Peptide Linkage to the α-Subunit of MHCII Creates a Stably Inverted Antigen Presentation Complex

Class II proteins of the major histocompatibility complex (MHCII) typically present exogenous antigenic peptides to cognate T cell receptors of CD4-T lymphocytes. The exact conformation of peptide–MHCII complexes (pMHCII) can vary depending on the length, register and orientation of the bound peptide. We have recently found the self-peptide CLIP (class‐II-associated invariant chain‐derived peptide) to adopt a dynamic bidirectional binding mode with regard to the human MHCII HLA-DR1 (HLA, human leukocyte antigen). We suggested that inversely bound peptides could activate specific T cell clones in the context of autoimmunity. As a first step to prove this hypothesis, pMHC complexes restricted to either the canonical or the inverted peptide orientation have to be constructed. Here, we show that genetically encoded linkage of CLIP and two other antigenic peptides to the HLA-DR1 α-chain results in stable complexes with inversely bound ligands. Two‐dimensional NMR and biophysical analyses indicate that the CLIP-bound pMHC^inv complex (pMHC^inv, inverted MHCII–peptide complex) displays high thermodynamic stability but still allows for the exchange against higher‐affinity viral antigen. Complemented by comparable data on a corresponding β-chain-fused canonical HLA-DR1/CLIP complex, we further show that linkage of CLIP leads to a binding mode exactly the same as that of the corresponding unlinked constructs. We suggest that our approach constitutes a general strategy to create pMHC^inv complexes. Such engineering is needed to create orientation-specific antibodies and raise T cells to study phenomena of autoimmunity caused by isomeric pMHCs.     

The Thalidomide-Binding Domain of Cereblon Defines the CULT Domain Family and Is a New Member of the β-Tent Fold

Despite having caused one of the greatest medical catastrophies of the last century through its teratogenic side-effects, thalidomide continues to be an important agent in the treatment of leprosy and cancer. The protein cereblon, which forms an E3 ubiquitin ligase compex together with damaged DNA-binding protein 1 (DDB1) and cullin 4A, has been recently indentified as a primary target of thalidomide and its C-terminal part as responsible for binding thalidomide within a domain carrying several invariant cysteine and tryptophan residues. This domain, which we name CULT (cereblon domain of unknown activity, binding cellular ligands and thalidomide), is also found in a family of secreted proteins from animals and in a family of bacterial proteins occurring primarily in δ-proteobacteria. Its nearest relatives are yippee, a highly conserved eukaryotic protein of unknown function, and Mis18, a protein involved in the priming of centromeres for recruitment of CENP-A. Searches for distant homologs point to an evolutionary relationship of CULT, yippee, and Mis18 to proteins sharing a common fold, which consists of two four-stranded β-meanders packing at a roughly right angle and coordinating a zinc ion at their apex. A β-hairpin inserted into the first β-meander extends across the bottom of the structure towards the C-terminal edge of the second β-meander, with which it forms a cradle-shaped binding site that is topologically conserved in all members of this fold. We name this the β-tent fold for the striking arrangement of its constituent β-sheets. The fold has internal pseudosymmetry, raising the possibility that it arose by duplication of a subdomain-sized fragment.     

Elucidation of the Molecular Basis for Arabinoxylan-Debranching Activity of a Thermostable Family GH62 α-l-Arabinofuranosidase from Streptomyces thermoviolaceus

