Reduced tooth size in 45,X (Turner syndrome) females

Mean values and variances of deciduous and permanent tooth dimensions were compared between 121 45,X (Turner syndrome) females and 171 control subjects to clarify the role of the X chromosome on dental development. Although deciduous molars tended to be smaller than normal in 45,X females, there was no evidence of a reduction in tooth size for deciduous anterior teeth. In the permanent dentition, all mesiodistal dimensions were significantly smaller in 45,X females but only some of the buccolingual dimensions were smaller. The findings for deciduous tooth-size may reflect a sampling effect related to the extremely high frequency of spontaneous abortion in 45,X individuals. Results for permanent teeth are consistent with the concept of a decrease in enamel thickness in 45,X females.     

A study of torus palatinus and torus mandibularis in Pre-Columbian Peruvians.

An incidence of tori lower than previously reported was found in a population from Pre-Columbian Peru. It is suggested that the prevalence of tori along with other genetic markers with racial variation may be used to help identify and define a population group.     

Mammalian X Chromosome Dosage Compensation: Perspectives From the Germ Line

Sex chromosomes are advantageous to mammals, allowing them to adopt a genetic rather than environmental sex determination system. However, sex chromosome evolution also carries a burden, because it results in an imbalance in gene dosage between females (XX) and males (XY). This imbalance is resolved by X dosage compensation, which comprises both X chromosome inactivation and X chromosome upregulation. X dosage compensation has been well characterized in the soma, but not in the germ line. Germ cells face a special challenge, because genome wide reprogramming erases epigenetic marks responsible for maintaining the X dosage compensated state. Here we explain how evolution has influenced the gene content and germ line specialization of the mammalian sex chromosomes. We discuss new research uncovering unusual X dosage compensation states in germ cells, which we postulate influence sexual dimorphisms in germ line development and cause infertility in individuals with sex chromosome aneuploidy.     

Unequal X Chromosomes in Bradysia Hygida (Diptera:Sciaridae) Females: Karyotype Assembly and Morphometric Analysis

The mitotic chromosomes of Bradysia hygida(Diptera:Sciaridae) neuroblast cells are described together with their morphometric data. Giemsa-stained neuroblast chromosomes from female and male larvae confirm the chromosome number of this species, 2n=8 (XX) and 2n=7 (XO), respectively. The karyotype assembly reveals two metacentric autosomic pairs, the A and B chromosome; a subtelocentric, the C chromosome, the smallest one; and a sexual unequal metacentric pair, X chromosome, in female karyotype and a one sexual metacentric X chromosome in male. The implications of the unequal X chromosome pair are discussed.     

Cytogenetic mapping of the W chromosome in the genus Leporinus (Teleostei, Anostomidae) using a highly repetitive DNA sequence

The distribution of the Leporinus elongatus LeSpeI repetitive sequence in other Leporinus species was studied in an attempt to elucidate the evolutionary history of sex chromosomes in this genus using chromosome fluorescence in situ hybridization. The presence of fluorescent signals only in species that have differentiated sex chromosomes suggests that this sequence is related to the differentiation of sex chromosomes in this genus. Thus, these data will contribute to a better understanding of chromosome evolution, especially for sex chromosomes, in the Leporinus genus.     

An unusual sex-determination system in South American field mice (Genus Akodon): the role of mutation, selection, and meiotic drive in maintaining XY females

The mechanism of sex determination in mammals appears highly conserved: the presence of a Y chromosome triggers the male developmental pathway, whereas the absence of a Y chromosome results in a default female phenotype. However, if the Y chromosome fails to initiate the male pathway (referred to as Y*), XY* females can result, as is the case in several species of South American field mice (genus Akodon). The breeding genetics in this system inherently select against the Y* chromosome such that the frequency of XY* females should decrease rapidly to very low frequencies. However, in natural populations of Akodon, XY* females persist at substantial frequencies; for example, 10% of females are XY* in A. azarae and 30% in A. boliviensis. We develop a mathematical model that considers the potential roles of three evolutionary forces in maintaining XY* females: Y-to-Y* chromosome transitions (mutation), chromosome segregation distortion (meiotic drive), and differential fecundity (selection). We then test the predictions of our model using data from breeding colonies of A. azarae. We conclude that any single force is inadequate to maintain XY* females. However, a combination of segregation bias of the male and female Y chromosomes during spermatogenesis/oogenesis and increased fecundity in XY* females could account for the observed frequencies of XY* females.     

