共查询到20条相似文献,搜索用时 328 毫秒
1.
The constitutive heterochromatin of the Indian muntjac (Muntiacus muntjak) was examined following digestion with various restriction endonucleases (AluI, HaeIII, HinfI, and MboI), as well as by selective fluorescence staining with distamycin A plus 4'-6-diamidino-2-phenylindole. Distinct areas within the C-bands were found to have characteristic staining patterns which were more conspicuous in the sex chromosomes. Two dot-like structures resistant to AluI were found in the X and Y1 chromosomes in the same position as the nucleolus organizer regions. 相似文献
2.
We have used a combination of chromosome sorting, degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR), chromosome painting and digital image capturing and processing techniques for comparative chromosome analysis of members of the genus Muntiacus. Chromosome-specific paints from a female Indian muntjac were hybridised to the metaphase chromosomes of the Gongshan, Black, and Chinese muntjac by both single and three colour chromosome painting. Karyotypes and idiograms for the Indian, Gongshan, Black and Chinese muntjac were constructed, based on enhanced 4, 6-diamidino-2-phenylindole (DAPI) banding patterns. The hybridisation signal for each paint was assigned to specific bands or chromosomes for all of the above muntjac species. The interspecific chromosomal homology was demonstrated by the use of both enhanced DAPI banding and comparative chromosome painting. These results provide direct molecular cytogenetic evidence for the tandem fusion theory of the chromosome evolution of muntjac species.Deceased 相似文献
3.
B Mayr G Geber H Auer M Kalat W Schleger 《Canadian journal of genetics and cytology》1986,28(5):744-753
Sequential staining with a counterstain-contrasted fluorescent banding technique (chromomycin A3-distamycin A-DAPI) revealed the occurrence of distamycin A-4,6-diamidino-2-phenylindole (DA-DAPI) staining heterochromatin in the centromeric regions of chromosomes 33, 36, 37, and 38 in the wolf (Canis lupus pallipes) and of chromosomes 13, 16, and 23 in the blue fox (Alopex lagopus). The red fox (Vulpes vulpes) lacked such regions. Staining with DAPI--actinomycin D produced a QFH-type banding pattern with clearcut differences in the staining behaviour of DA-DAPI positive regions between these three canid species. Staining with the fluorochrome D 287/170 did not preferentially highlight any of the DA-DAPI positive regions in any of them. Counterstain-enhanced chromomycin A3 R-banding and studies of nucleolus organizer region location and activity confirmed a close relationship between the karyotype of the wolf and the domestic dog. Few heterochromatic marker bands were encountered in these two species, but heterochromatin polymorphism was evident in the blue fox. 相似文献
4.
Bright-field microscopy of silver-stained pachytene spermatocytes of a male Indian muntjac, Muntiacus muntjak revealed that (a) the synapsis between the autosomal homologs, including the long arm of the X and Y2, was normal, (b) the nucleolus organizer regions were present in both the No. 1 bivalent and the long arm of the X and Y2, (c) the accessory structures of the X chromosome short arm in the forms of light and dark thickenings and the hairpin-like bend were present despite the X-autosome translocation, (d) a short synaptonemal complex was present between the Y1 (real Y) and the short arm of the X chromosome, and (e) the centromeric orientation of the Y1 and Y2 chromosomes was in Cis configuration as opposed to the X chromosome. 相似文献
5.
This paper describes a 4-6-diamidino-2-phenylindole (DAPI) fluorescent technique for differentiation of sister chromatids and for the study of sister chromatid exchanges (SCE) in mouse chromosomes. The advantages of the DAPI fluorescent technique are also described. Differences in the occurrence of SCE between the centromeric heterochromatin (C-banded) and the chromosomal arm chromatin were studied in mouse cells (RAG) with or without mitomycin C treatment. Single strand exchanges between the DNA double helices in the sister chromatids were not detected. SCE and chromosome breakage appeared to occur more frequently in the centromeric region than in the chromosomal arm. This might play an important role in chromosome evolution in mice. 相似文献
6.
