首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 156 毫秒
1.
2.
3.
Lichenysins are surface-active lipopeptides with antibiotic properties produced nonribosomally by several strains of Bacillus licheniformis. Here, we report the cloning and sequencing of an entire 26.6-kb lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Three large open reading frames coding for peptide synthetases, designated licA, licB (three modules each), and licC (one module), could be detected, followed by a gene, licTE, coding for a thioesterase-like protein. The domain structure of the seven identified modules, which resembles that of the surfactin synthetases SrfA-A to -C, showed two epimerization domains attached to the third and sixth modules. The substrate specificity of the first, fifth, and seventh recombinant adenylation domains of LicA to -C (cloned and expressed in Escherichia coli) was determined to be Gln, Asp, and Ile (with minor Val and Leu substitutions), respectively. Therefore, we suppose that the identified biosynthesis operon is responsible for the production of a lichenysin variant with the primary amino acid sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile, with minor Leu and Val substitutions at the seventh position.Many strains of Bacillus are known to produce lipopeptides with remarkable surface-active properties (11). The most prominent of these powerful lipopeptides is surfactin from Bacillus subtilis (1). Surfactin is an acylated cyclic heptapeptide that reduces the surface tension of water from 72 to 27 mN m−1 even in a concentration below 0.05% and shows some antibacterial and antifungal activities (1). Some B. subtilis strains are also known to produce other, structurally related lipoheptapeptides (Table (Table1),1), like iturin (32, 34) and bacillomycin (3, 27, 30), or the lipodecapeptides fengycin (50) and plipastatin (29).

TABLE 1

Lipoheptapeptide antibiotics of Bacillus spp.
LipopeptideOrganismStructureReference
Lichenysin AB. licheniformisFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asn-D-Leu-L-Ile51, 52
Lichenysin BFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu23, 26
Lichenysin CFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Ile17
Lichenysin DFAa-L-Gln-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-IleThis work
Surfactant 86B. licheniformisFAa-L-Glxd-L-Leu-D-Leu-L-Val-L-Asxd-D-Leu-L-Ilee14, 15
L-Val
SurfactinB. subtilisFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu1, 7, 49
EsperinB. subtilisFAb-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leue45
L-Val 
Iturin AB. subtilisFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Ser32
Iturin CFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asne-L-Asne34
D-Ser-L-Thr 
Bacillomycin LB. subtilisFAc-L-Asp-D-Tyr-D-Asn-L-Ser-L-Gln-D-Proe-L-Thr3
D-Ser- 
Bacillomycin DFAc-L-Asp-D-Tyr-D-Asn-L-Pro-L-Glu-D-Ser-L-Thr30, 31
Bacillomycin FFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Thr27
Open in a separate windowaFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of the C-terminal amino acid. bFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of Asp5. cFA, β-amino fatty acid. The β-amino group forms a peptide bond with the carboxy group of the C-terminal amino acid. dOnly the following combinations of amino acid 1 and 5 are allowed: Gln-Asp or Glu-Asn. eWhere an alternative amino acid may be present in a structure, the alternative is also presented. In addition to B. subtilis, several strains of Bacillus licheniformis have been described as producing the lipopeptide lichenysin (14, 17, 23, 26, 51). Lichenysins can be grouped under the general sequence l-Glx–l-Leu–d-Leu–l-Val–l-Asx–d-Leu–l-Ile/Leu/Val (Table (Table1).1). The first amino acid is connected to a β-hydroxyl fatty acid, and the carboxy-terminal amino acid forms a lactone ring to the β-OH group of the lipophilic part of the molecule. In contrast to the lipopeptide surfactin, lichenysins seem to be synthesized during growth under aerobic and anaerobic conditions (16, 51). The isolation of lichenysins from cells growing on liquid mineral salt medium on glucose or sucrose basic has been studied intensively. Antimicrobial properties and the ability to reduce the surface tension of water have also been described (14, 17, 26, 51). The structural elucidation of the compounds revealed slight differences, depending on the producer strain. Various distributions of branched and linear fatty acid moieties of diverse lengths and amino acid variations in three defined positions have been identified (Table (Table11).In contrast to the well-defined methods for isolation and structural characterization of lichenysins, little is known about the biosynthetic mechanisms of lichenysin production. The structural similarity of lichenysins and surfactin suggests that the peptide moiety is produced nonribosomally by multifunctional peptide synthetases (7, 13, 25, 49, 53). Peptide synthetases from bacterial and fungal sources describe an alternative route in peptide bond formation in addition to the ubiquitous ribosomal pathway. Here, large multienzyme complexes affect the ordered recognition, activation, and linking of amino acids by utilizing the thiotemplate mechanism (19, 24, 25). According to this model, peptide synthetases activate their substrate amino acids as aminoacyl adenylates by ATP hydrolysis. These unstable intermediates are subsequently transferred to a covalently enzyme-bound 4′-phosphopantetheinyl cofactor as thioesters. The thioesterified amino acids are then integrated into the peptide product through a stepwise elongation by a series of transpeptidations directed from the amino terminals to the carboxy terminals. Peptide synthetases have not only awakened interest because of their mechanistic features; many of the nonribosomally processed peptide products also possess important biological and medical properties.In this report we describe the identification and characterization of a putative lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Cloning and sequencing of the entire lic operon (26.6 kb) revealed three genes, licA, licB, and licC, with structural patterns common to peptide synthetases and a gene designated licTE, which codes for a putative thioesterase. The modular organization of the sequenced genes resembles the requirements for the biosynthesis of the heptapeptide lichenysin. Based on the arrangement of the seven identified modules and the tested substrate specificities, we propose that the identified genes are involved in the nonribosomal synthesis of the portion of the lichenysin peptide with the primary sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile (with minor Val and Leu substitutions).  相似文献   

4.
5.
Forty-five different point mutations in POLG, the gene encoding the catalytic subunit of the human mitochondrial DNA polymerase (pol γ), cause the early onset mitochondrial DNA depletion disorder, Alpers syndrome. Sequence analysis of the C-terminal polymerase region of pol γ revealed a cluster of four Alpers mutations at highly conserved residues in the thumb subdomain (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) and two Alpers mutations at less conserved positions in the adjacent palm subdomain (Q879H, c.2637g→t and T885S, c.2653a→t). Biochemical characterization of purified, recombinant forms of pol γ revealed that Alpers mutations in the thumb subdomain reduced polymerase activity more than 99% relative to the wild-type enzyme, whereas the palm subdomain mutations retained 50–70% wild-type polymerase activity. All six mutant enzymes retained physical and functional interaction with the pol γ accessory subunit (p55), and none of the six mutants exhibited defects in misinsertion fidelity in vitro. However, differential DNA binding by these mutants suggests a possible orientation of the DNA with respect to the polymerase during catalysis. To our knowledge this study represents the first structure-function analysis of the thumb subdomain in pol γ and examines the consequences of mitochondrial disease mutations in this region.As the only DNA polymerase found in animal cell mitochondria, DNA polymerase γ (pol γ)3 bears sole responsibility for DNA synthesis in all replication and repair transactions involving mitochondrial DNA (1, 2). Mammalian cell pol γ is a heterotrimeric complex composed of one catalytic subunit of 140 kDa (p140) and two 55-kDa accessory subunits (p55) that form a dimer (3). The catalytic subunit contains an N-terminal exonuclease domain connected by a linker region to a C-terminal polymerase domain. Whereas the exonuclease domain contains essential motifs I, II, and III for its activity, the polymerase domain comprising the thumb, palm, and finger subdomains contains motifs A, B, and C that are crucial for polymerase activity. The catalytic subunit is a family A DNA polymerase that includes bacterial pol I and T7 DNA polymerase and possesses DNA polymerase, 3′ → 5′ exonuclease, and 5′-deoxyribose phosphate lyase activities (for review, see Refs. 1 and 2). The 55-kDa accessory subunit (p55) confers processive DNA synthesis and tight binding of the pol γ complex to DNA (4, 5).Depletion of mtDNA as well as the accumulation of deletions and point mutations in mtDNA have been observed in several mitochondrial disorders (for review, see Ref. 6). mtDNA depletion syndromes are caused by defects in nuclear genes responsible for replication and maintenance of the mitochondrial genome (7). Mutation of POLG, the gene encoding the catalytic subunit of pol γ, is frequently involved in disorders linked to mutagenesis of mtDNA (8, 9). Presently, more than 150 point mutations in POLG are linked with a wide variety of mitochondrial diseases, including the autosomal dominant (ad) and recessive forms of progressive external ophthalmoplegia (PEO), Alpers syndrome, parkinsonism, ataxia-neuropathy syndromes, and male infertility (tools.niehs.nih.gov/polg) (9).Alpers syndrome, a hepatocerebral mtDNA depletion disorder, and myocerebrohepatopathy are rare heritable autosomal recessive diseases primarily affecting young children (1012). These diseases generally manifest during the first few weeks to years of life, and symptoms gradually develop in a stepwise manner eventually leading to death. Alpers syndrome is characterized by refractory seizures, psychomotor regression, and hepatic failure (11, 12). Mutation of POLG was first linked to Alpers syndrome in 2004 (13), and to date 45 different point mutations in POLG (18 localized to the polymerase domain) are associated with Alpers syndrome (9, 14, 15). However, only two Alpers mutations (A467T and W748S, both in the linker region) have been biochemically characterized (16, 17).During the initial cloning and sequencing of the human, Drosophila, and chicken pol γ genes, we noted a highly conserved region N-terminal to motif A in the polymerase domain that was specific to pol γ (18). This region corresponds to part of the thumb subdomain that tracks DNA into the active site of both Escherichia coli pol I and T7 DNA polymerase (1921). A high concentration of disease mutations, many associated with Alpers syndrome, is found in the thumb subdomain.Here we investigated six mitochondrial disease mutations clustered in the N-terminal portion of the polymerase domain of the enzyme (Fig. 1A). Four mutations (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) reside in the thumb subdomain and two (Q879H, c.2637g→t and T885S, c.2653a→t) are located in the palm subdomain. These mutations are associated with Alpers, PEO, mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS), ataxia-neuropathy syndrome, Leigh syndrome, and myocerebrohepatopathy (
POLG mutationDiseaseGeneticsReference
G848SAlpers syndromeIn trans with A467T, Q497H, T251I-P587L, or W748S-E1143G in Alpers syndrome15, 35, 4350
Leigh syndromeIn trans with R232H in Leigh syndrome49
MELASIn trans with R627Q in MELAS38
PEO with ataxia-neuropathyIn trans with G746S and E1143G in PEO with ataxia50
PEOIn trans with T251I and P587L in PEO51, 52
T851AAlpers syndromeIn trans with R1047W48, 53
In trans with H277C
R852CAlpers syndromeIn trans with A467T14, 48, 50
In cis with G11D and in trans with W748S-E1143G or A467T
Ataxia-neuropathyIn trans with G11D-R627Q15
R853QMyocerebrohepatopathyIn trans with T251I-P587L15
Q879HAlpers syndrome with valproate-induced hepatic failureIn cis with E1143G and in trans with A467T-T885S35, 54
T885SAlpers syndrome with valproate-induced hepatic failureIn cis with A467T and in trans with Q879H-E1143G35, 54
Open in a separate windowOpen in a separate windowFIGURE 1.POLG mutations characterized in this study. A, the location of the six mutations characterized is shown in red in the primary sequence of pol γ. Four mutations, the G848S, T851A, R852C, and R853Q, are located in the thumb domain, whereas two mutations, the Q879H and T885S, are in the palm domain of the polymerase region. B, sequence alignment of pol γ from yeast to humans. The amino acids characterized in this study are shown in red. Yellow-highlighted amino acids are highly conserved, and blue-highlighted amino acids are moderately conserved.  相似文献   

