共查询到20条相似文献,搜索用时 46 毫秒
1.
2.
3.
4.
5.
6.
7.
8.
Andrew D. Morgan R. Craig MacLean Kristina L. Hillesland Gregory J. Velicer 《Applied and environmental microbiology》2010,76(20):6920-6927
Predator-prey relationships among prokaryotes have received little attention but are likely to be important determinants of the composition, structure, and dynamics of microbial communities. Many species of the soil-dwelling myxobacteria are predators of other microbes, but their predation range is poorly characterized. To better understand the predatory capabilities of myxobacteria in nature, we analyzed the predation performance of numerous Myxococcus isolates across 12 diverse species of bacteria. All predator isolates could utilize most potential prey species to effectively fuel colony expansion, although one species hindered predator swarming relative to a control treatment with no growth substrate. Predator strains varied significantly in their relative performance across prey types, but most variation in predatory performance was determined by prey type, with Gram-negative prey species supporting more Myxococcus growth than Gram-positive species. There was evidence for specialized predator performance in some predator-prey combinations. Such specialization may reduce resource competition among sympatric strains in natural habitats. The broad prey range of the Myxococcus genus coupled with its ubiquity in the soil suggests that myxobacteria are likely to have very important ecological and evolutionary effects on many species of soil prokaryotes.Predation plays a major role in shaping both the ecology and evolution of biological communities. The population and evolutionary dynamics of predators and their prey are often tightly coupled and can greatly influence the dynamics of other organisms as well (1). Predation has been invoked as a major cause of diversity in ecosystems (11, 12). For example, predators may mediate coexistence between superior and inferior competitors (2, 13), and differential trajectories of predator-prey coevolution can lead to divergence between separate populations (70).Predation has been investigated extensively in higher organisms but relatively little among prokaryotes. Predation between prokaryotes is one of the most ancient forms of predation (27), and it has been proposed that this process may have been the origin of eukaryotic cells (16). Prokaryotes are key players in primary biomass production (44) and global nutrient cycling (22), and predation of some prokaryotes by others is likely to significantly affect these processes. Most studies of predatory prokaryotes have focused on Bdellovibrionaceae species (e.g., see references 51, 55, and 67). These small deltaproteobacteria prey on other Gram-negative cells, using flagella to swim rapidly until they collide with a prey cell. After collision, the predator cells then enter the periplasmic space of the prey cell, consume the host cell from within, elongate, and divide into new cells that are released upon host cell lysis (41). Although often described as predatory, the Bdellovibrionaceae may also be considered to be parasitic, as they typically depend (apart from host-independent strains that have been observed [60]) on the infection and death of their host for their reproduction (47).In this study, we examined predation among the myxobacteria, which are also deltaproteobacteria but constitute a monophyletic clade divergent from the Bdellovibrionaceae (17). Myxobacteria are found in most terrestrial soils and in many aquatic environments as well (17, 53, 74). Many myxobacteria, including the model species Myxococcus xanthus, exhibit several complex social traits, including fruiting body formation and spore formation (14, 18, 34, 62, 71), cooperative swarming with two motility systems (64, 87), and group (or “wolf pack”) predation on both bacteria and fungi (4, 5, 8, 9, 15, 50). Using representatives of the genus Myxococcus, we tested for both intra- and interspecific variation in myxobacterial predatory performance across a broad range of prey types. Moreover, we examined whether prey vary substantially in the degree to which they support predatory growth by the myxobacteria and whether patterns of variation in predator performance are constant or variable across prey environments. The latter outcome may reflect adaptive specialization and help to maintain diversity in natural populations (57, 59).Although closely related to the Bdellovibrionaceae (both are deltaproteobacteria), myxobacteria employ a highly divergent mode of predation. Myxobacteria use gliding motility (64) to search the soil matrix for prey and produce a wide range of antibiotics and lytic compounds that kill and decompose prey cells and break down complex polymers, thereby releasing substrates for growth (66). Myxobacterial predation is cooperative both in its “searching” component (6, 31, 82; for details on cooperative swarming, see reference 64) and in its “handling” component (10, 29, 31, 32), in which secreted enzymes turn prey cells into consumable growth substrates (56, 83). There is evidence that M. xanthus employs chemotaxis-like genes in its attack on prey cells (5) and that predation is stimulated by close contact with prey cells (48).Recent studies have revealed great genetic and phenotypic diversity within natural populations of M. xanthus, on both global (79) and local (down to centimeter) scales (78). Phenotypic diversity includes variation in social compatibility (24, 81), the density and nutrient thresholds triggering development (33, 38), developmental timing (38), motility rates and patterns (80), and secondary metabolite production (40). Although natural populations are spatially structured and both genetic diversity and population differentiation decrease with spatial scale (79), substantial genetic diversity is present even among centimeter-scale isolates (78). No study has yet systematically investigated quantitative natural variation in myxobacterial predation phenotypes across a large number of predator genotypes.Given the previous discovery of large variation in all examined phenotypes, even among genetically extremely similar strains, we anticipated extensive predatory variation as well. Using a phylogenetically broad range of prey, we compared and contrasted the predatory performance of 16 natural M. xanthus isolates, sampled from global to local scales, as well as the commonly studied laboratory reference strain DK1622 and representatives of three additional Myxococcus species: M. flavescens (86), M. macrosporus (42), and M. virescens (63) (Table (Table1).1). In particular, we measured myxobacterial swarm expansion rates on prey lawns spread on buffered agar (31, 50) and on control plates with no nutrients or with prehydrolyzed growth substrate.
Open in a separate window 相似文献
TABLE 1.
List of myxobacteria used, with geographical originOrganism abbreviation used in text | Species | Strain | Geographic origin | Reference(s) |
---|---|---|---|---|
A9 | Myxococcus xanthus | A9 | Tübingen, Germany | 78 |
A23 | Myxococcus xanthus | A23 | Tübingen, Germany | 78 |
A30 | Myxococcus xanthus | A30 | Tübingen, Germany | 78 |
A41 | Myxococcus xanthus | A41 | Tübingen, Germany | 78 |
A46 | Myxococcus xanthus | A46 | Tübingen, Germany | 78 |
A47 | Myxococcus xanthus | A47 | Tübingen, Germany | 78 |
A75 | Myxococcus xanthus | A75 | Tübingen, Germany | 78 |
A85 | Myxococcus xanthus | A85 | Tübingen, Germany | 78 |
TV | Myxococcus xanthus | Tvärminne | Tvärminne, Finland | 79 |
PAK | Myxococcus xanthus | Paklenica | Paklenica, Croatia | 79 |
MAD | Myxococcus xanthus | Madeira 1 | Madeira, Portugal | 79 |
WAR | Myxococcus xanthus | Warwick 1 | Warwick, UK | 79 |
TOR | Myxococcus xanthus | Toronto 1 | Toronto, Ontario, Canada | 79 |
SUL2 | Myxococcus xanthus | Sulawesi 2 | Sulawesi, Indonesia | 79 |
KAL | Myxococcus xanthus | Kalalau | Kalalau, HI | 79 |
DAV | Myxococcus xanthus | Davis 1A | Davis, CA | 79 |
GJV1 | Myxococcus xanthus | GJV 1 | Unknown | 35, 72 |
MXFL1 | Myxococcus flavescens | Mx fl1 | Unknown | 65 |
MXV2 | Myxococcus virescens | Mx v2 | Unknown | 65 |
CCM8 | Myxococcus macrosporus | Cc m8 | Unknown | 65 |
9.