Xylan-debranching enzymes facilitate the complete hydrolysis of xylan and can be used to alter xylan chemistry. Here, the family GH62 α-l-arabinofuranosidase from Streptomyces thermoviolaceus (SthAbf62A) was shown to have a half-life of 60 min at 60°C and the ability to cleave α-1,3 l-arabinofuranose (l-Araf) from singly substituted xylopyranosyl (Xylp) backbone residues in wheat arabinoxylan; low levels of activity on arabinan as well as 4-nitrophenyl α-l-arabinofuranoside were also detected. After selective removal of α-1,3 l-Araf substituents from disubstituted Xylp residues present in wheat arabinoxylan, SthAbf62A could also cleave the remaining α-1,2 l-Araf substituents, confirming the ability of SthAbf62A to remove α-l-Araf residues that are (1→2) and (1→3) linked to monosubstituted β-d-Xylp sugars. Three-dimensional structures of SthAbf62A and its complex with xylotetraose and l-arabinose confirmed a five-bladed β-propeller fold and revealed a molecular Velcro in blade V between the β1 and β21 strands, a disulfide bond between Cys27 and Cys297, and a calcium ion coordinated in the central channel of the fold. The enzyme-arabinose complex structure further revealed a narrow and seemingly rigid l-arabinose binding pocket situated at the center of one side of the β propeller, which stabilized the arabinofuranosyl substituent through several hydrogen-bonding and hydrophobic interactions. The predicted catalytic amino acids were oriented toward this binding pocket, and the catalytic essentiality of Asp53 and Glu213 was confirmed by site-specific mutagenesis. Complex structures with xylotetraose revealed a shallow cleft for xylan backbone binding that is open at both ends and comprises multiple binding subsites above and flanking the l-arabinose binding pocket.     

The Effects of Simvastatin or Interferon-α on Infectivity of Human Norovirus Using a Gnotobiotic Pig Model for the Study of Antivirals

The lack of an animal model for human norovirus (HuNoV) has hindered the development of therapeutic strategies. This study demonstrated that a commonly used cholesterol-lowering statin medication, simvastatin, which increases HuNoV replication in an in vitro replicon system, also enhances HuNoV infectivity in the gnotobiotic (Gn) pig model. In contrast, oral treatment with interferon (IFN)-α reduces HuNoV infectivity. Young piglets, all with A or H1 histo-blood group antigens on enterocytes, were treated orally with 8 mg/kg/day of simvastatin; 5 days later, the pigs were inoculated orally with a GII.4 HuNoV (HS194/2009/US strain) and then treated with simvastatin for 5 more days. Simvastatin induced significantly earlier onset and longer duration of HuNoV fecal shedding in treated pigs, frequently with higher fecal viral titers. Simvastatin impaired poly (I:C)-induced IFN-α expression in macrophages or dendritic cells, possibly due to lowered toll-like receptor (TLR) 3 expression; however, the mechanisms were not related to interferon regulatory factor 3 or nuclear factor kappa B signaling pathway. Thus, the enhanced, earlier infectivity of HuNoV in simvastatin-treated pigs coincided with the inhibitory effect of simvastatin on innate immunity. In contrast to the increased HuNoV shedding that simvastatin induced, viral shedding during the treatment period was reduced or curtailed in the HuNoV-inoculated pigs pre-treated/treated with human IFN-α. Our findings are the first to indicate that IFN-α has potential as antiviral therapy against HuNoV. Based on these intriguing and novel findings using the Gn pig model, we confirmed that HuNoV infectivity is altered by treatment with simvastatin or IFN-α. Collectively, these findings indicate that Gn pigs are a useful model to test immunomodulators or efficacy of antivirals against HuNoV.     

Attempted Detection of Toxoplasma gondii Oocysts in Environmental Waters Using a Simple Approach to Evaluate the Potential for Waterborne Transmission in the Galápagos Islands,Ecuador

Toxoplasmosis is a health concern for wildlife and humans, particularly in island ecosystems. In the Galápagos Islands, exposure to Toxoplasma gondii has been found in marine avifauna on islands with and without domestic cats. To evaluate potential waterborne transmission of T. gondii, we attempted to use filtration and epifluorescent microscopy to detect autofluorescent T. gondii oocysts in fresh and estuarine surface water samples. T. gondii oocyst-like structures were microscopically visualized but were not confirmed by polymerase chain reaction and sequence analyses. Further research is needed to refine environmental pathogen screening techniques and to evaluate disease risk of waterborne zoonoses such as T. gondii for wildlife and humans, particularly in the Galápagos and other naive island ecosystems.     