6.
Single-cell-type Proteomics: Toward a Holistic Understanding of Plant Function     
Shaojun Dai  Sixue Chen 《Molecular & cellular proteomics : MCP》2012,11(12):1622-1630
  相似文献   

7.
The Atrazine Catabolism Genes atzABC Are Widespread and Highly Conserved     
Mervyn L. de Souza  Jennifer Seffernick  Betsy Martinez  Michael J. Sadowsky  Lawrence P. Wackett 《Journal of bacteriology》1998,180(7):1951-1954
Pseudomonas strain ADP metabolizes the herbicide atrazine via three enzymatic steps, encoded by the genes atzABC, to yield cyanuric acid, a nitrogen source for many bacteria. Here, we show that five geographically distinct atrazine-degrading bacteria contain genes homologous to atzA, -B, and -C. The sequence identities of the atz genes from different atrazine-degrading bacteria were greater than 99% in all pairwise comparisons. This differs from bacterial genes involved in the catabolism of other chlorinated compounds, for which the average sequence identity in pairwise comparisons of the known members of a class ranged from 25 to 56%. Our results indicate that globally distributed atrazine-catabolic genes are highly conserved in diverse genera of bacteria.Atrazine [2-chloro-4-(ethylamino)-6-(isopropylamino)- 1,3,5-triazine] is a herbicide used for controlling broad-leaf and grassy weeds and is relatively persistent in soils (51). Atrazine and other s-triazine compounds have been detected in ground and surface waters at levels exceeding the Environmental Protection Agency’s maximum contaminant level of 3 ppb (30).Microbial populations exposed to synthetic chlorinated compounds, such as atrazine, often respond by producing enzymes that degrade these molecules. Most of our current understanding of the genes and enzymes involved in atrazine degradation derives from studies using Pseudomonas strain ADP, in which the first three enzymatic steps in atrazine degradation have been defined (6, 14, 15, 48). The genes atz A, -B, and -C, which encode these enzymes, have been cloned and sequenced. Atrazine chlorohydrolase (AtzA), hydroxyatrazine ethylaminohydrolase (AtzB), and N-isopropylammelide isopropylaminohydrolase (AtzC) sequentially convert atrazine to cyanuric acid (6, 14, 15, 48) (Fig. (Fig.1).1). Cyanuric acid and related compounds are catabolized by many soil bacteria (10, 11, 17, 24, 26, 61), and by Pseudomonas sp. ADP, to carbon dioxide and ammonia (35). This provides the evolutionary pressure for the atzA, -B, and -C genes to permit bacterial growth on the more than one billion pounds of atrazine that have been applied to soils globally (20). Here we used a knowledge of the atzA, -B, and -C gene sequences to investigate the presence of homologous genes in other atrazine-degrading bacteria. In this study, we report that five atrazine-degrading microorganisms, which were recently isolated from geographically separated sites exposed to atrazine, contained nearly identical atzA, -B, and -C genes. Open in a separate windowFIG. 1Pathway for atrazine catabolism to cyanuric acid in Pseudomonas sp. strain ADP.

Atrazine-catabolizing bacteria used in this study.

Until recently, attempts at isolating bacteria (18) or fungi (27) that completely degrade atrazine to carbon dioxide, ammonia, and chloride were unsuccessful. While several microorganisms were shown to dealkylate atrazine, they were unable to displace the chlorine atom (41, 54). Since 1994, several research groups have independently isolated atrazine-degrading bacteria that displaced the chlorine atom and mineralized atrazine (3, 7, 13, 35, 39, 46). Six of these bacterial cultures, listed in Table Table1,1, were studied here, and the Clavibacter strain had been investigated previously (13).

TABLE 1

Recently isolated atrazine-catabolizing bacteria
GenusStrainLocation where isolatedYr reported (reference)
PseudomonasaADPAgricultural-chemical dealership site, Little Falls, Minn.1995 (35)
RalstoniaaM91-3Agricultural soil, Ohio1995 (46, 55)
Mixed cultureBasel, Switzerland1995 (57)
ClavibacterAgricultural soil, Riverside, Calif.1996 (13)
AgrobacteriumJ14aAgricultural soil, Nebraska1996 (39)
NDb38/38Atrazine-contaminated soil, Indiana1996 (3)
AlcaligenesaSG1Industrial settling pond, San Gabriel, La.1997 (7)
Open in a separate windowaIsolate identity based on 16S rRNA sequence analysis. bND, not determined. 

Detection of atzA, -B, and -C homologs in atrazine-degrading microorganisms by PCR analysis.

Recently isolated atrazine-degrading bacteria were screened for the presence of DNA homologous to the Pseudomonas strain ADP atzABC genes, which encode enzymes transforming atrazine to cyanuric acid (Fig. (Fig.1).1). Total genomic DNA was isolated from each of these bacteria as described elsewhere (49), and the PCR technique was used to amplify sequences internal to the atzA, -B, and -C genes as described elsewhere (13). Custom primers were designed specifically for atzA (5′CCATGTGAACCAGATCCT3′ and 5′TGAAGCGTCCACATTACC3′), atzB (5′TCACCGGGGATGTCGCGGGC3′ and 5′CTCTCCCGCATGGCATCGGG3′), and atzC (5′GCTCACATGCAGGTACTCCA3′ and 5′GTACCATATCACCGTTTGCCA3′) by using the Primer Designer package, version 2.01 (Scientific and Educational Software, State Line, Pa.), and were synthesized by Gibco BRL (Gaithersburg, Md.). PCR fragments were amplified by using Taq DNA polymerase (Gibco BRL) (22) and were separated from primers on a 1.0% agarose gel. The results of these studies (Fig. (Fig.2)2) indicated that PCR amplification consistently produced DNA fragments of 0.5 kb for all organisms when the atzA or -B primers were used and fragments of 0.6 kb when the atzC primers were used. Open in a separate windowFIG. 2PCR analysis with primers designed to amplify internal regions of atzA (lanes 1 to 5), atzB (lanes 6 to 10), and atzC (lanes 11 to 15). The atrazine-degrading bacteria analyzed were Pseudomonas strain ADP (35) (lanes 1, 6, and 11), Alcaligenes strain SGI (7) (lanes 2, 7, and 12), Ralstonia strain M91-3 (46) (lanes 3, 8, and 13), Agrobacterium strain J14a (39) (lanes 4, 9, and 14), and isolate 38/38 (3) (lanes 5, 10, and 15). Values to the right of the gel are sizes (in kilobase pairs).Southern hybridization analyses were performed on the PCR-amplified DNA as described elsewhere (49) to confirm the presence of homologous DNA. We used a 0.6-kb ApaI/PstI fragment from pMD4 (15), a 1.5-kb BglII fragment from pATZB-2 (6), and a 2.0-kb EcoRI/AvaI fragment from pTD2.5 (48) as probes for atzA, -B, and -C genes, respectively. DNA probes were labeled with [α-32P]dCTP by using the Rediprime Random Primer Labeling Kit (Amersham Life Science, Arlington Heights, Ill.) according to the manufacturer’s instructions. Southern hybridization analyses, performed under stringent conditions, confirmed that each strain contained DNA homologous to atzA, -B, and -C (data not shown). With strain M91-3 and isolate 38/38, however, in addition to the expected 0.5-kb atzB PCR product (Fig. (Fig.2,2, lanes 8 and 10), a 1.2-kb fragment was also obtained. However, no hybridization to this fragment was seen with the atzB probe. Similar investigations showed that a mixed culture obtained from Switzerland (Table (Table1),1), capable of degrading atrazine, also contained DNA homologous to all three atz genes (12).As a negative control, bacteria known not to degrade atrazine were analyzed. PCR analyses were carried out with genomic DNA from the following randomly chosen laboratory strains: Rhodococcus chlorophenolicus (1), Flavobacterium sp. (47), Streptomyces coelicolor M145 (21), Amycolatopsis mediterranei (19), Agrobacterium strain A136 and strain A348 (A136/pTiA6NC) (60), Arthrobacter globiformis MN1 (45), Bradyrhizobium japonicum (33), Rhizobium sp. strain NGR 234 (44), Pseudomonas NRRLB12228, and Klebsiella pneumoniae 99 (16). None of these strains contained DNA that was amplified by PCR using the primers designed to identify the atzA, -B, or -C gene (data not shown).