Patti J. Miller Claudio L. Afonso Erica Spackman Melissa A. Scott Janice C. Pedersen Dennis A. Senne Justin D. Brown Chad M. Fuller Marcela M. Uhart William B. Karesh Ian H. Brown Dennis J. Alexander David E. Swayne 《Journal of virology》2010,84(21):11496-11504
The biological, serological, and genomic characterization of a paramyxovirus recently isolated from rockhopper penguins (Eudyptes chrysocome) suggested that this virus represented a new avian paramyxovirus (APMV) group, APMV10. This penguin virus resembled other APMVs by electron microscopy; however, its viral hemagglutination (HA) activity was not inhibited by antisera against any of the nine defined APMV serotypes. In addition, antiserum generated against this penguin virus did not inhibit the HA of representative viruses of the other APMV serotypes. Sequence data produced using random priming methods revealed a genomic structure typical of APMV. Phylogenetic evaluation of coding regions revealed that amino acid sequences of all six proteins were most closely related to APMV2 and APMV8. The calculation of evolutionary distances among proteins and distances at the nucleotide level confirmed that APMV2, APMV8, and the penguin virus all were sufficiently divergent from each other to be considered different serotypes. We propose that this isolate, named APMV10/penguin/Falkland Islands/324/2007, be the prototype virus for APMV10. Because of the known problems associated with serology, such as antiserum cross-reactivity and one-way immunogenicity, in addition to the reliance on the immune response to a single protein, the hemagglutinin-neuraminidase, as the sole base for viral classification, we suggest the need for new classification guidelines that incorporate genome sequence comparisons.Viruses from the Paramyxoviridae family have caused disease in humans and animals for centuries. Over the last 40 years, many paramyxoviruses isolated from animals and people have been newly described (16, 17, 22, 29, 31, 32, 36, 42, 44, 46, 49, 58, 59, 62-64). Viruses from this family are pleomorphic, enveloped, single-stranded, nonsegmented, negative-sense RNA viruses that demonstrate serological cross-reactivity with other paramyxoviruses related to them (30, 46). The subfamily Paramyxovirinae is divided into five genera: Respirovirus, Morbillivirus, Rubulavirus, Henipavirus, and Avulavirus (30). The Avulavirus genus contains nine distinct avian paramyxovirus (APMV) serotypes (Table (Table1),1), and information on the discovery of each has been reported elsewhere (4, 6, 7, 9, 12, 34, 41, 50, 51, 60, 68).
Open in a separate windowaRequires the addition of an exogenous protease.bProtease requirement depends on the isolate examined.cPutative.Six of these serotypes were classified in the latter half of the 1970s, when the most reliable assay available to classify paramyxoviruses was the hemagglutination inhibition (HI) assay (61). However, there are multiple problems associated with the use of serology, including the inability to classify some APMVs by comparing them to the sera of the nine defined APMVs alone (2, 8). In addition, one-way antigenicity and cross-reactivity between different serotypes have been documented for many years (4, 5, 14, 25, 29, 33, 34, 41, 51, 52, 60). The ability of APMVs, like other viruses, to show antigenic drift as it evolves over time (37, 43, 54) and the wide use and availability of precise molecular methods, such as PCR and genome sequencing, demonstrate the need for a more practical classification system.The genetic diversity of APMVs is still largely unexplored, as hundreds of avian species have never been surveyed for the presence of viruses that do not cause significant signs of disease or are not economically important. The emergence of H5N1 highly pathogenic avian influenza (HPAI) virus as the cause of the largest outbreak of a virulent virus in poultry in the past 100 years has spurred the development of surveillance programs to better understand the ecology of avian influenza (AI) viruses in aquatic birds around the globe, and in some instances it has provided opportunities for observing other viruses in wild bird populations (15, 53). In 2007, as part of a seabird health surveillance program in the Falkland Islands (Islas Malvinas), oral and cloacal swabs and serum were collected from rockhopper penguins (Eudyptes chrysocome) and environmental/fecal swab pools were collected from other seabirds.While AI virus has not yet been isolated from penguins in the sub-Antarctic and Antarctic areas, there have been two reports of serum antibodies positive to H7 and H10 from the Adélie species (11, 40). Rare isolations of APMV1, both virulent (45) and of low virulence (8), have been reported from Antarctic penguins. Sera positive for APMV1 and AMPV2 have also been reported (21, 24, 38, 40, 53). Since 1981, paramyxoviruses have been isolated from king penguins (Aptenodytes patagonicus), royal penguins (Eudyptes schlegeli), and Adélie penguins (Pygoscelis adeliae) from Antarctica and little blue penguins (Eudyptula minor) from Australia that cannot be identified as belonging to APMV1 to -9 and have not yet been classified (8, 11, 38-40). The morphology, biological and genomic characteristics, and antigenic relatedness of an APMV recently isolated from multiple penguin colonies on the Falkland Islands are reported here. Evidence that the virus belongs to a new serotype (APMV10) and a demonstration of the advantages of a whole genome system of analysis based on random sequencing followed by comparison of genetic distances are presented. Only after all APMVs are reported and classified will epidemiological information be known as to how the viruses are moving and spreading as the birds travel and interact with other avian species. 相似文献
TABLE 1.
Characteristics of prototype viruses APMV1 to APMV9 and the penguin virusStrain | Host | Disease | Distribution | Fusion cleavagec | GI accession no. |
---|---|---|---|---|---|
APMV1/Newcastle disease virus | >250 species | High mortality | Worldwide | GRRQKRF | 45511218 |
Inapparent | Worldwide | GGRQGRLa | 11545722 | ||
APMV2/Chicken/CA/Yucaipa/1956 | Turkey, chickens, psittacines, rails, passerines | Decrease in egg production and respiratory disease | Worldwide | DKPASRF | 169144527 |
APMV3/Turkey/WI/1968 | Turkey | Mild respiratory disease and moderate egg decrease | Worldwide | PRPSGRLa | 209484147 |
APMV3/Parakeet/Netherlands/449/1975 | Psittacines, passerines, flamingos | Neurological, enteric, and respiratory disease | Worldwide | ARPRGRLa | 171472314 |
APMV4/Duck/Hong Kong/D3/1975 | Duck, geese, chickens | None known | Worldwide | VDIQPRF | 210076708 |
APMV5/Budgerigar/Japan/Kunitachi/1974 | Budgerigars, lorikeets | High mortality, enteric disease | Japan, United Kingdom, Australia | GKRKKRFa | 290563909 |
APMV6/Duck/Hong Kong/199/1977 | Ducks, geese, turkeys | Mild respiratory disease and increased mortality in turkeys | Worldwide | PAPEPRLb | 15081567 |
APMV7/Dove/TN/4/1975 | Pigeons, doves, turkeys | Mild respiratory disease in turkeys | United States, England, Japan | TLPSSRF | 224979458 |
APMV8/Goose/DE/1053/1976 | Ducks, geese | None known | United States, Japan | TYPQTRLa | 226343050 |
APMV9/Duck/NY/22/1978 | Ducks | None known | Worldwide | RIREGRIa | 217068693 |
APMV10/Penguin/Falkland Islands/324/2007 | Rockhopper penguins | None Known | Falkland Islands | DKPSQRIa | 300432141 |
10.
Francisco J. Roig A. Llorens B. Fouz C. Amaro 《Applied and environmental microbiology》2009,75(8):2577-2580
This work demonstrates that Vibrio vulnificus biotype 2, serovar E, an eel pathogen able to infect humans, can become resistant to quinolone by specific mutations in gyrA (substitution of isoleucine for serine at position 83) and to some fluoroquinolones by additional mutations in parC (substitution of lysine for serine at position 85). Thus, to avoid the selection of resistant strains that are potentially pathogenic for humans, antibiotics other than quinolones must be used to treat vibriosis on farms.Vibrio vulnificus is an aquatic bacterium from warm and tropical ecosystems that causes vibriosis in humans and fish (http://www.cdc.gov/nczved/dfbmd/disease_listing/vibriov_gi.html) (33). The species is heterogeneous and has been subdivided into three biotypes and more than eight serovars (6, 15, 33; our unpublished results). While biotypes 1 and 3 are innocuous for fish, biotype 2 can infect nonimmune fish, mainly eels, by colonizing the gills, invading the bloodstream, and causing death by septicemia (23). The disease is rapidly transmitted through water and can result in significant economic losses to fish farmers. Surviving eels are immune to the disease and can act as carriers, transmitting vibriosis between farms. Interestingly, biotype 2 isolates belonging to serovar E have been isolated from human infections, suggesting that serovar E is zoonotic (2). This serovar is also the most virulent for fish and has been responsible for the closure of several farms due to massive losses of fish. A vaccine, named Vulnivaccine, has been developed from serovar E isolates and has been successfully tested in the field (14). Although the vaccine provides fish with long-term protection from vibriosis, at present its use is restricted to Spain. For this reason, in many fish farms around the world, vibriosis is treated with antibiotics, which are usually added to the food or water.Quinolones are considered the most effective antibiotics against human and fish vibriosis (19, 21, 31). These antibiotics can persist for a long time in the environment (20), which could favor the emergence of resistant strains under selective pressure. In fact, spontaneous resistances to quinolones by chromosomal mutations have been described for some gram-negative bacteria (10, 11, 17, 24, 25, 26). Therefore, improper antibiotic treatment of eel vibriosis or inadequate residue elimination at farms could favor the emergence of human-pathogenic serovar E strains resistant to quinolones by spontaneous mutations. Thus, the main objective of the present work was to find out if the zoonotic serovar of biotype 2 can become quinolone resistant under selective pressure and determine the molecular basis of this resistance.Very few reports on resistance to antibiotics in V. vulnificus have been published; most of them have been performed with biotype 1 isolates. For this reason, the first task of this study was to determine the antibiotic resistance patterns in a wide collection of V. vulnificus strains belonging to the three biotypes that had been isolated worldwide from different sources (see Table S1 in the supplemental material). Isolates were screened for antimicrobial susceptibility to the antibiotics listed in Table S1 in the supplemental material by the agar diffusion disk procedure of Bauer et al. (5), according to the standard guideline (9). The resistance pattern found for each isolate is shown in Table S1 in the supplemental material. Less than 14% of isolates were sensitive to all the antibiotics tested, and more than 65% were resistant to more than one antibiotic, irrespective of their biotypes or serovars. The most frequent resistances were to ampicillin-sulbactam (SAM; 65.6% of the strains) and nitrofurantoin (F; 60.8% of the strains), and the least frequent were to tetracycline (12%) and oxytetracycline (8%). In addition, 15% of the strains were resistant to nalidixic acid (NAL) and oxolinic acid (OA), and 75% of these strains came from fish farms (see Table S1 in the supplemental material). Thus, high percentages of strains of the three biotypes were shown to be resistant to one or more antibiotics, with percentages similar to those found in nonbiotyped environmental V. vulnificus isolates from Asia and North America (4, 27, 34). In those studies, resistance to antibiotics could not be related to human contamination. However, the percentage of quinolone-resistant strains found in our study is higher than that reported in other ones, probably due to the inclusion of fish farm isolates, where the majority of quinolone-resistant strains were concentrated. This fact suggests that quinolone resistance could be related to human contamination due to the improper use of these drugs in therapy against fish diseases, as has been previously suggested (18, 20). Although no specific resistance pattern was associated with particular biotypes or serovars, we found certain differences in resistance distribution, as shown in Table Table1.1. In this respect, biotype 3 displayed the narrowest spectrum of resistances and biotype 1 the widest. The latter biotype encompassed the highest number of strains with multiresistance (see Table S1 in the supplemental material). Within biotype 2, there were differences among serovars, with quinolone resistance being restricted to the zoonotic serovar (Table (Table11).