The Collagen-binding Integrin α2β1 Is a Novel Interaction Partner of the Trimeresurus flavoviridis Venom Protein Flavocetin-A

Many snake venoms are known for their antithrombotic activity. They contain components that specifically target different platelet-activating receptors such as the collagen-binding integrin α2β1 and the von Willebrand factor receptor GPIb. In a search for an α2β1 integrin-blocking component from the venom of the habu snake (Trimeresurus flavoviridis), we employed two independent purification protocols. First, we used the integrin α2A domain, a major collagen-binding domain, as bait for affinity purification of an α2β1 integrin-binding toxin from the crude venom. Second, in parallel, we used classical protein separation protocols and tested for α2β1 integrin-inhibiting capabilities by ELISA. Using both approaches, we identified flavocetin-A as an inhibitor of α2β1 integrin. Hitherto, flavocetin-A has been reported as a GPIb inhibitor. However, flavocetin-A inhibited collagen-induced platelet aggregation even after GPIb was blocked with other inhibitors. Moreover, flavocetin-A antagonized α2β1 integrin-mediated adhesion and migration of HT1080 human fibrosarcoma cells, which lack any GPIb, on collagen. Protein chemical analyses proved that flavocetin-A binds to α2β1 integrin and its α2A domain with high affinity and in a cooperative manner, which most likely is due to its quaternary structure. Kinetic measurements confirmed the formation of a strong complex between integrin and flavocetin-A, which dissociates very slowly. This study proves that flavocetin-A, which has long been known as a GPIb inhibitor, efficiently targets α2β1 integrin and thus blocks collagen-induced platelet activation. Moreover, our findings suggest that the separation of GPIb- and α2β1 integrin-blocking members within the C-type lectin-related protein family is less strict than previously assumed.     

Nickel is a specific antagonist for the catabolism of activated α2-macroglobulin

The multifunctional low density lipoprotein receptor-related protein/α₂-macroglobulin receptor (LRP) binds and degrades several ligands involved in protease and lipoprotein metabolism. We previously reported that nickel (Ni²⁺) specifically inhibits the binding of activated α₂-macroglobulin (α₂M^*) at 4°C to LRP and had no effect on the binding of other ligands to the receptor (Hussain et al. (1995) Biochem. 34, 16074–16081). In the current investigation, we have examined the effect of Ni²⁺ on the catabolism of ¹²⁵I-labeled α₂M^*, receptor-associated protein (RAP) and lactoferrin at physiologic temperatures by fibroblasts. Nickel completely inhibited the degradation of α₂M^* over a wide range of concentrations (0.3–2.4 nM); 50% inhibition for the degradation of 1.2 nM α₂M^* was observed at 0.5 mM Ni²⁺. Furthermore, nickel inhibited the binding, internalization and degradation of ¹²⁵I-α₂M^* in a dose- and time- dependent manner. In contrast, the degradation of several concentrations of ¹²⁵I-RAP by fibroblasts was not affected by different amounts of Ni²⁺ for various times. Similarly, Ni²⁺ did not inhibit the degradation of lactoferrin either before or after treating the cells with heparitinase to remove cell-surface proteoglycans. The degradation of lactoferrin was, however, inhibited by the RAP indicating that lactoferrin degradation was mediated by the LRP. These data suggest that Ni²⁺ is a specific inhibitor for the degradation of α₂M^*.     

Is the secret for a successful aging to keep track of cancer pathways?

A successful aging could be gained by life satisfaction, social functioning, or psychological resources and, definitely, by increasing resistance to diverse age‐related pathologies. Nowadays, cancer can be considered an age‐related disease since the incidence of most cancers increases with age, rising more rapidly beginning in midlife. Although adults with extended longevity are less likely to develop cancer, it is now emerging that aging and cancer share common molecular links, and thus targeting these mechanisms may be suitable to treat multiple disorders, for the prolonging of healthy aging. At present, one of the cornerstones of antiaging is hormone‐replacement therapy to treat diseases associated with a state of age‐related sex‐hormone deficiency in women and men; however, many studies question the relationship of hormone replacement to cancer recurrence. Here, we discuss signaling and metabolic molecular crossroad linking aging and cancer. This is useful to argue about the current knowledge of prolongevity and druggable targets and to motivate specific intervention strategies that could modify practices of the aging population, activating multiple longevity pathways but keeping track of cancer pathways, thereby potentially preserving health status.     