DNA sequences of atzA, -B, and -C homologs in atrazine-degrading microorganisms.

DNAs amplified from the five strains in Table Table11 with the atzA, -B, and -C primers were purified from gel slices by using the GeneClean II System (Bio 101, Inc., Vista, Calif.) and sequenced with a PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing kit (Perkin-Elmer Corp., Norwalk, Conn.) and an ABI model 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). The GCG sequence analysis software package (Genetics Computer Group, Inc., Madison, Wis.) was used for all DNA and protein sequence comparisons and alignments. Table Table22 summarizes these data. The PCR-amplified genes were ≥99% identical to the Pseudomonas strain ADP atzA, -B, and -C genes in all pairwise comparisons of DNA sequences. This remarkable sequence identity suggested that each atz gene in the different genera was derived from a common ancestor and that they have diverged evolutionarily only to a limited extent.

TABLE 2

Sequence identities of atzABC homologs from different atrazine-degrading bacteria
Strain% DNA sequence identitya
atzAatzBatzC
Pseudomonas ADP100100100
Alcaligenes SG199.2100100
Ralstonia M91-399.0100100
Agrobacterium J14a99.1100100
Isolate 38/3899.310099.8
Open in a separate windowaDNA sequences obtained from each strain by using the ataA, -B, and -C primers were compared with the atzABC gene sequences from Pseudomonas strain ADP. A review of the literature on other bacterial catabolic pathways indicated a much greater degree of divergence when genes encoding enzymes for the catabolism of other commercially relevant chlorinated compounds were compared (Table (Table3).3). As with atrazine, multiple bacterial strains that catabolize 1,2-dichloroethane, chloroacetic acid, 2,4-dichlorophenoxyacetate, dichloromethane, and 4-chlorobenzoate have been isolated. A comparison of the gene sequences encoding the initiating reactions in the catabolism of each of those compounds revealed that sequence divergence was comparatively high. In pairwise comparisons within each gene class, the average sequence identities ranged from 25 to 56% (divergence was 46 to 75%). With the atzABC genes, by contrast, there is at most a 1% sequence difference within the sequenced gene region (Table (Table2).2). Moreover, the atzB sequences were completely identical, and the atzC genes diverged by only 1 bp in one of the five strains tested. This suggests that the atz genes recently arose from a single origin and have become distributed globally. Similarly, identical parathion hydrolase genes were isolated from two bacteria representing different genera and global locations (40, 52, 53).

TABLE 3

Sequence comparisons of isofunctional bacterial enzymes that catabolize chlorinated compounds
GeneEnzymeAverage % protein sequence identitya (no. of pairwise comparisons)References
dhlA, dhaAHaloalkane dehalogenase25.0 (1)23, 31
dehC, hadL, dehH, dehH1, dehH2, dhlB, dehCI, dehCII2-Haloacid dehalogenase36.6 ± 3.9 (36)5, 25, 28, 29, 42, 43, 50, 59
tfdA2,4-Dichlorophenoxyacetate monooxygenase43.2 ± 4.6 (21)b34, 37, 38, 56, 58
dcmADichloromethane dehalogenase56.0 (1)4, 32
atzAAtrazine chlorohydrolase98.6 ± 0.12 (15)cThis study
atzBHydroxyatrazine ethylaminohydrolase100 (10)cThis study
atzCN-Isopropylammelide isopropylaminohydrolase99.0 ± 0.43 (10)cThis study
Open in a separate windowaAll possible pairwise alignments of translated gene sequences were made. The average percent identity is the mean of the percent identity values for all pairwise alignments ± standard error of the mean. bIncludes full protein sequences as well as partial protein sequences of ≥100 amino acids. cSequence identity within a 0.5-kb PCR product for atzA and -B and within a 0.6-kb PCR product for atzC. Six sequences were analyzed for atzA, and five were analyzed for atzB and -C. The data presented here provide further support for previous studies suggesting that hydroxyatrazine in the environment derives from biological processes (36), and not solely from abiotic reactions (2, 9). The present data, and a recent report by Bouquard et al. (8), indicate that the gene encoding atrazine chlorohydrolase is widespread in the United States and Europe.Our observations argue for a single, recent evolutionary origin of the atz genes and their subsequent global distribution. We have recently localized the atzA, -B, and -C genes to a large, self-transmissible plasmid in Pseudomonas strain ADP (12), and possible mechanisms of transfer of the atzABC genes are currently under investigation.  相似文献   

8.
Old knowledge and new technologies allow rapid development of model organisms     
Charles E. Cook  Janet Chenevert  Tomas A. Larsson  Detlev Arendt  Evelyn Houliston  Péter Lénárt 《Molecular biology of the cell》2016,27(6):882-887
  相似文献   

9.
Cultivation and Genomic,Nutritional, and Lipid Biomarker Characterization of Roseiflexus Strains Closely Related to Predominant In Situ Populations Inhabiting Yellowstone Hot Spring Microbial Mats     
Marcel T. J. van der Meer  Christian G. Klatt  Jason Wood  Donald A. Bryant  Mary M. Bateson  Laurens Lammerts  Stefan Schouten  Jaap S. Sinninghe Damsté  Michael T. Madigan  David M. Ward 《Journal of bacteriology》2010,192(12):3033-3042
  相似文献   

10.
Evidence for Interspecies Gene Transfer in the Evolution of 2,4-Dichlorophenoxyacetic Acid Degraders     
Catherine McGowan  Roberta Fulthorpe  Alice Wright  J. M. Tiedje 《Applied and environmental microbiology》1998,64(10):4089-4092
Small-subunit ribosomal DNA (SSU rDNA) from 20 phenotypically distinct strains of 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading bacteria was partially sequenced, yielding 18 unique strains belonging to members of the alpha, beta, and gamma subgroups of the class Proteobacteria. To understand the origin of 2,4-D degradation in this diverse collection, the first gene in the 2,4-D pathway, tfdA, was sequenced. The sequences fell into three unique classes found in various members of the beta and gamma subgroups of Proteobacteria. None of the α-Proteobacteria yielded tfdA PCR products. A comparison of the dendrogram of the tfdA genes with that of the SSU rDNA genes demonstrated incongruency in phylogenies, and hence 2,4-D degradation must have originated from gene transfer between species. Only those strains with tfdA sequences highly similar to the tfdA sequence of strain JMP134 (tfdA class I) transferred all the 2,4-D genes and conferred the 2,4-D degradation phenotype to a Burkholderia cepacia recipient.Bacteria capable of mineralizing 2,4-dichlorophenoxyacetic acid (2,4-D), a commonly used herbicide, are found in many different phylogenetic groups (2, 3, 7, 11, 22, 23). Evidence suggests that numerous variants of 2,4-D catabolic genes exist and that catabolic operons consist of a near-random mixing of these variants (7). Interspecies gene transfer is a well-documented phenomenon (13), and horizontal gene transfer of the 2,4-D-degrading plasmid pJP4 has been shown (3, 5). However, not all 2,4-D catabolic operons are found on plasmids (10, 11, 16, 20). The extent to which other 2,4-D genes have been exchanged in nature is unknown. The aim of this research was to assess the role of horizontal gene transfer in the evolution of 2,4-D-degrading strains. This article summarizes the results of two aspects of this work—the study of the transfer of the entire 2,4-D pathway by using standard mating experiments and a phylogenetic study of the tfdA gene. The tfdA gene codes for an α-ketoglutarate-dependent 2,4-D dioxygenase which converts 2,4-D into 2,4-dichlorophenol and glyoxylate (6). This 861-bp gene was first sequenced from Ralstonia eutropha JMP134 (19). Two more tfdA genes were cloned from chromosomal locations in Burkholderia strain RASC and Burkholderia strain TFD6 (16, 20). These proved to be identical to each other and 78.5% similar to the original. An alignment of the two variants allowed conserved areas to be identified and primers to be designed for the amplification of tfdA-like genes from other sources (24). Sequence analysis of putative tfdA fragments and the small-subunit ribosomal DNA (SSU rDNA) of the strains carrying them allowed us to construct phylogenies of the genes and their hosts and to look for congruency between them.