A Sri Lankan child with 49,XXXXY syndrome

Pentasomy 49,XXXXY is a rare sex chromosome disorder usually presenting with ambigous genitalia, facial dysmorphism, mental retardation and a combination of cardiac, skeletal and other malformations. The incidence of the condition is estimated to be 1 in 85,000 male births. Previously, this condition was identified as a Klinefelter variant. The condition is suspected in a patient, by a combination of characteristic clinical findings, and the diagnosis is confirmed by chromosome culture and karyotyping. In the case we report here, the main presentation of ambiguous genitalia led to a suspicion of a sex chromosome aneuploidy which was subsequently confirmed by chromosomal analysis.     

Occlusal morphology in 45,X females

Seventy-two 45,X females (Turner syndrome) were examined for occlusal anomalies. Prevalence comparisons were made with first-degree female relatives and female population controls. The method of Bj?rk et al [1964] was used for determination of malocclusion. The results clearly suggest an increased prevalence of occlusal anomalies in 45,X females. The most common malocclusions are cross bite, large maxillary overjet, distal molar occlusion, and a tendency to open bite. These anomalies reflect an imbalanced growth of the craniofacial skeleton in three dimensions. These findings suggest that genes on the human X chromosome are of importance in the harmonious growth and development of the craniofacial skeleton and ultimately normal occlusal morphology and relations.     

Achiasmate Segregation of a B Chromosome from the X Chromosome in Two Species of Psyllids (Psylloidea, Homoptera)

The segregation of a B chromosome from the X chromosome was studied in male meiosis in two psyllid species, Rhinocola aceris (L.) and Psylla foersteri (Flor.) (Psylloidea, Homoptera). The frequency of segregation was determined from cells at metaphase II. In R. aceris, the B chromosome was mitotically stable and segregated quite regularly from the X chromosome in four geographically distant populations, while it showed less regular, but preferential segregation in one population. This was attributed to the presence of B chromosome variants that differ in their ability to interact with the X chromosome in segregation. In P. foersteri, the B chromosome was mitotically unstable and segregated preferentially from the X chromosome in spermatocyte cysts, which displayed one B chromosome in every cell. Behaviour of the B chromosome and X chromosome univalents during meiotic prophase and at metaphase I in R. aceris, and during anaphase I in P. foersteri suggested that the regular segregation resulted from the incorporation of B chromosomes in achiasmate segregation mechanisms with the X chromosome in the place occupied by the Y chromosome in species with XY system. The regular segregation of a B chromosome from the X chromosome may obscure the distinction of a B chromosome and an achiasmate Y chromosome in some cases. This revised version was published online in August 2006 with corrections to the Cover Date.     

Dermatoglyphic differences between 45,X and other chromosomal abnormalities of Turner syndrome

Summary The dermatoglyphic findings in 87 patients with Turner syndrome are summarized. Comparisons are made between the 50 cases with 45,X karyotypes and the remaining 37 with different chromosomal abnormalities including 19 patients with an X long arm isochromosome cell line. The results indicate differences between the 45,X patients and the other chromosomal types which are in the same direction as the changes reported between Turner syndrome and normal controls.     