Open in a separate windowaCTX, cefotaxime; E, erythromycin; OT, oxytetracycline; SXT-TMP, sulfamethoxazole-trimethoprim; TE, tetracycline.The origin of resistance to quinolones in the zoonotic serovar was further investigated. To this end, spontaneous mutants of sensitive strains were selected from colonies growing within the inhibition halo around OA or NAL disks. Two strains (strain CG100 of biotype 1 and strain CECT 4604 of biotype 2, serovar E) developed isolated colonies within the inhibition zone. These colonies were purified, and maintenance of resistance was confirmed by serial incubations on medium without antibiotics. Using the disk diffusion method, CG100 was shown to be resistant to SAM and F and CECT 4604 to F (see Table S1 in the supplemental material). The MICs for OA, NAL, flumequine (UB), and ciprofloxacin (CIP) were determined by using the microplate assay according to the recommendations of the Clinical and Laboratory Standards Institute and the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (8, 12) and interpreted according to the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (13). The MICs for OA and NAL and for the fluoroquinolones UB and CIP exhibited by the mutants and their counterparts are shown in Table Table2.2. The inhibition zone diameters correlated well with MICs (data not shown). Mutants FR1, FR2, FR3, and FR4 were resistant to NAL and sensitive to the remaining quinolones, although they showed higher resistances than their parental strains (Table (Table2).2). Thus, these four mutants showed increases of 32- to 128-fold for NAL MICs, 4- to 8-fold for UB MICs, and 16-fold for CIP MICs (Table (Table2).2). The fifth mutant, FR5, was resistant to the two tested quinolones and to UB, a narrow-spectrum fluoroquinolone. This mutant, although sensitive to CIP, multiplied its MIC for this drug by 128 with respect to the parental strain (Table (Table22).
Open in a separate windowaMutations in a nucleotide (nt) that gave rise to a codon change and to a change in amino acids (aa) are indicated. NC, no change detected.bThe resistance (R) or sensitivity (S) against the antibiotic determined according to the Clinical and Laboratory Standards Institute and the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (9, 13) is indicated in parentheses.For other gram-negative pathogens, quinolone resistance relies on spontaneous mutations in the gyrA, gyrB, parC, and parE genes that occur in a specific region of the protein known as the quinolone resistance-determining region (QRDR) (1, 11, 17, 24, 25, 26, 28). To test the hypothesis that mutations in these genes could also produce quinolone resistance in V. vulnificus, the QRDRs of these genes were sequenced in the naturally resistant strains and in the two sensitive strains that had developed resistances by selective pressure in vitro. The genomic DNA was extracted (3), and the QRDRs of gyrA, gyrB, parE, and parC were amplified using the primers shown in Table Table3,3, which were designed from the published genomes of biotype 1 strains YJ016 and CMCP6 (7, 22). PCR products of the predicted size were sequenced in an ABI 3730 sequencer (Applied Biosystems). Analysis of the QRDR sequences for gyrA, gyrB, parC, and parE of the mutants and the naturally resistant strains revealed that all naturally resistant strains, except one, shared a specific mutation at nucleotide position 248 with the laboratory-induced mutants (Table (Table2).2). This mutation gave rise to a change from serine to isoleucine at amino acid position 83. The exception was a mutation in the adjacent nucleotide that gave rise to a substitution of arginine for serine at the same amino acid position (Table (Table2).2). All the isolates that were resistant to the quinolone NAL had a unique mutation in the gyrA gene, irrespective of whether resistance was acquired naturally or in the laboratory (Table (Table2).2). This result strongly suggests that a point mutation in gyrA that gives rise to a change in nucleotide position 83 can confer resistance to NAL in V. vulnificus biotypes 1 and 2 and that this mutation could be produced by selective pressure under natural conditions. gyrA mutations consisting of a change from serine 83 to isoleucine have also been described in isolates of Aeromonas from water (17) and in diseased fish isolates of Vibrio anguillarum (26). Similarly, replacement of serine by arginine at amino acid position 83 in diseased fish isolates of Yersinia ruckeri (16) suggests that this mechanism of quinolone resistance is widespread among gram-negative pathogens. In all cases, these single mutations were also related to increased resistance to other quinolones (OA) and fluoroquinolones (UB and CIP) (Table (Table2),2), although the mutants remained sensitive according to the standards of the Clinical and Laboratory Standards Institute and the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (9, 13). A total of 50% of the naturally resistant strains, all of them of biotype 1, showed additional mutations that affected parC (a change in amino acid position 113) or gyrB (changes in amino acids at positions 425 and 438) (Table (Table2).2). These strains exhibited higher MICs for OA and fluoroquinolones (Table (Table2),2), although they were still sensitive to these drugs (9, 13). Finally, one isolate of biotype 2, serovar E, which was naturally resistant to quinolones and UB, showed a mutation in parC that gave rise to a substitution of leucine for serine at amino acid position 85 (Table (Table2).2). This mutation was shared only with the laboratory-induced mutant, also a biotype 2, serovar E mutant, which was resistant to the fluoroquinolone UB. The same mutation in parC had been previously described in diseased fish isolates of V. anguillarum that were highly resistant to quinolones (28), but this had not been related to fluoroquinolone resistance in Vibrio spp. nor in other gram-negative bacteria. These results strongly suggest that resistance to fluoroquinolones in V. vulnificus is related to specific mutations in gyrA and parC and that mutations in different positions for parC or in gyrB could contribute to increased resistance to quinolones and fluoroquinolones. Our results also agree with previous studies confirming that the acquisition of higher quinolone resistance is more probable when arising from a gyrA parC double mutation than from a gyrA gyrB double mutation (29).