Mating experiments.

A collection of 2,4-D degraders containing 15 unique strains as determined by genomic fingerprinting (7) was used as a source of donors in a series of mating experiments (Table (Table1).1). Burkholderia cepacia D5, lacking the ability to grow on 2,4-D and not hybridizing to any tfd genes, was used as a recipient in mating experiments. Strain D5 contains neomycin phosphotransferase genes (nptII) carried on transposon Tn5 and is resistant to 50 μg each of kanamycin, carbenicillin, and bacitracin per ml. All of the 2,4-D strains used were sensitive to these antibiotics. Filter matings were performed with a donor-to-recipient ratio of 1:10. Colonies which grew on selective medium (500 ppm of 2,4-D in mineral salts agar [MMO] [23] including 50 μg of kanamycin, carbenicillin, and bacitracin per ml) were subjected to further tests. Their ability to catabolize 2,4-D was tested in liquid medium (same composition as that described above).

TABLE 1

2,4-D-degrading strains, geographic origins, and GenBank accession numbers
StrainGenBank accession no. (SSU rDNA)OriginMost similar to genus and/or speciesaTransferbtfdA typecGenBank accession no. (tfdA gene)Reference or source
JMP134AF049542AustraliaRalstonia eutropha+IM167303
EML1549AF049546OregonBurkholderia sp.+I2
TFD39AF049539SaskatchewanBurkholderia sp.+IU4319723
K712AF049543MichiganBurkholderia sp.+IU4327611
TFD9AF049537SaskatchewanAlcaligenes xylosoxidans+IU4327623
TFD41AF049541MichiganRalstonia eutropha+I23
TFD38AF049540MichiganRalstonia eutropha+NDc23
TFD23AF049536MichiganRhodoferax fermentans+IU4327623
RASCAF049544OregonBurkholderia sp.(+)IIU257172
TFD6AF049546MichiganBurkholderia sp.II23
TFD2AF049545MichiganBurkholderia sp.II23
TFD31AF049536SaskatchewanRhodoferax fermentansIII23
B6-9AF049538OntarioRhodoferax fermentansNDIIIU431969
I-18U22836OregonHalomonas sp.NDIIIU2249915
K1443AF049531MichiganSphingomonas sp.d11
2,4-D1AF049535MontanaSphingomonas sp.R. Sanford
B6-5AF049533OntarioSphingomonas sp.ND9
B6-10AF049534OntarioSphingomonas sp.ND9
EML146AF049532OregonSphingomonas sp.2
M1AF049530French PolynesiaRhodospeudomonas sp.NDR. Fulthorpe
Open in a separate windowaThe generus and/or species most similar to the strain is given based on similarities of SSU rDNA sequences. bSymbols: +, able to transfer 2,4-D degradation to B. cepacia D5; (+), able to transfer at very low frequency; −, no transfer detected. cND, not determined. d—, no amplificate was obtained. The disappearance of 2,4-D from the culture medium was monitored by high-performance liquid chromatography. Cells were removed by centrifugation, and the supernatant was filtered through 0.2-μm-pore-size filters. These samples were then analyzed on a Lichrosorb Rp-18 column (Anspec Co., Ann Arbor, Mich.) with 60% methanol–40% 0.1% H3PO4 as the eluant. 2,4-D was detected by measuring light absorption at 230 nm. The presence of tfd genes was detected by hybridizing colony blots with a DNA probe derived from the entire pJP4 plasmid. The identity of the colonies was confirmed by probing with the nptII gene of Tn5 (found in B. cepacia D5). Probes were labeled with random hexanucleotides incorporating [32P]dCTP (3,000 Ci/mmol; New England Nuclear, Boston, Mass.). Hybridizations were done under high-stringency conditions by using 50% formamide and Denhardt’s solution (18) at 42°C. Of the 15 unique strains tested, 9 transferred 2,4-D degradation abilities to D5. This transfer was confirmed by hybridization with pJP4 for eight of these strains. B. cepacia RASC could transfer degradative abilities, but neither it nor the transconjugant hybridized to the pJP4 probe. Work subsequent to this study has confirmed that the genes carried by RASC do not hybridize to those found on pJP4 under high-stringency conditions (7).

Phylogenetic analyses.

Total genomic DNA was isolated from 20 unique 2,4-D-degrading strains (including all 15 used for mating experiments) grown on 500 ppm of 2,4-D mineral salts medium amended with 50 ppm of yeast extract. SSU rDNA was amplified by using fD1 and rD1 as primers (25). Putative tfdA fragments were amplified by using primers TVU and TVL as previously described (24). PCR products were purified with a Gene Clean kit (Bio 101, La Jolla, Calif.). Sequencing was done with an Applied Biosystems model 373A automatic sequencer (Perkin-Elmer Cetus) by using fluorescently labeled dye termination at the Michigan State University Sequencing Facility. The sequencing primer used for SSU rDNA fragments was 519R (5′ GTA TTA CCG CGG CTG CTG G-3′). For tfdA fragments, the sequencing primers were the same as the amplification primers. GenBank accession numbers for these sequences are given in Table Table11.The SSU rDNA sequences were compared to sequences in GenBank by using the Basic Local Alignment Search Tool (BLAST) (1), and those strains with the highest maximal segment pair scores were retrieved from GenBank and included in the phylogenetic analysis. Sequences were aligned manually with the software SeqEd (Applied Biosystems) and with MacClade (14). Sites where nucleotides were not resolved for all sequences were deleted from the alignment, as were those nucleotides corresponding to the small loop in this region that is absent in the alpha subgroup of the class Proteobacteria. These deletions left 283 unambiguous sites for the construction of the SSU rDNA phylogenies. Phylogenetic trees were constructed by using the neighbor-joining analysis of pairwise Jukes-Cantor distances (4), and the topology was confirmed by using the maximum parsimony method PAUP (21). Desulfomonile tiedjei of the δ-Proteobacteria was used as an outgroup. Bootstrap analysis based on 100 replicates was used to place confidence estimates on the tree. Only bootstrap values of greater than 50 were used.

2,4-D degrader diversity.

The 2,4-D degraders in this study were distributed throughout the alpha, beta, and gamma subgroups of the Proteobacteria (Fig. (Fig.1).1). The lack of representation of gram-positive bacteria is likely a reflection of isolation methods, not of the lack of gram-positive 2,4-D degraders. The majority of these strains were members of the beta subgroup of Proteobacteria, five of which were most closely related to the genus Burkholderia, having at least 92% sequence similarity with each other. Three were closely related to Rhodoferax fermentans (close to the class Comamonadaceae), three were related to Ralstonia eutropha, and one was related to Alcaligenes xylosoxidans. TFD39 falls outside any clear cluster. One member of the γ-Proteobacteria, strain I-18, a haloalkaliphile, was found to be closely related to the salt-loving genus Halomonas (15). The remaining six strains all clustered in the alpha branch of Proteobacteria (Fig. (Fig.1).1). Of this subgroup, five were most closely related to the genus Sphingomonas. One member of the α-Proteobacteria, strain M1, which is the most oligotrophic and slow growing of all the strains used in this study, is 97% similar to Rhodopseudomonas palustris. The character of strain M1 correlates well with its phylogenetic placement near the slow-growing genus Bradyrhizobium. Open in a separate windowFIG. 1Neighbor-joining dendrogram (Jukes-Cantor distances) of SSU rDNA from 2,4-D-degrading bacteria (indicated in boldface type) and reference strains (indicated in italic type). Class I (•), class II (▴), and class III (■) types of tfdA genes are indicated. Bootstrap confidence limits (percentages) are indicated above each branch. Scale bar represents a Jukes-Cantor distance of 0.01.

tfdA gene fragments.