A supernumerary “B-sex” chromosome drives male sex determination in the Pachón cavefish,Astyanax mexicanus

1. Download : Download high-res image (219KB)
2. Download : Download full-size image

     

Population differentiation and speciation in the genus Characidium (Characiformes: Crenuchidae): effects of reproductive and chromosomal barriers

Both time and low gene flow are the key factors by which different biological species arise. The divergence process among lineages and the development of pre‐ or postzygotic isolation occur when gene flow events are lacking. The separation among species of the genus Characidium was analysed in relation to the geomorphological mechanisms in river courses, events of captured adjacent upland drainages in south‐eastern Brazil, and sex chromosome differences. The ZZ/ZW sex chromosomes of Characidium vary in size, morphology, degree of heterochromatinization, and presence/absence of ribosomal DNA. The goal of this study was to understand the mechanism of sex chromosome differentiation, its close association with the geological history of cladogenetic events among drainages, and reproductive isolation leading to Characidium speciation. The W‐specific probe from Characidium gomesi generated a highlighted signal on the entire W chromosome of C. gomesi, Characidium heirmostigmata, Characidium pterostictum, and Characidium sp., instead of karyotypes of three Characidium aff. zebra populations, which showed scattered signals. An evolutionary and biogeographic landscape arose by analysis of ribosomal DNA site location and differentiation of the sex chromosomes, which established mechanisms of reproductive isolation leading to meiotic barriers, keeping the biological unit distinct even if the contact among species was restored. © 2014 The Linnean Society of London, Biological Journal of the Linnean Society, 2014, 111 , 541–553.     

Chromosome numbers in antlions (Myrmeleontidae) and owlflies (Ascalaphidae) (Insecta,Neuroptera)

A short review of main cytogenetic features of insects belonging to the sister neuropteran families Myrmeleontidae (antlions) and Ascalaphidae (owlflies) is presented, with a particular focus on their chromosome numbers and sex chromosome systems. Diploid male chromosome numbers are listed for 37 species, 21 genera from 9 subfamilies of the antlions as well as for seven species and five genera of the owlfly subfamily Ascalaphinae. The list includes data on five species whose karyotypes were studied in the present work. It is shown here that antlions and owlflies share a simple sex chromosome system XY/XX; a similar range of chromosome numbers, 2n = 14-26 and 2n = 18-22 respectively; and a peculiar distant pairing of sex chromosomes in male meiosis. Usually the karyotype is particularly stable within a genus but there are some exceptions in both families (in the genera Palpares and Libelloides respectively). The Myrmeleontidae and Ascalaphidae differ in their modal chromosome numbers. Most antlions exhibit 2n = 14 and 16, and Palparinae are the only subfamily characterized by higher numbers, 2n = 22, 24, and 26. The higher numbers, 2n = 20 and 22, are also found in owlflies. Since the Palparinae represent a basal phylogenetic lineage of the Myrmeleontidae, it is hypothesized that higher chromosome numbers are ancestral for antlions and were inherited from the common ancestor of Myrmeleontidae + Ascalaphidae. They were preserved in the Palparinae (Myrmeleontidae), but changed via chromosomal fusions toward lower numbers in other subfamilies.     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

Case report: a successful pregnancy outcome in a patient with non-mosaic Turner syndrome (45, X) via in vitro fertilization

We describe a successful pregnancy outcome in a patient with non-mosaic Turner syndrome (45, X) via in vitro fertilization. The patient achieved a second pregnancy at 35 years of age. The her blood lymphocyte karyotype was examined by G-band and FISH. Furthermore, cumulus cells and her elbow skin cells were evaluated via FISH. Non-mosaic Turner syndrome was determined by G-banding [100 % (50/50) 45, X]. Lymphocytes were shown as 478/500 (95.6 %) cells of X sex chromosome signal, 15/500 (3.0 %) cells of XXX signal, and 7/500 (1.4 %) cells of XX signal. The cumulus cells were mosaic: 152/260 (58.5 %) were X; 84/260 (32.3 %) were XXX, 20/260 (7.7 %) were XX, and 4/260 (1.5 %) were XY. Moreover, skin cells included a mosaic karyotype [47, XXX(29)/46, XX(1)]. We conclude that the collection of a large number of blood lymphocytes can reveal different mosaic patterns (X, XX and XXX) by FISH in spite of non-mosaic Turner syndrome.     