The study of chromosomes in insects is a good tool in mitotic process analysis, zoographic localization and evolution investigation. Among them, the Sciaridae offers a karyotype with a small number of chromosomes, where the heterochromatin and nucleolar organizer region, NOR, are easily analyzed in metaphase chromosomes obtained from cerebral ganglia squashes. In this work, the heterochromatic regions on Bradysia hygida mitotic chromosomes, revealed by C-banding, were identified as centromeric blocks on A and C chromosomes and as dark interstitial region in B and X chromosomes. By Ag-DAPI staining, active nucleolus organizer region, NOR, was revealed associated to the constitutive heterochromatin in the end of the C autosome chromosome. The C-band regions and the unusual ribosomal site localization are discussed. 相似文献
7.
Numerous selective and differential staining techniques have been used to investigate the hierarchical organisation of the human genome. This investigation demonstrates the unique characteristics that are produced on fixed human chromosomes when sequential procedures involving restriction endonuclease TaqI, distamycin A (DA) and 4,6-diamidino-2-phenylindole (DAPI) are employed. TaqI produces extensive gaps in the heterochromatic regions associated with satellite II and III DNAs of human chromosomes 1, 9, 15, 16 and Y. DA/DAPI selectively highlights, as brightly fluorescent C-bands, the heterochromatin associated with the alpha, beta, satellite II and III DNAs of these chromosomes. When DA and DAPI are used on chromosomes before TaqI digestion, and then stained with Giemsa, the centromeric regions appear to be more resistant, producing a distinct C-banding pattern and gaps in the heterochromatin regions. Sequential use of the DA/DAPI technique after TaqI treatment produces a bright fluorescence on the remaining pericentromeric regions of chromosomes 1, 9, 16 and Y, which also displayed a cytochemically unique banding pattern. This approach has produced specific enhanced chromosomal bands, which may serve as tools to characterize genomic heterochromatin at a fundamental level. 相似文献
8.
DNA replication patterns of individual chromosomes and their various euchromatic and heterochromatic regions were analyzed by means of quantitative autoradiography. The cultured cells of the skin fibroblast of a male Indian muntjac were pulse labeled with 3H-thymidine and chromosome samples were prepared for the next 32 h at 1–2 h intervals. A typical late replication pattern widely observed in heterochromatin was not found in the muntjac chromosomes. The following points make the DNA replication of the muntjac chromosomes characteristics: (1) Heterochromatin replicated its DNA in a shorter period with a higher rate than euchromatin. (2) Two small euchromatic regions adjacent to centromeric heterochromatin behaved differently from other portions of euchromatin, possessing shorter Ts, higher DNA synthetic rates and starting much later and ending earlier their DNA replication. (3) Segmental replication patterns were observed in the chromosomes 2 and 3 during the entire S phase. (4) Both homologues of the chromosome 3 showed a synchronous DNA replication pattern throughout the S phase except in the distal portion of the long arms during the mid-S phase. 相似文献
9.
Klaus Hägele 《Chromosoma》1979,70(2):239-250
Mitotic and meiotic chromosomes of Schistocerca gregaria were C-, mild N- and strong N-banded. After C-banding, three out of eleven autosomes show, in addition to the centromeric C-bands, a second C-band. — The mild N-banding method produces a single N-band in each of only four chromosomes. With the exception of one N-band these mild N-bands correspond to the non-centromeric, second C-bands, indicating the heterochromatic character of at least three mild N-band regions. — The strong N-banding technique produces bands both at the C- and mild N-band positions and additionally a third band in one chromosome (M8), not present after C- or mild N-banding. — The N-bands do not correspond to the nucleolus organizer regions. Because of the mechanisms of the N-banding methods, it is concluded that the centromeric heterochromatin, as well as the non-centromeric N-band regions, contain high quantities of non-histone proteins. Presumably a specific difference exists between the non-histone proteins in the centromeric and non-centromeric N-band regions because the centromeres are banded by the strong N-banding technique, but not after mild N-banding. It is concluded that the N-band regions (two exceptions) contain a heterochromatin type which has the following features in common with the -heterochromatin of Drosophila: C- as well as N-banding positive, high nonhistone protein content, repetitive and late replicating DNA. It is discussed whether the N-banded heterochromatin regions of Schistocerca contain that DNA fraction which is, like the Drosophila -heterochromatin, underreplicated in polyploid nuclei. 相似文献
10.