tfdA gene fragments were successfully amplified and sequenced from 10 strains of β-Proteobacteria and 1 strain of γ-Protobacteria. None of the strains from the α-Proteobacteria gave any amplificates with these primers. These 313 contiguous nucleotides were aligned with additional tfdA sequences from JMP134 and from strain RASC (Fig. (Fig.2).2). Three distinct classes of tfdA gene sequences with slight variations in each class were found. Class I included fragments from JMP134, TFD39, TFD23, K712, and TFD9 that differed from each other by 2 bp at the most. Class I tfdA genes are probably plasmid encoded. All strains with a class I tfdA gene examined so far contained broad-host-range, self-transmissible plasmids containing 2,4-D genes (2, 3, 11, 17). All of the strains with a class I tfdA gene were able to transfer the 2,4-D phenotype in the mating studies reported above. The class II tfdA sequences included identical fragments amplified from RASC, TFD6, and TFD2 which were 76% similar to those in class I. Class III included identical fragments from strains TFD31, B6-9, and I-18 which were 77% similar to class I genes and 80% similar to class II genes. Both class II and III tfdA genes differed from each other and from class I genes in the same nine sites corresponding to the third base pair of the codons. The tfdA phylogenetic tree is a simple one, with three distinct branches that are incongruent with the SSU rDNA-derived phylogeny (Fig. (Fig.3).3). Class I tfdA sequences were found in Burkholderia-like strains, in strains related to the Comamonas-Rhodoferax group, and in the Ralstonia-Acaligenes group, all in the β-Proteobacteria. Class II sequences are less widely distributed, found only in Burkholderia-like branches. However, even in this subgroup, this tfdA variant is found in strains that differ by 7% at the SSU rDNA level (RASC and TFD2). However, the class III sequences were most interesting, being found both in the Comamonas-Rhodoferax group and in a strain of the γ-Proteobacteria, I-18, strains that differ by 24% at the SSU rDNA level. Class III genes have since been found in a collection of randomly isolated non-2,4-D degraders, including gram-positive bacilli, as well as in various gram-negative bacteria, even though the gene is not expressed (10). Open in a separate windowFIG. 2Alignment of 313 nucleotides of internal fragments of tfdA genes from representative strains. Nucleotides identical to tfdA from pJP4 are represented by periods.Open in a separate windowFIG. 3Phylogenetic incongruency of tfdA genes and SSU rDNA from diverse 2,4-D-degrading bacteria. Dendrograms for tfdA and SSU rDNA are indicated. Shading indicates the type of tfdA sequence, either class I, II, or III. Note that branch lengths are not drawn to scale.An interesting result was the detection of two different tfdA gene variants in sibling strains. TFD23 and TFD31 are identical at the ribosomal gene level, but one harbors a class I gene and the other harbors a class III gene. Similarly, TFD6 and EML159 are rRNA siblings that carry a class II and class I gene, respectively.None of the α-Proteobacteria yielded a PCR product when amplified with the conserved tfdA primers. This finding complements our observation that none of these bacteria hybridized to the tfdA gene, even under conditions of low stringency, indicating that any tfdA-like genes in the α-Proteobacteria are likely to be more divergent from the ones sequenced here (7, 11). In addition, none of the Sphingomonas strains in the study hybridized with a whole pJP4 probe, and similarly, no Sphingomonas strains scored positive for transfer of 2,4-D-degrading ability to recipient B. cepacia D5. Together these results suggest a reduced gene flow between members of the α- and β- or γ-Proteobacteria or poor gene expression of β- or γ-derived genes by α-Proteobacteria. Although plasmid pJP4 is a broad-host-range plasmid and has been known to transfer to α-Proteobacteria such as Rhizobium and Agrobacterium species and to γ-Proteobacteria such as Pseudomonas putida, Pseudomonas fluorescens, and Pseudomonas aeruginosa, the 2,4-D pathway is not expressed in these strains of the α- or γ-Proteobacteria (3). Phylogenetically limited expression of plasmid-borne 3-chlorobenzoate-degradative genes has also been noted for the pseudomonads (8). Subsequent studies have found divergent but related sequences for the tfdB and tfdC genes in 2,4-D-degrading Sphingomonas strains (7, 12, 24).With the exceptions of the minor differences within the class I pJP4-like tfdA sequences, there were no intermediate tfdA sequences. The most likely explanation of this is that the rate of horizontal transfer of the tfd genes is high relative to the rate at which mutations can accumulate. Examination of sequences of tfdA genes from a greater variety of organisms may turn up more intermediate variation.  相似文献   

11.
Proteomics of Saccharomyces cerevisiae Organelles     
Elena Wiederhold  Liesbeth M. Veenhoff  Bert Poolman    Dirk Jan Slotboom 《Molecular & cellular proteomics : MCP》2010,9(3):431-445
  相似文献   

12.
Genetic Transformation and Mutagenesis via Single-Stranded DNA in the Unicellular,Diazotrophic Cyanobacteria of the Genus Cyanothece     
Hongtao Min  Louis A. Sherman 《Applied and environmental microbiology》2010,76(22):7641-7645
  相似文献   

13.
Dominant Bacteria and Biomass in the Kuytun 51 Glacier     
Shu-Rong Xiang  Tian-Cui Shang  Yong Chen  Ze-Fan Jing  Tandong Yao 《Applied and environmental microbiology》2009,75(22):7287-7290
  相似文献   

14.
Neurodegeneration and Alzheimer's disease (AD). What Can Proteomics Tell Us About the Alzheimer's Brain?     
Guillermo Moya-Alvarado  Noga Gershoni-Emek  Eran Perlson  Francisca C. Bronfman 《Molecular & cellular proteomics : MCP》2016,15(2):409-425
  相似文献   

15.
RNA Polymerase I Transcription Silences Noncoding RNAs at the Ribosomal DNA Locus in Saccharomyces cerevisiae     
Elisa Cesarini  Francesca Romana Mariotti  Francesco Cioci  Giorgio Camilloni 《Eukaryotic cell》2010,9(2):325-335
  相似文献   

16.
Nooks and Crannies in Type VI Secretion Regulation     
Christophe S. Bernard  Yannick R. Brunet  Erwan Gueguen  Eric Cascales 《Journal of bacteriology》2010,192(15):3850-3860
  相似文献   

17.
Immunological Mechanisms Mediating Hantavirus Persistence in Rodent Reservoirs     
Judith D. Easterbrook  Sabra L. Klein 《PLoS pathogens》2008,4(11)
Hantaviruses, similar to several emerging zoonotic viruses, persistently infect their natural reservoir hosts, without causing overt signs of disease. Spillover to incidental human hosts results in morbidity and mortality mediated by excessive proinflammatory and cellular immune responses. The mechanisms mediating the persistence of hantaviruses and the absence of clinical symptoms in rodent reservoirs are only starting to be uncovered. Recent studies indicate that during hantavirus infection, proinflammatory and antiviral responses are reduced and regulatory responses are elevated at sites of increased virus replication in rodents. The recent discovery of structural and non-structural proteins that suppress type I interferon responses in humans suggests that immune responses in rodent hosts could be mediated directly by the virus. Alternatively, several host factors, including sex steroids, glucocorticoids, and genetic factors, are reported to alter host susceptibility and may contribute to persistence of hantaviruses in rodents. Humans and reservoir hosts differ in infection outcomes and in immune responses to hantavirus infection; thus, understanding the mechanisms mediating viral persistence and the absence of disease in rodents may provide insight into the prevention and treatment of disease in humans. Consideration of the coevolutionary mechanisms mediating hantaviral persistence and rodent host survival is providing insight into the mechanisms by which zoonotic viruses have remained in the environment for millions of years and continue to be transmitted to humans.Hantaviruses are negative sense, enveloped RNA viruses (family: Bunyaviridae) that are comprised of three RNA segments, designated small (S), medium (M), and large (L), which encode the viral nucleocapsid (N), envelope glycoproteins (GN and GC), and an RNA polymerase (Pol), respectively. More than 50 hantaviruses have been found worldwide [1]. Each hantavirus appears to have coevolved with a specific rodent or insectivore host as similar phylogenetic trees are produced from virus and host mitochondrial gene sequences [2]. Spillover to humans causes hemorrhagic fever with renal syndrome (HFRS) or hantavirus cardiopulmonary syndrome (HCPS), depending on the virus [3][5]. Although symptoms vary, a common feature of both HFRS and HCPS is increased permeability of the vasculature and mononuclear infiltration [4]. Pathogenesis of HRFS and HCPS in humans is hypothesized to be mediated by excessive proinflammatory and CD8+ T cell responses ().