Open in a separate windowFinally, the evolutionary history for each protein was inferred from previously published DNA sequences of the whole genes from different Vibrio species after multiple sequence alignment with MEGA4 software (32) by applying the neighbor-joining method (30) with the Poisson correction (35). The distance tree for each whole protein showed a topology similar to the phylogenetic tree based on 16S rRNA analysis, with the two isolates of V. vulnificus forming a single group, closely related to Vibrio parahaemolyticus, Vibrio cholerae, V. anguillarum, and Vibrio harveyi (see Fig. S1A in the supplemental material). A second analysis was performed with the QRDR sequences of the different mutants and isolates of V. vulnificus (GenBank accession numbers ) to infer the intraspecies relationships (see Fig. S1B in the supplemental material). This analysis showed that QRDRs of gyrA, gyrB, parC, and parE were highly homogeneous within V. vulnificus.In summary, the zoonotic serovar of V. vulnificus can mutate spontaneously to gain quinolone resistance, under selective pressure in vitro, due to specific mutations in gyrA that involve a substitution of isoleucine for serine at amino acid position 83. This mutation appears in biotype 2, serovar E diseased-fish isolates and biotype 1 strains, mostly recovered from fish farms. An additional mutation in parC, resulting in a substitution of lysine for serine at amino acid position 85, seems to endow partial fluoroquinolone resistance on biotype 2, serovar E strains. This kind of double mutation is present in diseased-fish isolates of the zoonotic serovar but not in resistant biotype 1 isolates, which show different mutations in gyrB or in parC that increase their resistance levels but do not make the strains resistant to fluoroquinolones. Thus, antibiotics other than quinolones should be used at fish farms to prevent the emergence and spread of quinolone resistances, especially to CIP, a drug widely recommended for human vibriosis treatment. FJ379836 to FJ379927 相似文献
TABLE 1.
Percentage of resistant strains distributed by biotypes and serovarsV. vulnificus | No. of isolates | Resistance distribution (%) for indicated antibiotica
| ||||||||
---|---|---|---|---|---|---|---|---|---|---|
SAM | CTX | E | NAL | F | OT | OA | SXT-TMP | TE | ||
Biotype 1 | 49 | 75.5 | 24.5 | 14.3 | 30.6 | 83.7 | 8.2 | 30.6 | 28.6 | 8.2 |
Biotype 2 (whole) | 72 | 58.3 | 13.9 | 12.5 | 4.2 | 47.2 | 9.7 | 4.2 | 4.2 | 13.9 |
Biotype 2 | ||||||||||
Serovar E | 36 | 30.3 | 12.1 | 3 | 9.1 | 27.3 | 15.2 | 9.1 | 3 | 21.2 |
Serovar A | 23 | 100 | 9.1 | 18.2 | 0 | 77.3 | 0 | 0 | 9.1 | 4.6 |
Nontypeable | 8 | 29 | 14.3 | 25 | 0 | 57.1 | 14.3 | 0 | 0 | 14.3 |
Serovar I | 5 | 100 | 20 | 20 | 0 | 20 | 20 | 0 | 0 | 0 |
Biotype 3 | 5 | 100 | 0 | 20 | 0 | 80 | 0 | 0 | 0 | 20 |
TABLE 2.
MICs for quinolones and fluoroquinolones and mutations in gyrA, gyrB, and parC detected in naturally and artificially induced resistant strainsStrain(s) | MIC (μg ml−1) for indicated antibioticb
| Gene mutationa
| ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
gyrA
| gyrB
| parC
| ||||||||||||||
Position
| Codon change | aa change | Position
| Codon change | aa change | Position
| Codon change | aa change | ||||||||
NAL | OA | UB | CIP | nt | aa | nt | aa | nt | aa | |||||||
CG100 | 0.5 (S) | 0.125 (S) | 0.0625 (S) | 0.0078 (S) | ||||||||||||
FR1 | 16 (R) | 1 (S) | 0.25 (S) | 0.125 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
FR2 | 16 (R) | 1 (S) | 0.25 (S) | 0.125 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
CECT 4604 | 0.25 (S) | 0.0625 (S) | 0.0625 (S) | 0.0078 (S) | ||||||||||||
FR3 | 32 (R) | 2 (S) | 0.5 (S) | 0.125 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
FR4 | 32 (R) | 2 (S) | 0.5 (S) | 0.125 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
FR5 | 256 (R) | 16 (R) | 16 (R) | 1 (S) | 248 | 83 | AGT→ATT | S→I | 1156 | 386 | GCA→ACA | A→T | 254 | 85 | TCA→TTA | S→L |
1236 | 412 | CAG→CAC | Q→H | |||||||||||||
CECT 4602 | 128 (R) | 8 (R) | 64 (R) | 1 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | 254 | 85 | TCA→TTA | S→L |
CECT 4603, CECT 4606, CECT 4608, PD-5, PD-12, JE | 32 (R) | 2 (S) | <1 (S) | <1 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
CECT 4862 | 64 (R) | 2 (S) | 2 (S) | <1 (S) | 249 | 83 | AGT→AGA | S→R | NC | NC | NC | NC | NC | NC | NC | NC |
A2, A4, A5, A6, A7, PD-1, PD-3 | 64-128 (R) | 2 (S) | 4 (S) | <1 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | 338 | 113 | GCA→GTA | A→V |
V1 | 128 (R) | 4 (S) | 4 (S) | <1 (S) | 248 | 83 | AGT→ATT | S→I | 1274 | 425 | GAG→GGG | E→G | NC | NC | NC | NC |
1314 | 438 | AAC→AAA | N→K |
TABLE 3.
Oligonucleotides used in this studyPrimer | Sequence | Annealing temp (°C) | Size (bp) |
---|---|---|---|
GyrAF | GGCAACGACTGGAATAAACC | 55.8 | 416 |
GyrAR | CAGCCATCAATCACTTCCGTC | ||
ParCF | CGCAAGTTCACCGAAGATGC | 56.6 | 411 |
ParCR | GGCATCCGCAACTTCACG | ||
GyrBF | CGACTTCTGGTGACGATGCG | 57.4 | 642 |
GyrBR | GACCGATACCACAACCTAGTG | ||
ParEF | GCCAGGTAAGTTGACCGATTG | 56.8 | 512 |
ParER | CACCCAGACCTTTGAATCGTTG |
11.
Michelle T. Franklin Christal L. Nieman Alida F. Janmaat Mario Soberón Alejandra Bravo Bruce E. Tabashnik Judith H. Myers 《Applied and environmental microbiology》2009,75(17):5739-5741
Resistance of greenhouse-selected strains of the cabbage looper, Trichoplusia ni, to Bacillus thuringiensis subsp. kurstaki was countered by a hybrid strain of B. thuringiensis and genetically modified toxins Cry1AbMod and Cry1AcMod, which lack helix α-1. Resistance to Cry1AbMod and Cry1AcMod was >100-fold less than resistance to native toxins Cry1Ab and Cry1Ac.Insecticidal proteins from Bacillus thuringiensis are used widely for pest control, but evolution of resistance by pests can reduce their efficacy (3, 4, 6, 14). Resistance to B. thuringiensis toxins has been reported in field populations of four species of Lepidoptera, one species in response to sprays (3, 14) and three species in response to transgenic crops (10, 15, 16). Here, we focus on understanding and countering resistance to sprays of Bacillus thuringiensis subsp. kurstaki that evolved in commercial greenhouse populations of the cabbage looper, Trichoplusia ni (7, 17).We compared responses to single toxins and formulations of B. thuringiensis by two resistant strains (GipBtR and GlenBtR) and two related susceptible strains (GipS and GlenS) of T. ni. All four strains were started by the collection of larvae in 2001 from commercial greenhouses near Vancouver in British Columbia, Canada (7). Resistance evolved in the greenhouses in response to repeated sprays of DiPel (7), a formulation of B. thuringiensis subsp. kurstaki strain HD1 containing Cry1Aa, Cry1Ab, Cry1Ac, and Cry2Aa (9). Previously reported concentrations required to kill 50% of larvae (LC50s) indicated that, relative to a susceptible laboratory strain, initial resistance to DiPel was 113-fold in the Gip population (labeled T2c in reference 7) and 24-fold in the Glen population (labeled P5 in reference 7).We reared larvae on a wheat germ diet (5) at 26°C on a light-to-dark schedule of 16 h:8 h. GipS and GlenS were reared on diet without B. thuringiensis toxins, which allowed resistance to decline (7). To maintain resistance, GipBtR and GlenBtR were reared each generation on a diet treated with 5 or 10 mg of DiPel WP (Abbott Laboratories, Ontario, Canada) per milliliter of diet (7). In bioassays, groups of five third-instar larvae were put in 60-ml plastic cups containing diet, and mortality was assessed after 3 days by gently probing larvae for movement.We used diet overlay bioassays to evaluate the toxicity to GipBtR and GipS of the protoxin forms of Cry1Ab, Cry1Ac, Cry1AbMod, and Cry1AcMod produced in B. thuringiensis strains (12). Cry1AbMod and Cry1AcMod are genetically engineered variants of Cry1Ab and Cry1Ac, respectively, each lacking 56 amino acids from the amino-terminal region, including helix α-1 (12). An 80-μl aliquot containing distilled water and toxin was dispensed evenly over the surfaces of 2 ml of diet (a mean surface area of 7.1 cm2) and allowed to dry. Fifty to 200 larvae from each strain were tested at five to eight concentrations of each toxin.We used diet incorporation bioassays (7) to evaluate the toxicities of DiPel and Agree WG (Certis, Columbia, MD) to GipS, GipBtR, GlenS, and GlenBtR. Agree is a formulation of hybrid strain GC91, which was created from the conjugation-like transfer of a plasmid from B. thuringiensis subsp. kurstaki strain HD191 into B. thuringiensis subsp. aizawai strain HD135, and it contains Cry1Ac, Cry1C, and Cry1D (1, 8). DiPel and Agree were diluted in distilled water and mixed into diet (7). Twenty-five to 50 larvae from each strain were tested at six to seven concentrations of DiPel and Agree.We used probit analysis (13) to estimate the LC50s and their 95% fiducial limits (FL), as well as the slopes of concentration-mortality lines and their standard errors. The mortality of larvae fed treated diet was not adjusted for the mortality of control larvae on untreated diet, because the control mortality was low (mean, 3.6%; range, 0 to 16%). LC50s with nonoverlapping 95% FL are significantly different. Resistance ratios were calculated as the LC50 of a resistant strain (GipBtR or GlenBtR) divided by the LC50 of its susceptible counterpart (GipS or GlenS).The genetically modified toxins Cry1AbMod and Cry1AcMod were much more effective than the native toxins Cry1Ab and Cry1Ac against larvae of T. ni from the resistant GipBtR strain (Table (Table1).1). Resistance ratios of GipBtR were 580 for Cry1Ab and 1,400 for Cry1Ac but only 5.5 for Cry1AbMod and 9.3 for Cry1AcMod (Table (Table1).1). Against GipBtR, the LC50 was 53-fold higher for Cry1Ab than for Cry1AbMod and 11-fold higher for Cry1Ac than for Cry1AcMod (Table (Table1).1). Against GipS, however, the LC50 was 2-fold higher for Cry1AbMod than for Cry1Ab and 14-fold higher for Cry1AcMod than for Cry1Ac (Table (Table11).