B Mayr D Schweizer M Mendelak J Krutzler W Schleger M Kalat H Auer 《Canadian journal of genetics and cytology》1985,27(6):665-682
Chromomycin A3 banding of the mitotic sets of 10 species of Bovidae (cattle, wisent, yak, banteng, gaur, red buffalo, swamp buffalo, sheep, mufflon, and goat) serves to demarcate both centromeric constitutive heterochromatin and R-banding patterns capable of identifying all the chromosomes within a given complement. In all species significant amounts of chromomycin-bright heterochromatin are present at the centromeres of all autosomes, though there was a high degree of intra- and inter-individual variation in the size of the heterochromatic blocks. Marked interspecies differences in the centromeric patterns were evident. The X chromosomes contained appreciable amounts of centromeric heterochromatin only in the two buffaloes. All the animals studied lacked distamycin A - diamidinophenylindole type heterochromatin. AgNO3 staining was applied sequentially to detect the location of active nucleolus organizer regions (NORs). The distribution of NORs was reasonably conservative in most of the species. An exceptional situation was found in the two buffaloes, where only one NOR pair matched with the standard karyotype of the Bovidae. 相似文献
11.
Loh-Chung Yu Daniel Lowensteiner Elsie F. -K. Wong Ikuhisa Sawada Joe Mazrimas Carl Schmid 《Chromosoma》1986,93(6):521-528
A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs. 相似文献
12.
Actinomycin D effects on mitosis and chromosomes: sticky chromatids and localized lesions 总被引:1,自引:0,他引:1
When Indian muntjac and Chinese hamster cells in culture were treated with Actinomycin D (1 g/ml) for 1–2 hours, the sister chromatids, especially the distal segments, appeared to have difficulty separating in anaphase. The separated proximal segments progressively became stretched. The nucleolus organizer regions seemed to be most susceptible to stretching, and breaks in these regions were frequently observed. Electron microscopic observations showed that the sticky chromatids (and less frequently sticky chromosomes) contain connecting submicroscopic chromosome strands. When the treated cells were allowed to grow in a drug-free medium for several days, a high frequency of endoreduplicated mitotic figures was found. Chromosome and chromatid breaks and other aberrations were common, mainly localized at G band negative areas particularly nucleolus organizer regions. 相似文献
13.
Mitotic chromosomes of the plant pathogenic filamentous fungi Botrytis cinerea and Alternaria alternata were observed. Chromosomes prepared by the germ tube burst method were stained with the fluorescent dye 4,6-diamidino-2-phenylindole (DAPI) to yield figures with good resolution. Using this method, component chromosomes were clearly distinguished and the chromosome number could be determined. Fluorescence in situ hybridization (FISH) was also successfully applied to the specimens, revealing one ribosomal RNA gene cluster, or nucleolus organizer region (NOR) in the genome of each fungus. A long attenuated chromatid thread expanding from a condensed metaphase chromosome, which had been called a thread-like structure in B. cinerea, was proved to be an NOR. This is the first report of the successful application of FISH to the chromosomes of filamentous fungi. 相似文献
14.