Table 1

Summary of Immune Responses in Humans during Hantavirus Infection.
Categorical ResponseImmune MarkerEffect of InfectionVirus Speciesa In Vitro/In VivoTissue or Cell Typeb, Phase of Infectionc References
Innate RIG-IElevatedSNVIn vitroHUVEC, ≤24 h p.i. [79]
ReducedNY-1VIn vitroHUVEC, ≤24 h p.i. [37]
TLR3ElevatedSNVIn vitroHUVEC, ≤24 h p.i. [79]
IFN-βElevatedPUUV, PHV, ANDVIn vitroHSVEC, HMVEC-L, ≤24 h p.i. [36],[80]
ReducedTULV, PUUV NSsIn vitroCOS-7 and MRC5 cells, ≤24 h p.i. [32],[33]
IFN-αElevatedPUUV, HTNVIn vitroMФ, DCs, 4 days p.i. [30]
No changeHTNVIn vivoBlood, acute [81]
IRF-3, IRF-7ElevatedSNV, HTNV, PHV, ANDVIn vitroHMVEC-L, ≤24 h p.i. [33],[38]
MxAElevatedHTNV, NY-1V, PHV, PUUV, ANDV, SNV, TULVIn vitroMФ,HUVEC,HMVEC-L, 6 h–4 days p.i. [36], [39][41],[79]
MHC I and IIElevatedHTNVIn vitroDCs, 4 days p.i. [30]
CD11bElevatedPUUVIn vivoBlood, acute [82]
CD40, CD80, CD86ElevatedHTNVIn vitroDCs, 4 days p.i. [30],[83]
NK cellsElevatedPUUVIn vivoBAL, acute [84]
Proinflammatory/Adhesion IL-1βElevatedSNV, HTNVIn vivoBlood, lungs, acute [85],[86]
IL-6ElevatedSNV, PUUVIn vivoBlood, lungs, acute [85],[87],[88]
TNF-αElevatedPUUV, SNV, HTNVIn vivoBlood, lungs, kidney, acute [85],[86],[88],[89]
ElevatedHTNVIn vitroDCs, 4 days p.i. [30]
CCL5ElevatedSNV, HTNVIn vitroHMVEC-L, HUVEC, 12 h–4 days p.i. [38],[39],[90]
CXCL8ElevatedPUUVIn vivoBlood, acute [82]
ElevatedPUUVIn vivoMen, blood, acute [62]
ElevatedTULV, PHV, HTNVIn vitroHUVEC, MФ, 2–4 days p.i. [39],[91]
CXCL10ElevatedSNV, HTNV, PHVIn vitroHMVEC-L,HUVEC, 3–4 days p.i. [38],[39]
ElevatedPUUVIn vivoMen, blood, acute [62]
IL-2ElevatedSNV, HTNV, PUUVIn vivoBlood, lungs, acute [82],[86]
Nitric oxideElevatedPUUVIn vivoBlood, acute [92]
GM-CSFElevatedPUUVIn vivoWomen, blood, acute [62]
ICAM, VCAMElevatedPUUVIn vivoKidney, acute [87]
ElevatedHTNV, PHVIn vitroHUVEC, 3–4 days p.i. [30],[39]
E-selectinElevatedPUUVIn vivoBlood, acute [82]
CD8+ and CD4+ T cells IFN-γElevatedHTNV, SNVIn vivoBlood, CD4+,CD8+, lungs, acute [81],[86]
CD8+ElevatedDOBV, PUUV, HTNVIn vivoBlood, BAL, acute [52],[84],[93]
Virus-specific IFN-γ+CD8+ElevatedPUUV, SNVIn vivoPBMC, acute [45],[94]
Perforin, Granzyme BElevatedPUUVIn vivoBlood, acute [95]
CD4+CD25+ “activated”ElevatedDOBV, PUUVIn vivoPBMC, acute [89],[93]
IL-4ElevatedSNVIn vivoLungs, acute [86]
Regulatory “suppressor T cells”d ReducedHTNVIn vivoBlood, acute [52]
IL-10ElevatedPUUVIn vivoBlood, acute [86]
TGF-βElevatedPUUVIn vivoKidney, acute [89]
Humoral IgM, IgG, IgA, IgEElevatedAll hantavirusesIn vivoBlood [4]
Open in a separate windowaSNV, Sin Nombre virus; NY-1V, New York-1 virus; PUUV, Puumala virus; PHV, Prospect Hill virus; ANDV, Andes virus; TULV, Tula virus; HTNV, Hantaan virus; DOBV, Dobrava virus.bHUVEC, human umbilical vascular endothelial cells; HSVEC, human saphenous vein endothelial cells; HMVEC-L, human lung microvascular endothelial cells; COS-7, African green monkey kidney fibroblasts transformed with Simian virus 40; MRC5, human fetal lung fibroblasts; MФ, macrophages; DCs, dendritic cells; BAL, bronchoalveolar lavage, PBMC, human peripheral blood mononuclear cells.cAcute infection is during symptomatic disease in patients.dSuppressor T cells likely represent cells currently referred to as regulatory T cells.

Table 2

Summary of Immune Responses in Rodents during Hantavirus Infection.
Categorical ResponseImmune MarkerEffect of InfectionVirus Speciesa Host, Tissue or Cell Typeb Phase of Infectionc References
Innate TLR7ReducedSEOVMale Norway rats, lungsAcute, Persistent [19]
ElevatedSEOVFemale Norway rats, lungsAcute, Persistent [19]
RIG-IElevatedSEOVFemale Norway rats, lungsAcute, Persistent [19]
ElevatedSEOVNewborn rats, thalamusAcute [96]
TLR3ElevatedSEOVMale Norway rats, lungsAcute, Persistent [19]
IFN-βReducedSEOVMale Norway rats, lungsAcute, Persistent [19],[61]
ElevatedSEOVFemale Norway rat lungsAcute [19],[61]
Mx2ReducedSEOVMale Norway rats, lungsAcute, Persistent [19],[60]
ElevatedSEOVFemale Norway rats, lungsAcute, Persistent [19],[60]
ElevatedHTNV, SEOVMiced, fibroblasts transfected with Mx23–4 days p.i. [97]
JAK2ElevatedSEOVFemale Norway rats, lungsAcute [60]
MHC IIElevatedPUUVBank volesGenetic susceptibility [74]
Proinflammatory/Adhesion IL-1βReducedSEOVMale Norway rats, lungsPersistent [29]
IL-6ReducedSEOVMale and female Norway rats, lungsAcute, Persistent [29],[61]
ElevatedSEOVMale rats, spleenAcute [29]
TNF-αReducedHTNVNewborn miced, CD8+, spleenAcute [49],[50]
ReducedSEOVMale Norway rats, lungsAcute, Persistent [29],[42],[61]
ElevatedSEOVFemale Norway rats, lungsPersistent [61]
CX3CL1, CXCL10ReducedSEOVMale Norway rats, lungsAcute, Persistent [29]
ElevatedSEOVMale Norway rats, spleenAcute [29]
CCL2, CCL5ElevatedSEOVMale Norway rats, spleenAcute [29]
NOS2ReducedSEOVMale Norway rats, lungsAcute, Persistent [29],[61]
ElevatedSEOVMale Norway rats, spleenAcute [29]
ElevatedHTNVMouse MФd, in vitro6 h p.i. [98]
VCAM, VEGFElevatedSEOVMale Norway rats, spleenAcute [29]
CD8+ and CD4+ T cells CD8+ReducedHTNVNewborn miced, spleenPersistent [50]
ElevatedHTNVSCID miced, CD8+ transferred, spleenPersistence [49]
ElevatedSEOVFemale Norway rats, lungsPersistent [61]
IFN-γElevatedSEOVFemale Norway rats, lungsPersistent [61]
ElevatedSEOVMale Norway rats, spleenAcute [29]
ElevatedSEOVMale and female Norway rats, splenocytesAcute [20]
ElevatedSNVDeer mice, CD4+ T cellsAcute [48]
ElevatedHTNVNewborn miced, CD8+ T cells, spleenAcute [50]
ReducedHTNVNewborn miced, CD8+ T cells, spleenPersistent [99]
IFN-γRElevatedSEOVFemale Norway rats, lungsAcute, Persistent [60]
ReducedSEOVMale Norway rats, lungsPersistent [60]
T cellsElevatedSEOVNude ratsPersistence [47]
ElevatedHTNVNude miced Persistence [100]
IL-4ReducedSEOVMale Norway rats, lungsAcute, Persistent [61]
ElevatedSNVDeer mice, CD4+ T cellsAcute [48]
ElevatedSEOVMale and female Norway rats, splenocytesAcute [20]
Regulatory Regulatory T cellsElevatedSEOVMale Norway rats, lungsPersistent [42],[61]
FoxP3ElevatedSEOVMale Norway rats, lungsPersistent [29],[42],[61]
TGF-βElevatedSEOVMale Norway rats, lungsPersistent [29]
SNVDeer mice, CD4+ T cellsPersistent [48]
IL-10ReducedSEOVMale Norway rats, lungs and spleenAcute, Persistent [29]
ElevatedSNVDeer mice, CD4+ T cellsAcute [48]
Humoral IgGElevatedSNVDeer micePersistent [12],[57]
ElevatedSEOVNorway ratsPersistent [16],[17]
ElevatedHTNVField micePersistent [15]
ElevatedPUUVBank volesPersistent [14]
ElevatedBCCVCotton ratsPersistent [18],[58]
Open in a separate windowaSEOV, Seoul virus; HTNV, Hantaan virus, PUUV, Puumala virus; SNV, Sin Nombre virus; PUUV, Puumala virus; BCCV, Black Creek Canal virus.bMФ, macrophages.cAcute infection is <30 days p.i. and persistent infection is ≥30 days p.i.d Mus musculus, non-natural reservoir host for hantaviruses.In contrast to humans, hantaviruses persistently infect their reservoir hosts, presumably causing lifelong infections [6]. Hantaviruses are shed in saliva, urine, and feces, and transmission among rodents or from rodents to humans occurs by inhalation of aerosolized virus in excrement or by transmission of virus in saliva during wounding [7],[8]. Although widely disseminated throughout the rodent host, high amounts of hantaviral RNA and antigen are consistently identified in the lungs of their rodent hosts, suggesting that the lungs may be an important site for maintenance of hantaviruses during persistent infection [9][18]. Hantavirus infection in rodents is characterized by an acute phase of peak viremia, viral shedding, and virus replication in target tissues, followed by a persistent phase of reduced, cyclical virus replication despite the presence of high antibody titers (Figure 1) [12][16], [18][20]. The onset of persistent infection varies across hantavirus–rodent systems, but generally the acute phase occurs during the first 2–3 weeks of infection and virus persistence is established thereafter (Figure 1).Open in a separate windowFigure 1Kinetics of Hantavirus Infection in Rodents.Adapted from Lee et al. [15] and others [12][14],[16],[18],[20], the kinetics of relative hantaviral load in blood (red), saliva (green), and lung tissue (blue) and antibody responses (black) during the acute and persistent phases of infection are represented. The amount of genomic viral RNA, infectious virus titer, and/or relative amount of viral antigen have been incorporated as relative hantaviral load. The antibody response is integrated as the relative amount of anti-hantavirus IgG and/or neutralizing antibody titers.Hantavirus infection alone does not cause disease, as reservoir hosts and non-natural hosts (e.g., hamsters infected with Sin Nombre virus [SNV] or Choclo virus) may support replicating virus in the absence of overt disease [12],[14],[16],[18],[21],[22]. Our primary hypothesis is that certain immune responses that are mounted in humans during hantavirus infection are suppressed in rodent reservoirs to establish and maintain viral persistence, while preventing disease (相似文献   