Orientation of the Calcium Channel β Relative to the α12.2 Subunit Is Critical for Its Regulation of Channel Activity

Background

The Ca_vβ subunits of high voltage-activated Ca²⁺ channels control the trafficking and biophysical properties of the α₁ subunit. The Ca_vβ-α₁ interaction site has been mapped by crystallographic studies. Nevertheless, how this interaction leads to channel regulation has not been determined. One hypothesis is that βs regulate channel gating by modulating movements of IS6. A key requirement for this direct-coupling model is that the linker connecting IS6 to the α-interaction domain (AID) be a rigid structure.

Methodology/Principal Findings

The present study tests this hypothesis by altering the flexibility and orientation of this region in α₁2.2, then testing for Ca_vβ regulation using whole cell patch clamp electrophysiology. Flexibility was induced by replacement of the middle six amino acids of the IS6-AID linker with glycine (PG6). This mutation abolished β2a and β3 subunits ability to shift the voltage dependence of activation and inactivation, and the ability of β2a to produce non-inactivating currents. Orientation of Ca_vβ with respect to α₁2.2 was altered by deletion of 1, 2, or 3 amino acids from the IS6-AID linker (Bdel1, Bdel2, Bdel3, respectively). Again, the ability of Ca_vβ subunits to regulate these biophysical properties were totally abolished in the Bdel1 and Bdel3 mutants. Functional regulation by Ca_vβ subunits was rescued in the Bdel2 mutant, indicating that this part of the linker forms β-sheet. The orientation of β with respect to α was confirmed by the bimolecular fluorescence complementation assay.

Conclusions/Significance

These results show that the orientation of the Ca_vβ subunit relative to the α₁2.2 subunit is critical, and suggests additional points of contact between these subunits are required for Ca_vβ to regulate channel activity.     

The α-Subunit of the Arabidopsis Heterotrimeric G Protein,GPA1, Is a Regulator of Transpiration Efficiency