Y chromosome conserved anchored tagged sequences (YCATS) for the analysis of mammalian male-specific DNA

Y chromosome haplotyping based on microsatellites or single nucleotide polymorphisms has recently proven to be a powerful approach for evolutionary studies of human populations, and also holds great promise for the studies of wild species. However, the use of the approach is hampered in most natural populations by the lack of Y chromosome markers and sequence information. Here, we report the large-scale development of Y chromosome conserved anchor tagged sequence (YCATS) markers in mammals by a polymerase chain reaction screening approach. Exonic primers flanking 48 different introns of Y-linked genes were developed based on human and mouse sequences, and screened on a set of 20 different mammals. On average about 10 introns were amplified for each species and a total of 100 kb of Y chromosome sequence were obtained. Intron size in humans was a reasonable predictor of intron size in other mammals (r2 = 0.45) and there was a negative correlation between human fragment size and amplification success. We discuss a number of factors affecting the possibility of developing conserved Y chromosome markers, including fast evolution of Y chromosome sequences due to male-biased mutation and adaptive evolution of male-specific genes, dynamic evolution of the Y chromosome due to being a nonrecombining unit, and homology with X chromosome sequences.     

Chromosomal diversification in populations of Characidium cf. gomesi (Teleostei, Crenuchidae)

Comparative cytogenetic studies carried out in two populations of Characidium cf. gomesi from Botucatu region, SP, Brazil, showed a similar karyotypic structure in a diploid number of 50 chromosomes, 32 metacentric and 18 submetacentric chromosomes for males and 31 metacentric and 19 submetacentric chromosomes for females as well as a ZZ-ZW sex chromosome system. Differences between both populations, however, were found in relation to the occurrence of B chromosomes and the distribution of 18S and 5S ribosomal DNA (rDNA) sites. Characidium cf. gomesi from the Alambari Stream, a component of the Tietê River basin, revealed 18S rDNA on Z and W chromosomes, while this gene was located on autosomes in the sample from the Paranapanema River basin. The 5S rDNA sites were observed in a single chromosomal pair (number 25) in the populations from Paranapanema and in two pairs in the specimens from Tietê (numbers 20 and 25). Besides that, in the sample from Paranapanema, both inter and intra-individual variations were found due to the occurrence of up to four heterochromatic supernumerary chromosomes in the cells. The life mode of this fish, restricted to headwaters and subjected to frequent breakdown into sub-populations, may have contributed to the fixation of such chromosomal differences. The karyotypic similarities found in the analysed populations, however, suggest that all are descended from the same ancestor group whereas their differences indicate that they are already existing in reproductively isolated populations.     

A case‐control study of brain structure and behavioral characteristics in 47,XXX syndrome

Trisomy X, the presence of an extra X chromosome in females (47,XXX), is a relatively common but under‐recognized chromosomal disorder associated with characteristic cognitive and behavioral features of varying severity. The objective of this study was to determine whether there were neuroanatomical differences in girls with Trisomy X that could relate to cognitive and behavioral differences characteristic of the disorder during childhood and adolescence. MRI scans were obtained on 35 girls with Trisomy X (mean age 11.4, SD 5.5) and 70 age‐ and sex‐matched healthy controls. Cognitive and behavioral testing was also performed. Trisomy X girls underwent a semi‐structured psychiatric interview. Regional brain volumes and cortical thickness were compared between the two groups. Total brain volume was significantly decreased in subjects with Trisomy X, as were all regional volumes with the exception of parietal gray matter. Differences in cortical thickness had a mixed pattern. The subjects with Trisomy X had thicker cortex in bilateral medial prefrontal cortex and right medial temporal lobe, but decreased cortical thickness in both lateral temporal lobes. The most common psychiatric disorders present in this sample of Trisomy X girls included anxiety disorders (40%), attention‐deficit disorder (17%) and depressive disorders (11%). The most strongly affected brain regions are consistent with phenotypic characteristics such as language delay, poor executive function and heightened anxiety previously described in population‐based studies of Trisomy X and also found in our sample.