18.
Characterization of the Cpx Regulon in Escherichia coli Strain MC4100     
Nancy L. Price  Tracy L. Raivio 《Journal of bacteriology》2009,191(6):1798-1815
  相似文献   

19.
Functional Characterization of Naturally Occurring Variants of Human Hepatitis B Virus Containing the Core Internal Deletion Mutation     
Thomas Ta-Tung Yuan  Min-Hui Lin  Sui Min Qiu  Chiaho Shih 《Journal of virology》1998,72(3):2168-2176
  相似文献   

20.
Basal levels of inorganic elements,genetic damages,and hematological values in captive Falco peregrinus     
Julian Stocker  Ana Paula Morel  Micaele Wolfarth  Johnny Ferraz Dias  Liana Appel Boufleur Niekraszewicz  Cristina V. Cademartori  Fernanda R. da Silva 《Genetics and molecular biology》2022,45(2)
It is essential to determine the basal pattern of different biomarkers for future evaluation of animal health and biomonitoring studies. Due to their great displacement capacity and to being at the top of their food chains, birds of prey are suitable for monitoring purposes. Furthermore, some birds of prey are adapted to using resources in urban places, providing information about this environment. Thus, this study determined the basal frequency of micronuclei and other nuclear alterations in peripheral blood erythrocytes of Falco peregrinus. Hematological and inorganic elements analysis were also performed. For this purpose, 13 individuals (7 females and 6 males) were sampled in private breeding grounds. Micronucleus, nuclear buds, nucleoplasmic bridges, notched nuclei, binucleated cells and nuclear tails were quantified. Inorganic elements detected included the macro-elements Ca, P, Mg, Na, Cl, S and K as well as the micro-elements Fe, Al and Zn. Our study found similar values compared to previous studies determining the reference ranges of hematologic parameters in falcons. The only different value was observed in the relative number of monocytes. Thus, this study is the first approach to obtaining reference values of cytogenetic damage in this species and could be useful for future comparisons in biomonitoring studies. Keywords: Biological monitoring, basal DNA damage, falcon, reference value, hematology