Open in a separate windowaConcentration that killed 50% and its 95% FL in mg protoxin per cm2 diet for toxins and mg formulation per ml of diet for DiPel and Agree.bLC50 of the resistant strain divided by the LC50 of the related susceptible strain for each toxin or formulation.cTotal of 17% mortality at the highest toxin concentration tested (17 mg protoxin/cm2 diet).dTotal of 35% mortality at the highest toxin concentration tested (23 mg protoxin/cm2 diet).eTotal of 24% mortality at the highest toxin concentration tested (15 mg DiPel/ml diet).Agree was more effective than DiPel against the two resistant strains GipBtR and GlenBtR (Table (Table1).1). Resistance ratios for DiPel were 370 for GipBtR and 26 for GlenBtR compared to resistance ratios for Agree, which were 9.9 for GipBtR and 5.9 for GlenBtR (Table (Table1).1). For the two resistant strains, LC50s were higher for DiPel than for Agree (13-fold higher against GipBtR and 1.6-fold higher against GlenBtR) (Table (Table1).1). Conversely, against the two susceptible strains, the LC50s were higher for Agree than for DiPel (2.7-fold higher against GipBtR and 2.6-fold higher against GlenBtR).The resistant GipBtR strain examined here (Table (Table1)1) and the resistant GLEN-Cry1Ac-BCS strain of T. ni studied by Wang et al. (17) had >500-fold resistance to Cry1Ab and Cry1Ac. Both GipBtR and GLEN-Cry1Ac-BCS were derived from greenhouse populations of T. ni that had been sprayed repeatedly with DiPel (7, 17), which contains Cry1Ab and Cry1Ac but not Cry1C or Cry1D (9). The GLEN-Cry1Ac-BCS strain had cross-resistance of only 2.5-fold to Cry1C and 2.4-fold to Cry1D (17). Agree contains Cry1C and Cry1D (8), which probably boosted its efficacy against GipBtR and GlenBtR (Table (Table11).The results here with Cry1AbMod and Cry1AcMod extend those of previous work indicating that modified toxins killed larvae of Manduca sexta in which susceptibility to Cry1Ab was decreased via RNA interference and also killed larvae of Pectinophora gossypiella that had laboratory-selected, genetically based resistance to Cry1Ab and Cry1Ac (12). The efficacy of Cry1AbMod and Cry1AcMod against greenhouse-selected T. ni suggests that the modified toxins may be useful against resistance that evolves in commercial agricultural settings. The results here also increase the number of lepidopteran species against which the modified toxins were effective to three, with each species representing a different family (Sphingidae, Gelechiidae, and Noctuidae). In the two other species, decreased susceptibility to native Cry1A toxins was mediated by alterations in a cadherin protein that binds Cry1Ac (2, 11, 12), whereas the role of cadherin in T. ni resistance has not been demonstrated or excluded.Similar to patterns observed with P. gossypiella (12), modified toxins were more effective than native toxins against resistant T. ni larvae, but native toxins were more effective than modified toxins against susceptible T. ni larvae (Table (Table1).1). This raises the intriguing possibility that combinations of native and modified toxins might be especially effective against populations with a mixture of susceptible and resistant individuals. In any case, the Cry1AMod toxins and hybrid B. thuringiensis products applied either jointly or separately may be useful for countering or delaying evolution of resistance in T. ni. However, further work is needed to determine how native and modified toxins interact when used in combination and how modified toxins perform in the greenhouse and field. 相似文献
TABLE 1.
Responses of resistant (GipBtR and GlenBtR) and susceptible (GipS and GlenS) strains of T. ni to native toxins (Cry1Ab and Cry1Ac), modified toxins (Cry1AbMod and Cry1AcMod), and formulations (DiPel and Agree)Toxin or formulation | Strain | No. of larvae | LC50 (95% FL)a | Slope ± SE | Resistance ratiob |
---|---|---|---|---|---|
Cry1Ab | GipBtR | 400 | 180 (59-2,900)c | 0.41 ± 0.09 | 580 |
GipS | 376 | 0.30 (0.21-0.41) | 0.56 ± 0.06 | ||
Cry1AbMod | GipBtR | 400 | 3.4 (2.6-4.6) | 0.52 ± 0.05 | 5.5 |
GipS | 375 | 0.62 (0.51-0.75) | 0.99 ± 0.09 | ||
Cry1Ac | GipBtR | 600 | 54 (35-110)d | 0.50 ± 0.07 | 1,400 |
GipS | 1,450 | 0.038 (0.031-0.046) | 0.44 ± 0.02 | ||
Cry1AcMod | GipBtR | 600 | 5.1 (4.4-5.8) | 0.85 ± 0.06 | 9.3 |
GipS | 1,145 | 0.55 (0.47-0.64) | 0.60 ± 0.03 | ||
DiPel | GipBtR | 125 | 66 (21-420,000)e | 0.43 ± 0.17 | 370 |
GipS | 125 | 0.18 (0.08-0.27) | 0.73 ± 0.16 | ||
Agree | GipBtR | 300 | 4.9 (3.6-7.7) | 0.81 ± 0.12 | 9.9 |
GipS | 300 | 0.49 (0.42-0.57) | 1.4 ± 0.14 | ||
DiPel | GlenBtR | 150 | 3.2 (2.7-3.9) | 1.9 ± 0.27 | 26 |
GlenS | 125 | 0.13 (0.05-0.17) | 1.5 ± 0.44 | ||
Agree | GlenBtR | 300 | 2.0 (1.7-2.4) | 1.2 ± 0.12 | 5.9 |
GlenS | 295 | 0.34 (0.29-0.39) | 1.4 ± 0.17 |
12.
13.
14.