Land plants must balance CO₂ assimilation with transpiration in order to minimize drought stress and maximize their reproductive success. The ratio of assimilation to transpiration is called transpiration efficiency (TE). TE is under genetic control, although only one specific gene, ERECTA, has been shown to regulate TE. We have found that the α-subunit of the heterotrimeric G protein in Arabidopsis (Arabidopsis thaliana), GPA1, is a regulator of TE. gpa1 mutants, despite having guard cells that are hyposensitive to abscisic acid-induced inhibition of stomatal opening, have increased TE under ample water and drought stress conditions and when treated with exogenous abscisic acid. Leaf-level gas-exchange analysis shows that gpa1 mutants have wild-type assimilation versus internal CO₂ concentration responses but exhibit reduced stomatal conductance compared with ecotype Columbia at ambient and below-ambient internal CO₂ concentrations. The increased TE and reduced whole leaf stomatal conductance of gpa1 can be primarily attributed to stomatal density, which is reduced in gpa1 mutants. GPA1 regulates stomatal density via the control of epidermal cell size and stomata formation. GPA1 promoter::β-glucuronidase lines indicate that the GPA1 promoter is active in the stomatal cell lineage, further supporting a function for GPA1 in stomatal development in true leaves.Land plants, in particular plants that utilize C₃ photosynthesis, must balance CO₂ acquisition with water loss in order to maximize fitness. The water loss cost per unit of biomass acquired can be expressed as transpiration efficiency (TE; also referred to as water-use efficiency), the ratio of CO₂ assimilation (A) to transpiration. TE strongly correlates with the δ¹³C of plant tissue, the ratio of ¹³C to ¹²C relative to a standard (Farquhar et al., 1982, 1989; Dawson et al., 2002). The physiological basis of this correlation is that in plants there is diffusional and biochemical discrimination against ¹³C, the heavier and less abundant stable isotope of carbon. Discrimination against ¹³C decreases with decreasing internal CO₂ concentration (C_i), which can result from either increased A or reduced stomatal conductance (g_s; Farquhar et al., 1982). While it is known that g_s (a main factor controlling transpiration) correlates with A (Wong et al., 1979), genetic variation for TE and/or δ¹³C has been documented in a number of species (Farquhar and Richards, 1984; Virgona et al., 1990; Ehleringer et al., 1991; Comstock and Ehleringer, 1992; Hammer et al., 1997; Lambrides et al., 2004). In Arabidopsis (Arabidopsis thaliana), multiple quantitative trait loci associated with TE have been identified, indicating that TE is under genetic control (Juenger et al., 2005; Masle et al., 2005; McKay et al., 2008). However, only one gene, ERECTA, has been specifically identified as a regulator of TE (Masle et al., 2005). ERECTA encodes a Leu-rich repeat receptor-like kinase (Torii et al., 1996) and regulates TE via the control of stomatal density, g_s, mesophyll cell proliferation, and photosynthetic capacity (Masle et al., 2005).Heterotrimeric G proteins are GTP-binding proteins that function in the transduction of extracellular signals into intracellular responses. In its inactive state, the G protein classically exists as a trimer consisting of an α-subunit (Gα) bound to GDP, a β-subunit (Gβ), and a γ-subunit (Gγ). When a ligand binds to a G protein-coupled receptor (GPCR), a conformational change occurs in the G protein, resulting in the exchange of GDP for GTP and the dissociation of Gα-GTP from the Gβγ dimer. The G protein subunits remain active until the intrinsic GTPase activity of Gα results in the hydrolysis of GTP to GDP and the reassociation of the inactive trimer. The Arabidopsis genome contains canonical Gα and Gβ genes, GPA1 and AGB1, and two genes known to encode Gγs, AGG1 and AGG2 (Assmann, 2002). One likely GPCR, GCR1, has been functionally characterized (Pandey and Assmann, 2004), and additional GPCRs have been predicted using bioinformatics (Moriyama et al., 2006; Gookin et al., 2008) and interaction with GPA1 in yeast-based protein-protein interaction assays (Gookin et al., 2008). Recently, a new class of G proteins, GPCR-type G proteins (GTG1 and GTG2), have been identified in Arabidopsis that also serve as one class of abscisic acid (ABA) receptors (Pandey et al., 2009).Despite the paucity of heterotrimeric G protein subunit genes in the Arabidopsis genome as compared with mammalian systems, functional studies of heterotrimeric G protein mutants suggest that G protein function is diverse in Arabidopsis. G proteins have been shown to function in developmental processes and hormonal and environmental signaling, including stomatal aperture regulation (Perfus-Barbeoch et al., 2004; Joo et al., 2005; Chen et al., 2006; Pandey et al., 2006; Trusov et al., 2006; Warpeha et al., 2007; Fan et al., 2008; Zhang et al., 2008a, 2008b). In response to drought stress, ABA concentration increases in the leaves (Davies and Zhang, 1991; Davies et al., 2005), where it promotes stomatal closure and inhibits stomatal opening (Schroeder et al., 2001). The G protein α- and β-subunit mutants, gpa1 and agb1, respectively, are hyposensitive to ABA inhibition of stomatal opening while displaying wild-type ABA promotion of stomatal closure (Wang et al., 2001; Fan et al., 2008). ABA inhibits stomatal opening in part by inhibiting inward-rectifying K⁺ channels, reducing K⁺ influx and therefore water entry into the cell (Schroeder et al., 2001). ABA inhibition of inward K⁺ channel activity is reduced in both gpa1 and agb1 mutants (Wang et al., 2001; Fan et al., 2008). agg1 and agg2 mutants show no altered regulation of ABA-induced stomatal movements or ion channel activities, suggesting that the genome contains additional unknown Gγ(s) or that heterotrimeric G protein signaling in plants does not always operate according to the mammalian paradigm (Trusov et al., 2008). gcr1 mutants are hypersensitive to both ABA inhibition of opening and ABA promotion of stomatal closure (Pandey et al., 2006). gtg1 gtg2 double mutants show a wild-type response for ABA inhibition of stomatal opening and are hyposensitive in ABA promotion of stomatal closure (Pandey et al., 2009).While the altered stomatal sensitivities of the G protein mutants to ABA suggest that heterotrimeric G proteins may function in the regulation of whole plant water status, few experiments have been performed at the whole leaf or whole plant level. gpa1 mutants in the Wassilewskija background display increased water loss from excised leaves (Wang et al., 2001); however, there are no published reports of experiments assessing whole plant water status in gpa1 or agb1 mutants. gcr1 mutants show reduced water loss from excised leaves, drought tolerance, and improved recovery following the cessation of drought stress (Pandey and Assmann, 2004). In addition to their altered guard cell sensitivities to ABA, gpa1, agb1, and gcr1 mutants are hypersensitive to ABA inhibition of root and seedling development (Pandey et al., 2006), which could have impacts on whole plant water status. Finally, it has been recently reported that gpa1 and agb1 mutants have reduced and increased stomatal densities, respectively, in cotyledons (Zhang et al., 2008a). While stomatal density of leaves can be an important component of whole plant water status, the study by Zhang et al. (2008a) was performed on cotyledons only, whose developmental programs are often independent from those of true leaves (Chandler, 2008). Therefore, it is difficult to infer how this cotyledon phenotype will affect water relations at the whole plant level. Taken together, the stomatal aperture, electrophysiology, and tissue-specific ABA phenotypes of the G protein mutants, in addition to the possibility for altered stomatal density in the G protein mutant leaves, make it difficult to predict how G proteins contribute to the regulation of whole-plant TE. For example, the ABA-hyposensitive stomatal phenotype of gpa1 could result in increased transpiration, possibly reducing TE under certain conditions. Conversely, if gpa1 mutant leaves have reduced stomatal density, transpiration may be reduced, which could enhance TE under a range of conditions. Previous attempts to address the contributions of G proteins to whole plant transpiration, TE, and drought response using excised leaf/rosette assays to measure water loss are not sufficient, because both transpiration and A must be taken into account. Therefore, we investigated the role of GPA1 in regulating TE under ample water and drought stress conditions and in the presence of ABA. We have identified GPA1 as a negative regulator of TE in Arabidopsis via the control of g_s and stomatal proliferation.     