In recent years, different organisms have provided information about environmental quality (Parmar et al., 2016). Birds of prey due to their great displacement capacity and to being at the top of the food chains are suited for monitoring purposes (Lodenius and Solonen, 2013). Top bird predators have been evaluated regarding exposure to pesticide, metal and other chemical substances (Lodenius and Solonen, 2013; de Wit et al., 2019; Aver et al., 2020; Frixione and Rodríguez-Estrella, 2020). In biomonitoring studies, it is possible to evaluate biomarkers at the molecular, cellular, morphological and physiological levels in different species. Among the available bioassays, there are several that are more invasive or less invasive to animals (Valdes, 2010). A technique that estimates the exposure level in DNA without having to sacrifice the organism exposed is the Erythrocyte Nuclear Abnormalities (ENA) assay. The ENA assay is considered a proper tool for detecting the DNA damage because its analysis includes micronuclei and the other nuclear alterations analyses (Gomes et al., 2015). Most studies about genotoxicity in birds include only micronuclei in analysis, excluding the other nuclear variations, which may be more frequent than micronuclei. Nuclei with smaller or larger evaginations, nuclei with vacuoles and nuclei with a deep slit are alterations that can also be observed (Carrasco et al., 1990; Quero et al., 2016; de Souza et al., 2017; de Faria et al., 2018; Silveira et al., 2022).Some birds of prey, such as Falco peregrinus, have adapted to using resources in urban areas. According to Pollack et al. (2017) these species provide information, especially about the widespread consequences of urbanization, giving an insight into its influence on animal behavior and physiology, as well as guiding investigations in humans. The aim of this study was to determine the frequency of micronuclei and other nuclear alterations in peripheral blood erythrocytes of Falco peregrinus, as a first approach to obtain reference values of cytogenetic damage in this species. Furthermore, knowledge was obtained regarding other physiological parameters, such as hematological analysis and the quantification of inorganic elements.All birds used in this study belong to Criatório Hayabusa - Consultoria Ambiental Ltda., a wildlife center and commercial breeder located in São Francisco de Paula (Rio Grande do Sul, Brazil). The area has approximately 48 ha and is considered to be in an excellent state of conservation, distant from urban areas and areas where crops are cultivated. The individuals are housed in outdoor aviary cages (4 m (width) x 4 m (height) x 4 m (length)) containing a couple of birds each. The birds had been captive for at least four years and were fed daily with Coturnix coturnix and water ad libitum. The sex of the birds was determined through external sexual size dimorphism, wherein the male can carry up to 50% less loads than the female (Mills et al., 2019). In addition, the bird’s age (juvenile/adult) was defined according to information on a metal ring.The procedures involving animals were conducted in compliance with the guidelines approved by the Committee on Ethics in the Use of Animals of the Universidade La Salle (CEUA-UNILASALLE, number 003/2017), and authorized by the Ministry of the Environment (MMA) through the Sistema de Autorização e Informação da Biodiversidade (SISBIO) for scientific activities (number 59921-1).Blood samples of 13 individuals, collected by the center’s veterinarian, were drawn from the ulnar vein of the wing using heparinised syringes. The samples were immediately smeared onto clean glass slides, where two slides were prepared per individual. The slides were sent to the laboratory. Remaining blood samples were also transported to the laboratories at below 8 ºC for the analysis of hematological and inorganic elements. The animals were identified as to sex and age (juvenile/adult). All the birds sampled were apparently healthy, without any signs of illness.In the laboratory, the slides were prepared according to Grisolia and Cordeiro (2000). At least 2,000 erythrocytes for each animal were scored using bright-field optical microscopy at a magnification of ×200-1000. Coded slides were blind-scored by a single observer. The presence of ENA was evaluated according to procedures by Carrasco et al. (1990) and Quero et al. (2016), using mature erythrocytes to estimate the frequency of the following nuclear lesions: (i) micronuclei (MN); (ii) nuclear buds (NBud); (iii) binucleated cell (BN); (iv) nuclear tails (NT); (v) nucleoplasmic (NB); and (vi) Notched (NO).The content of inorganic elements in the blood samples was analyzed by particle-induced X-ray emission (PIXE) (Johansson et al., 1995). As the PIXE system requires the use of solid samples, the blood samples were dried at 60 °C. Once dried, the samples were homogenized and pressed into 2 mm thick pellets before being placed in the target holder inside the reaction chamber (pressure about 10-5 mbar). A 3 MV Tandetron accelerator provided a 2.0 MeV proton beam with an average current of 3 nA at the target. The X-rays produced in the samples were detected by a Si(Li) detector with an energy resolution of ca. 150 eV at 5.9 keV. The spectra were analyzed with the GUPIX software package and the results were expressed in mg/g (Campbell et al., 2000). The same sample was evaluated in three independent analyses in order to obtain mean and standard deviation.The hematological evaluation was carried out in a commercial laboratory (BLUT’S Centro de Diagnóstico, Produtos e Serviços Veterinários, Porto Alegre-RS, Brazil) according to standard methods. Together with the results of the present study, information about other studies were taken as reference to interpret hematologic parameters.The normality of the variables was evaluated using the Kolmogorov-Smirnov test. To compare the parameters of the study population, Studentt-, and Mann-Whitney U non-parametric tests were used. The critical level for rejection of the null hypothesis was considered to be P < 0.05.The interspecific variations in the spontaneous frequencies of nuclear alterations are probably related to the intrinsic individual factors associated with ingestion, accumulation, metabolism and excretion of the xenobiotics to which the organism is exposed daily. Furthermore, the correct functioning of the DNA repair also could be involved in this interspecific response to DNA damage (Jha, 2004). Information on 13 animals sampled is presented in Female (n=7)Male (n=6)Total (n=13)Micronucleus1.29 ± 1.502.00 ± 1.261.62 ± 1.39Nuclear buds3.14 ± 2.341.5 ± 1.522.38 ± 2.10Nucleoplasmic bridges0.43 ± 0.5300.23 ± 0.44Nuclear tails1.14 ± 1.070.5 ± 0.550.85 ± 0.90Notched nuclei0.14 ± 0.380.33 ± 0.820.23 ± 0.60Binucleated cells1.29 ± 1.381.17 ± 1.941.23 ± 1.59Open in a separate windowMann-Whitney test to compare female and male. Data expressed in mean ± standard deviation. According to Zúñiga-González et al. (2001), species with the highest values of MNs basal frequency potentially could be useful for biomonitoring the possible effect of environmental mutagens. Birds of prey are sensitive indicators of environmental quality because they are particularly prone to bioaccumulate organic contaminants (Carneiro et al., 2016), including genotoxins. However, there is scarce information concerning spontaneous MN frequency in birds, mainly in birds of prey. In our study, the mean MN frequency was 0.8 per 1,000 erythrocytes analysed, values ​​higher than determined for Buteo albicaudatus and Polyborus plancus, that are other species of birds of prey of the Falconidae family. No micronucleus was found in Polyborus plancus while the rate for Buteo albicaudatus was 0.05 micronuclei (Zúñiga-González et al., 2001). In another study, Zúñiga-González et al. (2000) evaluated spontaneous micronuclei in birds of prey and did not observe MN in Accipiter cooperi, Polyborus plancus, Aquila chrysaetos, and Parabuteo unicinctus. For Falco sp. and Buteo sp. the MN frequencies were 0.14 and 0.02 respectively. Regarding other abnormalities evaluated by ENA assay, a rate of 1.19 NBud per 1,000 erythrocytes was counted. NBud reflects chromosomal instability and it is related to DNA amplification, DNA repair complexes and excess chromosomes due to aneuploid events (Fenech et al., 2011). There is no information concerning ENA frequencies in birds of prey. In birds, Quero et al. (2016), evaluating 17 different species of wild birds, observed that 80.9 % of the individuals presented at least one NBud with a rate of 0.10 to 0.95 ± 0.14/1000 erythrocytes. A high frequency of NBud (1.28/1000 cells) was observed in individuals of Aratinga canicularis exposed to water (negative control) (Gomez-Meda et al., 2006). This study evaluated the MN and NBud frequencies in birds exposed to mitomycin-C, suggesting that budding may reflect a wider spectrum of DNA damage than the MN formation. Thus, the authors proposed that estimating the NBud rate in routine hematological analysis could serve to establish basal values for the species and to evaluate environmental genotoxicity exposure.In our study, the individuals also presented NB and NT in their erythrocytes. Molecularly, these nuclear alterations could be formed by the same pathway (Anbumani and Mohankumar, 2015). When there is dicentric chromosome formation due to misrepair of DNA breaks, telomere end fusions or incorrect sister chromatid separation, this chromosome can be pulled to opposite poles of the cell during mitosis, producing the nucleoplasmic bridges (Fenech et al., 2011). It is also possible that a cytoplasmic constriction of the NB could result in a nuclear tail (Anbumani and Mohankumar, 2015). Falco peregrinus showed a rate of 0.12 nucleoplasmic bridge and 0.43 nuclear tails for 1000 erythrocytes. There are no previous studies including frequencies of these nuclear alterations in birds of prey. However, Quero et al. (2016) in different orders found a mean range between 0.01 and 0.20 for NB as well as 0.05 and 0.22 for NT in peripheral blood erythrocytes.In addition, the evaluation of NO cells in this work showed a mean frequency of 0.12/1000 erythrocytes. The mechanisms responsible for NO cell formation must be better understood, although de Faria et al. (2018) comment on nuclei with asymmetric constriction such as notched type that can be associated with damage in structures/proteins that leads to the cleavage of different nuclear and cytoskeleton proteins and to tubulin polymerization failure, for example. Quero et al. (2016) found mean nuclear alterations between 0.1 and 2.5 in birds analyzed, with results similar to those reported here.Erythrocytes with two nuclei present cytokinesis failure. BN cell formation is related to erroneous mitosis, where karyokinesis is not synchronized with cytokinesis (Coonen et al., 2004). In F. peregrinus the BN cell rate was 0.62/1000 cells. Regarding BN cells in birds, reported mean frequencies were between 0.05 and 0.40 for bird species (Quero et al., 2016).As to age and sex influence on spontaneous nuclear alterations, Shepherd and Somers (2012) have shown that these are important factors affecting background MN frequency. In their study, male birds had a 1.4- to 2.2-fold higher frequency of MN than females. In our research, all birds tested were adults and with regard to sex, NB cells were observed only in female individuals. Other authors showed that the sex of the birds did not affect nuclear alteration in the control group (de Souza et al., 2017).Inorganic elements detected in the blood of birds of prey included the macro-elements Ca, P, Mg, Na, Cl, S and K as well as the micro-elements Fe, Al and Zn (Figure 1). In Figure 1A it appeared that Na (4.25 mg/g) was the highest concentration, while Zn (0.018 mg/g) was the lowest element (Figure 1B). No difference was observed between male and female (P>0.05). Open in a separate windowFigure 1 -A and B) Levels of inorganic elements in blood samples of Falco peregrinus. Data expressed in mg/g, mean ± standard deviation.The analysis of elements, mainly metals in birds, has been an important tool to assess environmental pollution because human activities have increased the natural environment concentrations (Carneiro et al., 2016). In our study, the basal quantity of some macro and micronutrients was detected in the blood of captive birds of prey not exposed to contaminants. Carneiro et al. (2016), in a review about biomonitoring of metals and metalloids using raptors in Portugal and Spain, point out that the blood and liver samples were very frequently used the studies. Metals, such as Fe and Zn, were detected in bird blood in our study. Fe is needed in the hemoglobin production for the blood to carry oxygen. However, as the Fe homeostasis must be maintained, little iron in the diet can cause anemia in birds and too much can lead to iron storage disease (Cork, 2000). Zn is also an important micronutrient with physiologic benefits, including bone formation, immune function and normal functioning of the central nervous system. In birds, overexposure to zinc can result in anemia (Puschner and Poppenga, 2009). In our study, the findings indicate the presence of Al in the blood of birds of prey. The origin of Al found in the birds is as yet unknown due to an increase in the redistribution of this element in the environment as a result of human activities. This element is abundant in the Earth’s crust and is moved by natural and/or human activity. Atmospheric precipitation may be acidic, enhancing the Al leaching. However, levels of A1 below 0.1% generally do not have an adverse effect on the overall health of the animal, but higher levels may cause decreased growth rates and muscle weakness (Scheuhammer, 1987).Results of hematological values are summarized in Wernery et al. (2004) (n = 267), Muller et al. (2005) (n = 320) and Padrtova and Lloyd (2009) (n = 96). A different value was observed in the relative number of monocytes, where in the cited studies they range from 1.8 to 4.4, while in our study it was 10.75±4.81. In birds, monocyte cells can be confused with lymphocytes during cell count, and variations the results may reflect this difficulty (Ivins et al., 1986).Table 2 - Hematological values for Falco peregrinus and reference ranges of falcons from the literature.
Present studyReference 1Reference 2Reference 3
Red blood cells (x106/uL)2.88 ± 0.362.68 ± 0.233.35 ± 0.122.39 ± 0.26
Hemoglobin (g/dL)15.75 ± 1.4817.9 ± 1.115.3 ± 0.617.9 ± 1.6
Hematocrit (%)49.00 ± 5.29N.D.46 ± 2N.D.
MCV (fL)172.99 ± 28.52176.5 ± 10.3137.3 ± 4.2219.7 ± 25.4
MCHC (%)32.18 ± 28.5238.1 ± 2.0N.D.34.4 ± 1.5
Leukocytes (x103/uL)5.44 ± 1.215.63 ± 1.639.31 ± 3.247.55 ± 2.27
Platelets21.17 ± 6.96N.D.N.D.N.D.
PP (g/L)44.5 ± 6.22N.D.N.D.N.D.
Heterophils (%)66.75 ± 11.1769.9 ± 10.060.0 ± 10.049.9 ± 3.5
Lymphocytes (%)20.75 ± 7.9225.3 ± 9.237.4 ± 11.244.2 ± 3.4
Monocytes (%)10.75 ± 4.811.8 ± 1.62.6 ± 1.24.4 ± 1.6
Eosinophils (%)1.25 ± 1.711.9 ± 1.901.4 ± 1.1
Basophils (%)0.5 ± 0.711.1 ± 1.200.1 ± 0
Open in a separate windowMCV = Mean Corpuscular Volume; MCHC = Mean Corpuscular Hemoglobin Concentration; PP = Plasm Protein; Reference 1: Padrtova and Lloyd, 2009; Reference 2: Wernery et al 2004; Reference 3: Muller et al, 2005. N.D: Not determined. In addition, changes were observed in hematological parameters between birds of prey of different sex, where the relative numbers of basophils were higher in males. Oliveira et al. (2014), comparing males and females of Harpia harpyja, found some variation in the values of relative number of basophils, with values increased in females. According to Campbell (1994) the function of basophils in poultry is not fully elucidated.In order to evaluate environmental pollution using biomonitoring, it is essential to know the physiological parameters of the species studied, such as basal DNA damage, inorganic elements, and hematological values. In the present study, data on baseline MN and ENA frequencies for Falco peregrinus were first reported on captive species. Micronucleus, nuclear buds, nucleoplasmic bridges, notched nuclei, binucleated cells and nuclear tails were observed. Inorganic elements were also detected in the blood of bird of prey including macro and micro-elements as well, as hematological values. Thus, the data published in this study could be useful for future comparisons in biomonitoring studies and it can help the veterinarian in laboratory and clinical assessments of falcons kept in captivity in conservation programs.  相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号