Todd J. Ward Thomas Usgaard Peter Evans 《Applied and environmental microbiology》2010,76(19):6680-6684
A 30-probe assay was developed for simultaneous classification of Listeria monocytogenes isolates by lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (EC) type (ECI, ECIa, ECII, and ECIII). The assay was designed to facilitate rapid strain characterization and the integration of subtype data into risk-based inspection programs.Listeria monocytogenes is a facultative intracellular pathogen that can cause serious invasive illness (listeriosis) in humans and other animals. L. monocytogenes is responsible for over 25% of food-borne-disease-related deaths attributable to known pathogens and is a leading cause of food recalls due to microbial adulteration (12, 21). However, not all L. monocytogenes subtypes contribute equally to human illness, and substantial differences in the ecologies and virulence attributes of different L. monocytogenes subtypes have been identified (9, 13, 14, 23, 24, 33, 35, 36). Among the four major evolutionary lineages of L. monocytogenes, only lineages I and II are commonly isolated from contaminated food and human listeriosis patients (19, 27, 29, 33). Lineage I strains are overrepresented among human listeriosis isolates, particularly those associated with epidemic outbreaks, whereas lineage II strains are overrepresented in foods and the environment (13, 14, 24). Lineage III strains account for approximately 1% of human listeriosis cases but are common among animal listeriosis isolates and appear to be a host-adapted group that is poorly adapted to food-processing environments (6, 34-36). The ecological and virulence attributes of lineage IV are poorly understood, as this lineage is rare and was only recently described based on a small number of strains (19, 26, 29, 33).L. monocytogenes is differentiated into 13 serotypes; however, four major serogroups (4b, 1/2b, 1/2a, and 1/2c) from within lineages I and II account for more than 98% of human and food isolates (16, 31). Serogroups refer to evolutionary complexes typified by a predominant serotype but which include very rare serotypes that represent minor evolutionary variants (7, 9, 33). Phylogenetic analyses have indicated that rare serotypes may have evolved recently, or even multiple times, from one of the major serotypes (9), and numerous molecular methods fail to discriminate minor serotypes as independent groups (1, 4, 7, 9, 18, 22, 33, 38, 39). Serotyping is one of the most common methods for L. monocytogenes subtyping, and serogroup classifications are a useful component of strain characterization because ecotype divisions appear largely congruent with serogroup distinctions (16, 34). Serogroup 4b strains are of particular public health concern because contamination with these strains appears to increase the probability that a ready-to-eat (RTE) food will be implicated in listeriosis (16, 28). Serogroup 4b strains account for approximately 40% of sporadic listeriosis and also are responsible for the majority of listeriosis outbreaks despite being relatively rare contaminants of food products (9, 13, 17, 30, 34). In addition, serogroup 4b strains are associated with more severe clinical presentations and higher mortality rates than other serogroups (11, 16, 20, 31, 34). Serogroups 1/2a and 1/2b are overrepresented among food isolates but also contribute significantly to human listeriosis, whereas serogroup 1/2c rarely causes human illness and may pose a lower risk of listeriosis for humans (16). Serogroup-specific differences in association with human listeriosis are consistent with the prevalence of virulence-attenuating mutations in inlA within these serogroups (32, 34); however, a number of additional factors likely contribute to these differences.Four previously described epidemic clones (ECs; ECI, ECIa, ECII, and ECIII) of L. monocytogenes have been implicated in numerous listeriosis outbreaks and have contributed significantly to sporadic illness (15, 34). ECI, ECIa, and ECII are distinct groups within serogroup 4b that were each responsible for repeated outbreaks of listeriosis in the United States and Europe. ECIII is a lineage II clone of serotype 1/2a that persisted in the same processing facility for more than a decade prior to causing a multistate outbreak linked to contaminated turkey (15, 25). While there has been speculation that epidemic clones possess unique adaptations that explain their frequent involvement in listeriosis outbreaks (9, 34, 37), it is not clear that epidemic clones are more virulent than other strains with the same serotype. However, contamination of RTE food with EC strains would be cause for increased concern due to the previous involvement of these clones in major outbreaks of listeriosis (16).As a result of the L. monocytogenes subtype-specific differences in ecology, virulence, and association with human illness, molecular subtyping technologies have the potential to inform assessments of relative risk and to improve risk-based inspection programs. The objective of the present study was to develop a single assay for rapid and accurate classification of L. monocytogenes isolates by lineage, major serogroup, and epidemic clone in order to facilitate strain characterization and the integration of subtype data into inspection programs that are based on assessment of relative risk.A database of more than 5.3 Mb of comparative DNA sequences from 238 L. monocytogenes isolates (9, 33-35) was scanned for single nucleotide polymorphisms that could be used to differentiate lineages, major serogroups, and epidemic clones via a targeted multilocus genotyping (TMLGT) approach. The acronym TMLGT is used to distinguish this approach from previously published multilocus genotyping (MLGT) assays that were lineage specific and designed for haplotype discrimination (9, 33). To provide for simultaneous interrogation of the selected polymorphisms via TMLGT, six genomic regions (Table (Table1)1) were coamplified in a multiplex PCR. While the previous MLGT assays were based on three lineage-specific multiplexes and required prior identification of lineage identity, TMLGT was designed to target variation across all of the lineages simultaneously and is based on a unique set of amplicons. PCR was performed in 50-μl volumes with 1× High Fidelity PCR buffer (Invitrogen Life Technologies), 2 mM MgSO4, 100 μM deoxynucleoside triphosphate (dNTP), 300 nM primer, 1.5 U Platinum Taq high-fidelity DNA polymerase (Invitrogen Life Technologies), and 100 ng of genomic DNA. PCR consisted of an initial denaturation of 90 s at 96°C, followed by 40 cycles of 30 s at 94°C, 30 s at 50°C, and 90 s at 68°C. Amplification products were purified using Montage PCR cleanup filter plates (Millipore) and served as a template for allele-specific primer extension (ASPE) reactions utilizing subtype-specific probes.
Open in a separate windowaCorresponding nucleotide positions in the complete genome sequence of L. monocytogenes strain EGD-e (GenBank accession number ).bSee IUPAC codes for definition of degenerate bases.ASPE was performed in multiplex reactions including 30 probes, with each lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (ECI, ECIa, ECII, and ECIII) targeted by two different probes (Table NC_003210(Table2).2). In addition, positive-control probes were included to confirm the presence of each amplicon in the multiplex PCR. As serogroups and epidemic clones are nested within a particular lineage, probes for these groups were designed to be specific within the appropriate lineage and values for these probes were evaluated only for isolates of the appropriate lineage. For example, serogroup 1/2a probes were evaluated only for isolates that were positive for lineage II probes. ASPE probes were designed with a unique 5′ sequence tag specific to individual sets of xMAP fluorescent polystyrene microspheres (Luminex Corporation) used to sort extension products. Extension and hybridization reactions were performed as described previously (9) except microspheres were twice pelleted by centrifugation (4 min at 2,250 × g) and resuspended in 75 μl 1× TM buffer prior to being pelleted and resuspended in 100 μl 1× TM buffer containing 2 μg/ml streptavidin-R-phycoerythrin (Invitrogen Life Technologies). Samples were incubated for 15 min at 37°C prior to detecting the microsphere complexes with a Luminex 100 flow cytometer (Luminex Corporation). The median fluorescence intensity (MFI) from biotinylated extension products attached to 100 microspheres was measured for each probe. The average MFI from three template-free control samples was also determined and subtracted from the raw MFI of each sample to account for background fluorescence. Probe performance was initially evaluated via the index of discrimination (ID) as described by Ducey et al. (9), and probes with ID values less than 2.0 were redesigned.