The N-terminal globular domain of the laminin α1 chain binds to α1β1 and α2β1 integrins and to the heparan sulfate-containing domains of perlecan

The N-terminal domains VI plus V (62 kDa) and V alone (43 kDa) of the laminin α1 chain were obtained as recombinant products and shown to be folded into a native form by electron microscopy and immunological assays. Domain VI alone, which corresponds to an LN module, did not represent an autonomously folding unit in mammalian cells, however. Fragment α1VI/V, but not fragment α1V, bound to purified α1β1 and α2β1 integrins, to heparin, and to heparan sulfate-substituted domains I and V of perlecan. This localized the binding activities to the LN module, which contains two basic sequences suitable for heparin interactions.     

The tip region of the MacA α-hairpin is important for the binding to TolC to the Escherichia coli MacAB-TolC pump

The tripartite efflux pump MacAB-TolC found in Gram-negative bacteria is involved in resistance to antibiotics. We previously reported the funnel-like hexameric structure of the adaptor protein MacA to be physiologically relevant. In this study, we investigated the role of the tip region of its α-hairpin, which forms a cogwheel structure in the funnel-like shape of the MacA hexamer. Mutational and biochemical analyses revealed that the conserved residues located at the tip region of the α-hairpin of MacA play an essential role in the binding of TolC. Our findings offer a molecular basis for understanding the drug resistance of pathogenic bacteria.     

Is There a Role for alpha-Blockers for the Treatment of Voiding Dysfunction Unrelated to Benign Prostatic Hyperplasia?

alpha-Adrenoreceptor antagonists have become the primary medical treatment for lower urinary tract symptoms associated with benign prostatic hyperplasia (BPH). It was presumed that the primary mechanism by which alpha-blockers reduced lower urinary tract symptoms (LUTS) was by relaxation of smooth muscle in the prostate through a sympathetic response. Reduction of outlet resistance leads to changes in bladder function, thus improving both storage and voiding symptoms. However, it was observed that many patients with BPH-associated LUTS had significant improvement in storage symptoms without subjective or objective improvement in voiding. Storage symptoms associated with detrusor overactivity (frequency, urgency, and urge incontinence) are typically thought of as being parasympathetically mediated, and therefore anticholinergic medications have been the mainstay of pharmacological treatment, but recent work has suggested that several nonparasympathetic-mediated mechanisms may cause detrusor overactivity. Because alpha receptors appear to play a role in lower urinary tract function at multiple sites and levels, alpha-blockers could be used to treat voiding dysfunction not related to BPH. In addition, these nonprostate effects should be gender-independent, making the use of alpha-blockers plausible in women with specific types of voiding dysfunction.     