The distribution of Z-form DNA along the length of metaphase chromosomes of Indian muntjac was studied by indirect immunofluorescence procedures using an antibody specific to the Z-DNA conformation. Several fixation conditions were compared for reproducible detection of Z-DNA in isolated metaphase chromosomes. Fixation of chromosomes with 45% acetic acid alone gave reproducible reactivity with the antibody. When fixation was done either with Carnoy's solution (3:1 methanol:acetic acid) or with 75% alcohol alone, the antibody binding was at background level. Acetic acid-fixed chromosomes exhibited intense fluorescence both at C-band heterochromatin and at nucleolus organizer regions (NORs). The euchromatic regions had weakly, but clearly, stained bands, which were quite similar to the chromomycin A3 R-bands. After treatment with topoisomerase I, the immunofluorescence at NORs and R-bands disappeared, but only a slight decrease in immunofluorescence intensity was observed at C-band regions. We suggest that this difference in the immunoreactivity of NORs and R-bands from C-bands reflects a difference in gene activity among these regions. Possible molecular mechanisms involved in Z-DNA immunoreactivity are discussed, based on SDS-polyacrylamide gel electrophoretic analysis of chromosomal proteins after extraction of metaphase chromosomes with different fixative solutions.Abbreviations
PI
propidium iodide
-
NOR(s)
nucleolus organizer region(s)
-
SDS-PAGE
sodium dodecyl sulfate polyacrylamide gel electrophoresis
Deceased, April 23, 1988 相似文献
15.
de Oliveira Mendes-Neto E Vicari MR Campaner C Nogaroto V Artoni RF Almeida MC 《Genetics and molecular biology》2010,33(2):237-243
Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA(3) ) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO (3) staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent. 相似文献
16.
Li YC Cheng YM Hsieh LJ Ryder OA Yang F Liao SJ Hsiao KM Tsai FJ Tsai CH Lin CC 《Chromosoma》2005,114(1):28-38
A minilibrary was constructed from DOP-PCR products using microdissected Y-chromosomes of Indian muntjac as DNA templates. Two microclones designated as IM-Y4-52 and IM-Y5-7 were obtained from negative screening of all three cervid satellite DNAs (satellites I, II, and IV). These two microclones were 295 and 382 bp in size, respectively, and shared 70% sequence homology. Southern blot analysis showed that the IM-Y4-52 clone was repetitive in nature with an 0.32-kb register in HaeIII digest. Sequence comparison revealed no similarities to DNA sequences deposited in the GenBank database, suggesting that the microclone sequences were from a novel satellite DNA family designated as cervid satellite V. A subclone of an Indian muntjac BAC clone which screened positive for IM-Y4-52 had a 3,325-bp insert containing six intact monomers, four deleted monomers, and two partial monomers. The consensus sequence of the monomer was 328 bp in length and shared more than 80% sequence homology with every intact monomer. A zoo blot study using IM-Y4-52 as a probe showed that the strong hybridization with EcoRI digested male genomic DNA of Indian muntjac, Formosan muntjac, Chinese muntjac, sambar deer, and Chinese water deer. Female genomic DNA of Indian muntjac, Chinese water deer, and Formosan muntjac also showed positive hybridization patterns. Satellite V was found to specifically localize to the Y heterochromatin region of the muntjacs, sambar deer, and Chinese water deer and to chromosome 3 of Indian muntjac and the X-chromosome of Chinese water deer.Y.-C. Li and Y.-M. Cheng contributed equally to this work. 相似文献
17.
- 1. 1. DNA was extracted from aseptical cultures of protocorms of the orchid Cymbidium and analysed by thermal denaturation. The denaturation profiles revealed an AT-rich fraction of about 18% of total DNA.
- 2. 2. Mitotic chromosomes and diploid and endopolyploid nuclei of in vitro cultured protocorms and root tips were differentially stained with quinacrine (Q), 33258 Hoechst (H) and a novel compound 4′-6-diamidino-2-phenylindole (DAPI) [10], as well as by the Giemsa C-banding technique. The centromeric regions display very bright fluorescence with all three fluorochromes and stain intensely following the Giemsa procedure. It is proposed that the AT-rich fraction of the Cymbidium DNA is located within the centromeric heterochromatin.
- 3. 3. In interphase nuclei differential Q, H, and DAPI fluorescence both within and between the chromocenters occurs. In nuclei with enlarged chromocenters, i.e. with amplified DNA in heterochromatin [2], the increased size of chromocenters is mainly caused by enlargement of the less brightly fluorescing fractions of the heterochromatin. The proportion of the very brightly fluorescing heterochromatin is similar in all nuclei (about 7%).