Open in a separate windowaNA, not applicable for positive amplicon control probes.bLuminex microsphere sets (Luminex Corporation) used for hybridization reactions are indicated following the hyphen.cn, number of isolates representing the target subtype among the 906 tested isolates.dThe 5′ sequence tag portions of extension probes are capitalized. See IUPAC codes for definitions of degenerate bases.eID, index of discrimination.Validation of the TMLGT assay was performed using 906 L. monocytogenes isolates for which the lineage, major serogroup, and epidemic clone type had been determined independently (see Table S1 in the supplemental material). A subset of 92 isolates, including at least five isolates from each lineage, serogroup, and epidemic clone type, was used to evaluate the discriminatory power of subtype-specific probes and the repeatability of the assay (see Table S1). Two independent runs of the 30-probe TMLGT assay produced identical results for these 92 isolates. In addition, genotypes matched expectations for all isolate/probe combinations, and the fluorescence intensities for positive genotypes (those targeted by a particular probe) were 3.8 to 58.3 (mean, 18.5) times as high as background values for isolates with negative genotypes (those not targeted by a particular probe) (Table (Table2).2). The performances of individual probes also were assessed in terms of sensitivity and specificity, where sensitivity is defined as the percentage of positive samples that produced positive results and specificity indicates the percentage of negative samples that produce negative results (5). Based on results from all 906 isolates analyzed by TMLGT, probe sensitivity was at least 98.6% and 23 of the 24 subtype-specific probes exhibited 100% sensitivity (Table (Table2).2). The specificities for all probes were also greater than 98.6%, and 21 of the 24 subtype-specific probes exhibited 100% specificity (Table (Table22).All but three of the 906 isolates in the validation panel were fully and accurately typed relative to lineage, serogroup, and epidemic clone by using the TMLGT assay (typeability, 99.9%; accuracy of isolate assignment, 99.8%). One of the lineage II isolates, NRRL B-33880, could not be assigned to a serogroup based on the TMLGT results because this isolate was positive for one of the serogroup 1/2a probes (VGCb-40) and one of the serogroup 1/2c probes (LMO-9). This isolate was previously identified as a member of serogroup 1/2c based on mapping lineage-specific MLGT data onto a multilocus phylogeny (34) but produced a serogroup 1/2a-specific banding pattern (data not shown) with the multiplex PCR assay described by Doumith et al. (7). Similar strains, including the common laboratory strain EGD-e, were found to have genomes that are more similar to serogroup 1/2c strains than to strains from the 1/2a serogroup (8, 33) and likely represent intermediates in the evolution of the 1/2c clade from 1/2a ancestors. There is a poor correlation between genomic and antigenic variation for such isolates (34), consistent with the ambiguous results produced by application of the TMLGT assay to NRRL B-33880. The two other problematic isolates, NRRL B-33555 and NRRL B-33559, were accurately identified based on TMLGT data as lineage II isolates from the 1/2a serogroup. However, these two isolates were positive for both ECIII-specific probes in the TMLGT assay but have lineage-specific MLGT haplotypes (Lm2.46), indicating that they are representatives of a sister group closely related to ECIII (33).In 2005, the Food Safety and Inspection Service (FSIS) implemented an approach to inspection that includes consideration of relative risk in order to determine L. monocytogenes sampling frequency among establishments that produce certain RTE products. This approach incorporates information on production volume, outgrowth potential in the product, steps taken to prevent postlethality contamination, and FSIS sampling history. However, L. monocytogenes subtype-specific variation in ecology and virulence indicates that information on the lineage, major serogroup, and epidemic clone identities of isolates could be used to inform assessments of relative risk and to improve inspection programs that are based on consideration of risk. Several PCR-based methods have been described for differentiation of various combinations of these subgroups (1-3, 5, 7, 10, 35, 37); however, these approaches have focused on a single subgroup or a smaller set of subgroups than is differentiated by TMLGT analysis. Although we previously developed a set of three MLGT assays that can be used to differentiate all of the major serogroups and epidemic clones of L. monocytogenes (9, 33, 34), those assays did not include probes for lineage discrimination and require identification of the lineage prior to application of one of three unique sets of probes. In addition, the MLGT assays were designed to maximize strain discrimination, as opposed to subgroup identification, and require the use of at least twice as many probes as is needed for TMLGT analysis. MLGT data analysis is also more complicated than analysis of TMLGT data, and serogroup or epidemic clone type identification via MLGT requires phylogenetic analyses to place novel haplotypes within an established phylogenetic framework.In the present study, we developed the first assay for simultaneous discrimination of the four lineages, the four major serogroups, and the four previously described epidemic clones of L. monocytogenes. The assay includes multiple markers for each of these subtype probes as well as control probes to ensure that negative probe data were not the result of amplification failure, providing a high degree of internal validation required for use in inspection programs that consider risk in making sampling decisions. In addition, the utility of the assay has been validated with a large and diverse panel of 906 isolates, including 567 isolates from FSIS surveillance of RTE products and processing facilities (see Table S1 in the supplemental material). Data produced by the TMLGT assay are amenable to high-throughput analysis, and a simple spreadsheet utility has been developed to semiautomate subtype identifications and to alert investigators to potentially conflicting probe data (available upon request). In addition to having a potential application in inspection programs, the TMLGT assay provides a rapid and accurate means of characterizing L. monocytogenes isolates from different environments, which would facilitate pathogen tracking and improve understanding of L. monocytogenes ecology. 相似文献
TABLE 1.
Primers used in multiplex amplification for the TMLGT assayAmplicon | Positiona | Gene(s) | Primer | Sequence (5′-3′)b |
---|---|---|---|---|
INLa | 455381-456505 | inlA | inl2-a1 | GTCCTTGATAGTCTACTG |
inl2-a2 | ACCAAATTAGTAATCTAGCAC | |||
INLb | 457726-458752 | inlB | inl-f1d | GAATTRTTTAGYCAAGAATGT |
inlb-r | CTACCGGRACTTTATAGTAYG | |||
LMO | 325116-326096 | lmo0298-lmo0300 | lmo-a1 | AAGGCTTACAAGATGGCT |
lmo1a-1r | AAATAATAYGTGATACCGAC | |||
VGCa | 205366-206622 | plcA, hly | plca-f | CTCATCGTATCRTGTGTACC |
hly-r | TCTGGAAGGTCKTGTAGGTTC | |||
VGCb | 208447-209465 | mpl | ra_mpl-f | GTGGAYAGAACTCATAAAGG |
ra_mpl-r | ACTCCCTCCTYGTGATASGCT | |||
VGCc | 209728-211239 | actA | vgc1a-2f | TTCMATRCCAGCAGAACG |
vgc1a-2r | GCAGACCTAATAGCAATGTTG |
TABLE 2.
TMLGT probes and probe performance dataProbeb | Target (n)c | Probe sequenced | IDe | Sensitivity (%) | Specificity (%) |
---|---|---|---|---|---|
VGCb-21 | Lineage I (506) | AATCCTTTCTTTAATCTCAAATCAgcggaagcttgggaagcggtc | 7.3 | 100 | 100 |
VGCa-94 | Lineage I | CTTTCTATCTTTCTACTCAATAATcaacccgatgttcttcctgtc | 51.7 | 100 | 100 |
VGCc-8 | Lineage II (340) | AATCCTTTTACATTCATTACTTACattagctgattcgctttcct | 14.1 | 100 | 100 |
INLb-51 | Lineage II | TCATTTCAATCAATCATCAACAATagcgccaataaagctggc | 21.9 | 100 | 100 |
VGCb-19 | Lineage III (50) | TCAATCAATTACTTACTCAAATACccgctattaaaatgtactcca | 31.0 | 100 | 100 |
VGCb-29 | Lineage III | AATCTTACTACAAATCCTTTCTTTggtataccgctattaaaatgt | 45.1 | 100 | 100 |
LMO-17 | Lineage IV (10) | CTTTAATCCTTTATCACTTTATCAgaaccaaacaatgttattggt | 11.8 | 100 | 100 |
VGCa-27 | Lineage IV | CTTTTCAAATCAATACTCAACTTTttaacgacggtaacgtgccac | 58.3 | 100 | 100 |
INLb-84 | Serogroup 4b (213) | TCAACTAACTAATCATCTATCAATggtaaaaatatgcgaatattg | 9.7 | 100 | 100 |
INLb-85 | Serogroup 4b | ATACTACATCATAATCAAACATCActcgtgaacaagctttcc | 5.5 | 100 | 100 |
INLb-16 | Serogroup 1/2b (293) | AATCAATCTTCATTCAAATCATCAggtaaaaatatgcgtatctta | 11.7 | 100 | 100 |
INLb-100 | Serogroup 1/2b | CTATCTTTAAACTACAAATCTAACgtgaataagctatcggtctat | 13.0 | 100 | 100 |
LMO-42 | Serogroup 1/2a (268) | CTATCTTCATATTTCACTATAAACtggcgttgctgrctaagtttg | 6.6 | 100 | 100 |
VGCb-40 | Serogroup 1/2a | CTTTCTACATTATTCACAACATTAaatcaagcsgctcatatgaag | 10.4 | 100 | 98.6 |
LMO-9 | Serogroup 1/2c (72) | TAATCTTCTATATCAACATCTTACtttactggtgaaatggcg | 13.5 | 100 | 100 |
VGCb-5 | Serogroup 1/2c | CAATTCAAATCACAATAATCAATCaagattacgaatcgcttccac | 20.8 | 98.6 | 100 |
LMO-10 | ECI (111) | ATCATACATACATACAAATCTACAatgattaaaagtcagggaaag | 19.0 | 100 | 100 |
LMO-28 | ECI | CTACAAACAAACAAACATTATCAAaatcgaggcttacgaacgt | 23.7 | 100 | 100 |
VGCc-80 | ECIa (44) | CTAACTAACAATAATCTAACTAACactacaacgaaaacagcgc | 10.7 | 100 | 100 |
VGCa-35 | ECIa | CAATTTCATCATTCATTCATTTCAgttacttttatgtcgagt | 9.2 | 100 | 100 |
LMO-12 | ECII (35) | TACACTTTCTTTCTTTCTTTCTTTataccgattatttggacggtt | 3.8 | 100 | 100 |
LMO-30 | ECII | TTACCTTTATACCTTTCTTTTTACgacttgtagcagttgatttcaa | 7.5 | 100 | 100 |
VGCc-45 | ECIII (10) | TCATTTCACAATTCAATTACTCAActcttatttgcttttgttggtc | 21.1 | 100 | 99.4 |
INLa-3 | ECIII | TACACTTTATCAAATCTTACAATCgagcttaatgaaaatcagcta | 17.0 | 100 | 99.4 |
INLa-1 | INLa control | CTTTAATCTCAATCAATACAAATCagaagtggaagctgggaa | NAa | NA | NA |
INLb-13 | INLb control | CAATAAACTATACTTCTTCACTAAtgcacctaaacctccgac | NA | NA | NA |
LMO-88 | LMO control | TTACTTCACTTTCTATTTACAATCccgtttccttatgccaca | NA | NA | NA |
VGCa-23 | VGCa control | TTCAATCATTCAAATCTCAACTTTcaagycctaagacgccaatcg | NA | NA | NA |
VGCb-25 | VGCb control | CTTTTCAATTACTTCAAATCTTCAgcatgcgttagttcatgrcca | NA | NA | NA |
VGCc-82 | VGCc control | TACATACACTAATAACATACTCATgactgcatgctagaatctaag | NA | NA | NA |
15.