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes

The promoters of wheat, barley and wild oat -Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X_4–5-C-X_22–23-H-X₁-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.     

Bee Venom Phospholipase A2, a Good “Chauffeur” for Delivering Tumor Antigen to the MHC I and MHC II Peptide-Loading Compartments of the Dendritic Cells: The Case of NY-ESO-1

Bee venom phospholipase A2 (bvPLA2) is a small, 15kDa enzyme which hydrolyses many phospholipids through interfacial binding. The mutated bvPLA2H34Q (bvPLA2m), in which histidine-34 is replaced by glutamine, is not catalytically active. This protein has been shown to be a suitable membrane anchor and has been suggested as a suitable tumor-antigen vector for the development of novel dendritic cell-based vaccines. To confirm this feature, in this study the fusion protein PNY, composed of NY-ESO-1(NY(s)) fused to the C-terminus of bvPLA2m, was engineered. bvPLA2m enhanced the binding of NY(s) to the membrane of human monocyte-derived dendritic cells (DCs) and, once taken up by the cells, the antigen fused to the vector was directed to both MHC I and MHC II peptide-loading compartments. bvPLA2m was shown to increase the cross-presentation of the NY(s)-derived, restricted HLA-A*02 peptide, NY-ESO-1_157-165(NY_157-165), at the T1 cell surface. DCs loaded with the fusion protein induced cross-priming of NY(s)-specific CD8 + T-cells with greater efficiency than DCs loaded with NY(s). Sixty-five percent of these NY(s)-specific CD8+ T-cell lines could also be activated with the DCs pulsed with the peptide, NY_157-165. Of these CD8+ T-cell lines, two were able to recognize the human melanoma cell line, SK-MEL-37, in a context of HLA-A*02. Only a small number of bvPLA2m CD8+ T-cell lines were induced, indicating the low immunogenicity of the protein. It was concluded that bvPLA2m can be used as a membrane-binding vector to promote MHC class II peptide presentation and MHC class I peptide cross-presentation. Such a system can, therefore, be tested for the preparation of cell-based vaccines.     

The transition from the native to the acid-state characterized by multi-spectroscopy approach: Study for the holo-form of bovine α-lactalbumin

The transition of the holo-form of bovine α-lactalbumin from the native (N) to the pH-generated acidic-state (A-state) was analyzed by probing its tertiary and secondary structure using a concerted spectroscopic approach combining near- and far-UV circular dichroism (CD), electrospray ionization ion mobility mass spectrometry (ESI-IM-MS), vibrational circular dichroism (VCD), and Fourier transform infrared spectroscopy (FTIR) in the attenuated total reflection (ATR) and transmission (TR) modes. The spectroscopic results, which relied on the interaction of an electromagnetic field with different molecular targets, confirmed the decay of extensive rigid side-chain packing interactions during the pH-induced N → A-state transition and revealed the targets' dependence on secondary structural changes. Independent analyses of the spectral changes using two methods of multivariate analysis, such as principal component analysis and two-dimensional correlation spectroscopy, revealed small but significant differences in the secondary structure as a result of the all-or-none transition. The cooperativity of the transition was quantitatively described using values corresponding to the mid-point (t_m) and width of the transition (Δt_m). The averages of the two parameters, calculated using the data collected by the different probes, were equal to 3.5 ± 0.2 and 0.6 ± 0.1(SE), respectively. The variable two-state nature of the cooperative N → A-state transition confirmed that the protonation of the side chain carboxyl groups on the Asp and Glu residues and that the release of a Ca^2 + ion induced structural changes on both the secondary and tertiary levels. The changes have been confirmed by results obtained from the concerted spectroscopic approach.