- 4. 4. A comparison of nucleolar size and differential Giemsa staining of the nucleolus organizers showed that there is no disproportional increase of nucleoli and nucleolus organizing heterochromatin during endopolyploidization. That means, there is no indication for amplification of ribosomal DNA.
- 5. 5. Electron micrographs particularly of heterochromatin-rich nuclei revealed areas of different chromatin density within and between the chromocenters. However, the differences in fiber packaging density are much smaller than the observed differences in fluorescence brightness.
- 6. 6. The data obtained are interpreted as evidence for differential replication of AT-rich and non-AT-rich heterochromatin. It is suggested that DNA amplification [2, 4] is restricted to a non-AT-rich component which apparently is located neither in the brightly fluorescent centromeric nor in the nucleolus-associated heterochromatin.
18.
The Neotropical fish Heptapterus mustelinus, collected in the Pindorama stream of the upper Paraná River basin (Brazil), was studied cytogenetically, verifying 54 chromosomes (26m + 18m + 4st + 6a). This diploid number has not been reported among the Heptapteridae that have been studied to date. Unlike most species of the family, there were multiple Ag-nucleolar organizer regions (NOR) and heterochromatin present in the centromeric region of most of the chromosomes of the complement, being Chromomycin A(3) (CMA(3) (+) )/4',6-diamidino-2-phenylindole (DAPI(-) ) in nine chromosomal pairs, besides the one that coincides with the Ag-NORs. The data presented in this work reveal a different path in the karyotypic evolution of H. mustelinus when compared to the others Heptapteridae genera. 相似文献
19.
Distribution of 18+28S ribosomal genes in mammalian genomes 总被引:3,自引:2,他引:1
In situ hybridization with 3H 18S and 28S ribosomal RNA from Xenopus laevis has been used to study the distribution of DNA sequences coding for these RNAs (the nucleolus organizing regions) in the genomes of six mammals. Several patterns of distribution have been found: 1) A single major site (rat kangaroo, Seba's fruit bat), 2) Two major sites (Indian muntjac), 3) Multiple sites in centromeric heterochromatin (field vole), 4) Multiple sites in heterochromatic short arms (Peromyscus eremicus), 5) Multiple sites in telomeric regions (Chinese hamster). — The chromosomal sites which bind 3H 18S and 28S ribosomal RNA correspond closely to the sites of secondary constrictions where these are known. However, the correlation is not absolute. Some secondary constrictions do not appear to bind 3H ribosomal RNA. Some regions which bind ribosomal RNA do not appear as secondary constrictions in metaphase chromosomes. — Although the nucleolus organizing regions of most mammalian karyotypes are found on the autosomes, the X chromosomes in Carollia perspicillata and C. castanea carry large clusters of sequences complementary to ribosomal RNA. In situ hybridization shows that the Y chromosome in C. castanea also has a large nucleolus organizing region. 相似文献
20.
A clone of highly repetitive DNA, designated C5, was isolated from DNA of female Chinese muntjac cells. The nucleotide sequence of this clone is 80%–85% homologous to that of the satellite IA clone and other highly repetitive DNA clones previously obtained from the Indian muntjac. Using C5 as a probe for in situ hybridizations to chromosome preparations of cells of both the Chinese and Indian muntjacs, we were able to show that these repeated sequences occur in centromeric heterochromatin of the chromosomes of both Chinese and indian muntjac species. More significantly, non-random clusters of hybridization signals were detected on the arms of chromosomes of the Indian muntjac. These latter hybridization sites are postulated to be regions of interstitial heterochromatin and could be the remnants of centromeric heterochromatin from ancestral Chinese muntjac chromosomes. Our observations provide new supportive evidence for the tandem chromosome fusion theory that has been proposed for the evolution of the Indian muntjac karyotype.by P.B. Moens 相似文献