16.
17.
18.
Aurelio Cafaro Stefania Bellino Fausto Titti Maria Teresa Maggiorella Leonardo Sernicola Roger W. Wiseman David Venzon Julie A. Karl David O'Connor Paolo Monini Marjorie Robert-Guroff Barbara Ensoli 《Journal of virology》2010,84(17):8953-8958
The effects of the challenge dose and major histocompatibility complex (MHC) class IB alleles were analyzed in 112 Mauritian cynomolgus monkeys vaccinated (n = 67) or not vaccinated (n = 45) with Tat and challenged with simian/human immunodeficiency virus (SHIV) 89.6Pcy243. In the controls, the challenge dose (10 to 20 50% monkey infectious doses [MID50]) or MHC did not affect susceptibility to infection, peak viral load, or acute CD4 T-cell loss, whereas in the chronic phase of infection, the H1 haplotype correlated with a high viral load (P = 0.0280) and CD4 loss (P = 0.0343). Vaccination reduced the rate of infection acquisition at 10 MID50 (P < 0.0001), and contained acute CD4 loss at 15 MID50 (P = 0.0099). Haplotypes H2 and H6 were correlated with increased susceptibility (P = 0.0199) and resistance (P = 0.0087) to infection, respectively. Vaccination also contained CD4 depletion (P = 0.0391) during chronic infection, independently of the challenge dose or haplotype.Advances in typing of the major histocompatibility complex (MHC) of Mauritian cynomolgus macaques (14, 20, 26) have provided the opportunity to address the influence of host factors on vaccine studies (13). Retrospective analysis of 22 macaques vaccinated with Tat or a Tat-expressing adenoviral vector revealed that monkeys with the H6 or H3 MHC class IB haplotype were overrepresented among aviremic or controller animals, whereas macaques with the H2 or H5 haplotype clustered in the noncontrollers (12). More recently, the H6 haplotype was reported to correlate with control of chronic infection with simian immunodeficiency virus (SIV) mac251, regardless of vaccination (18).Here, we performed a retrospective analysis of 112 Mauritian cynomolgus macaques, which included the 22 animals studied previously (12), to evaluate the impact of the challenge dose and class IB haplotype on the acquisition and severity of simian/human immunodeficiency virus (SHIV) 89.6Pcy243 infection in 45 control monkeys and 67 monkeys vaccinated with Tat from different protocols (Table (Table11).
Open in a separate windowaAll animals were inoculated with the indicated dose of Tat plasmid DNA (pCV-tat [8], adenovirus-tat [Ad-tat] [27]) or protein, Gag protein, or empty vectors (pCV-0, adenovirus [Ad]) by the indicated route. Doses are in micrograms unless indicated otherwise.bAlum, aluminum phosphate (4); RIBI oil-in-water emulsions containing squalene, bacterial monophosphoryl lipid A, and refined mycobacterial products (4); Iscom, immune-stimulating complex (4); H1D are biocompatible anionic polymeric microparticles used for vaccine delivery (10, 12, 25a).cs.c., subcutaneous; i.m., intramuscular; i.d., intradermal; i.n., intranasal; i.t., intratracheal.dAll animals were inoculated intravenously with the indicated dose of the same SHIV89.6.Pcy243 stock.eAccording to the virological outcome upon challenge, monkeys were grouped as aviremic (A), controllers (C), or viremic (V).fBecause of the short follow-up, controller status could not be determined and all infected monkeys of the ISS-TG protocol were therefore considered viremic.gNA, not applicable. 相似文献
TABLE 1.
Summary of treatment, challenge dose, and outcome of infection in cynomolgus monkeysProtocol code | No. of monkeys | Immunogen (dose)a | Adjuvantb | Schedule of immunization (wk) | Routec | Challenged (MID50) | Virological outcomee | Reference(s) or source | ||
---|---|---|---|---|---|---|---|---|---|---|
A | C | V | ||||||||
ISS-ST | 6 | Tat (10) | Alum or RIBI | 0, 2, 6, 12, 15, 21, 28, 32, 36 | s.c., i.m. | 10 | 4 | 1 | 1 | 4, 17 |
ISS-ST | 1 | Tat (6) | None | 0, 5, 12, 17, 22, 27, 32, 38, 42, 48 | i.d. | 10 | 1 | 0 | 0 | 4, 17 |
ISS-PCV | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben | 0, 2, 6, 11, 15, 21, 28, 32, 36 | i.m. | 10 | 3 | 0 | 0 | 6 |
ISS-ID | 3 | Tat (6) | none | 0, 4, 8, 12, 16, 20, 24, 28, 39, 43, 60 | i.d. | 10 | 1 | 1 | 1 | B. Ensoli, unpublished data |
ISS-TR | 6 | Tat (10) | Alum-Iscom | 0, 2, 6, 11, 16, 21, 28, 32, 36 | s.c., i.d., i.m. | 10 | 4 | 2 | 0 | Ensoli, unpublished |
ISS-TGf | 3 | Tat (10) | Alum | 0, 4, 12, 22 | s.c. | 15 | 0 | 3 | Ensoli, unpublished | |
ISS-TG | 3 | Tatcys22 (10) | Alum | 15 | 0 | 3 | Ensoli, unpublished | |||
ISS-TG | 4 | Tatcys22 (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-TG | 4 | Tat (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-MP | 3 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 38 | s.c., i.m. | 15 | 0 | 2 | 1 | Ensoli, unpublished |
ISS-MP | 3 | Tat (10) | Alum | s.c. | 15 | 0 | 0 | 3 | Ensoli, unpublished | |
ISS-GS | 6 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 36 | s.c., i.m. | 15 | 1 | 3 | 2 | Ensoli, unpublished |
NCI-Ad-tat/Tat | 7 | Ad-tat (5 × 108 PFU), Tat (10) | Alum | 0, 12, 24, 36 | i.n., i.t., s.c. | 15 | 2 | 3 | 2 | Ensoli, unpublished |
NCI-Tat | 9 | Tat (6 and 10) | Alum/Iscom | 0, 2, 6, 11, 15, 21, 28, 32, 36 | s.c., i.d., i.m. | 15 | 2 | 4 | 3 | 12 |
ISS-NPT | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 0 | 0 | 3 | Ensoli, unpublished |
ISS-NPT | 3 | pCV-tatcys22 (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 1 | 1 | 1 | |
Total vaccinated | 67 | 19 | 17 | 31 | ||||||
Naive | 11 | None | None | NAg | NA | 10 or 15 | 1 | 3 | 7 | |
Control | 34 | None, Ad, or pCV-0 | Alum, RIBI, H1D, Iscom or bupivacaine + methylparaben-Iscom | s.c., i.d., i.n., i.t., i.m. | 10, 15, or 20 | 5 | 13 | 16 | ||
Total controls | 45 | 6 | 16 | 23 | ||||||
Total | 112 | 25 | 33 | 54 |