共查询到20条相似文献,搜索用时 15 毫秒
1.
Peter A C 't Hoen Bram-Sieben Rosema Jan N M Commandeur Nico P E Vermeulen Muthiah Manoharan Theo J C van Berkel Eric A L Biessen Martin K Bijsterbosch 《European journal of biochemistry》2002,269(10):2574-2583
Antisense oligodeoxynucleotides (AS-ODNs) are frequently used for the down-regulation of protein expression. Because the majority of potential antisense sequences lacks effectiveness, fast screening methods for the selection of effective AS-ODNs are needed. We describe a new cellular screening assay for the evaluation of the potency and specificity of new antisense sequences. Fusion constructs of the gene of interest and the gene encoding the enhanced green fluorescent protein (EGFP) are cotransfected with AS-ODNs to COS-7 cells. Subsequently, cells are analysed for expression of the EGFP fusion protein by flow cytometry. With the assay, we tested the effectiveness of a set of 15 phosphorothioate ODNs against rat glutathione S-transferase Mu1 (GSTM1) and/or Mu2 (GSTM2). We found several AS-ODNs that demonstrated potent, sequence-specific, and concentration-dependent inhibition of fusion protein expression. At 0.5 microm, AS-6 and AS-8 inhibited EGFP-GSTM1 expression by 95 +/- 4% and 81 +/- 6%, respectively. AS-5 and AS-10 were selective for GSTM2 (82 +/- 4% and 85 +/- 0.4% decrease, respectively). AS-2 and AS-3, targeted at homologous regions in GSTM1 and GSTM2, inhibited both isoforms (77-95% decrease). Other AS-ODNs were not effective or displayed non-target-specific inhibition of protein expression. The observed decrease in EGFP expression was accompanied by a decrease in GSTM enzyme activity. As isoform-selective, chemical inhibitors of GSTM and GSTM knock-out mice are presently unavailable, the selected AS-ODNs constitute important tools for the study of the role of GSTM in detoxification of xenobiotics and protection against chemical-induced carcinogenesis. 相似文献
2.
Ryoo K Huh SH Lee YH Yoon KW Cho SG Choi EJ 《The Journal of biological chemistry》2004,279(42):43589-43594
Mitogen-activated protein kinase/extracellular signal-regulated kinase kinase kinase 1 (MEKK1) is an important component in the stress-activated protein kinase pathway. Glutathione S-transferase Mu 1-1 (GST M1-1) has now been shown to inhibit the stimulation of MEKK1 activity induced by cellular stresses such as UV and hydrogen peroxide. GST M1-1 inhibited MEKK1 activation in a manner independent of its glutathione-conjugating catalytic activity. In vitro binding and kinase assays revealed that GST M1-1 directly bound MEKK1 and inhibited its kinase activity. Co-immunoprecipitation analysis showed a physical association between endogenous GST M1-1 and endogenous MEKK1 in L929 cells. Overexpressed GST M1-1 interfered with the binding of MEKK1 to SEK1 in transfected HEK293 cells. Furthermore, GST M1-1 suppressed MEKK1-mediated apoptosis. Taken together, our results suggest that GST M1-1 functions as a negative regulator of MEKK1. 相似文献
3.
Perbandt M Burmeister C Walter RD Betzel C Liebau E 《The Journal of biological chemistry》2004,279(2):1336-1342
The parasite Plasmodium falciparum causes malaria tropica, the most prevailing parasitic disease worldwide, with 300-500 million infections and 1.5-2.7 million deaths/year. The emergence of strains resistant to drugs used for prophylaxis and treatment and no vaccine available makes the structural analysis of potential drug targets essential. For that reason, we analyzed the three-dimensional structure of the glutathione S-transferase from P. falciparum (Pf-GST1) in the apoform and in complex with its inhibitor S-hexyl-glutathione. The structures have been analyzed to 2.6 and 2.2 A, respectively. Pf-GST1 shares several structural features with the Mu-type GSTs and is therefore closely related to this class, even though alignments with its members display low sequence identities in the range of 20-33%. Upon S-hexyl-glutathione binding, the overall structure and the glutathione-binding site (G-site) remain almost unchanged with the exception of the flexible C terminus. The detailed comparison of the parasitic enzyme with the human host Mu-class enzyme reveals that, although the overall structure is homologue, the shape of the hydrophobic binding pocket (H-site) differs substantially. In the human enzyme, it is shielded from one side by the large Mu-loop, whereas in Pf-GST1 the Mu-loop is truncated and the space to recognize and bind voluminous substrates is extended. This structural feature can be exploited to support the design of specific and parasite-selective inhibitors. 相似文献
4.
A number of plant species are thought to possess a glutathione S-transferase enzyme (GST: EC 2.5.1.18) that will conjugate glutathione (GSH) to trans -cinnamic acid (CA) and para -coumaric acid (4-CA). However, we present evidence that this activity is mediated by peroxidase enzymes and not GSTs. The N-terminal amino acid sequence of the GSH-conjugating enzyme purified from etiolated corn shoots exhibited a strong degree of homology to cytosolic ascorbate peroxidase enzymes (APX: EC 1.11.1.11) from a number of plant species. The GSH-conjugating and APX activities of corn could not be separated during chromatography on hydrophobic-interaction. anion-exchange, and gel filtration columns. Spectral analysis of the enzyme revealed that the protein had a Soret band at 405 nm. When the enzyme was reduced with dithionite, the peak was shifted to 423 nm with an additional peak at 554 nm. The spectrum of the dithionite-reduced enzyme in the presence of 0.1 m M KCN exhibited peaks at 430, 534 and 563 nm. These spectra are consistent with the presence of a heme moiety. The GSH-conjugating and APX activities of the enzyme were both inhibited by KCN. NaN3 , p -chloromercuribenzoate ( p CMB), and iodoacetate. The APX specific activity of the enzyme was 1.5-fold greater than the GSH-conjugating specific activity with 4-CA. In addition to the corn enzyme, a pea recombinant APX (rAPX) and horseradish peroxidase (HRP; EC 1.11.1.7) were also able to conjugate GSH to CA and 4-CA. The peroxidase enzymes may generate thiyl free radicals of GSH that react with the alkyl double bond of CA and 4-CA resulting in the formation of a GSH conjugate. 相似文献
5.
Glutathione transferases are detoxification enzymes that catalyze the addition of glutathione (GSH) to a wide variety of hydrophobic compounds. Although this group of enzymes has been extensively characterized by crystallographic studies, little is known about their dynamic properties. This study investigates the role of protein dynamics in the mechanism of a human class mu enzyme (GSTM2-2) by characterizing the motional properties of the unliganded enzyme, the enzyme-substrate (GSH) complex, an enzyme-product complex [S-(2,4-dinitrobenzyl)glutathione, GSDNB], and an enzyme-inhibitor complex (S-1-hexylglutathione, GSHEX). The kinetic on- and off-rates for these ligands are 10-20-fold lower than the diffusion limit, suggesting dynamic conformational heterogeneity of the active site. The off-rate of GSDNB is similar to the turnover number for its enzymatic formation, suggesting that product release is rate-limiting when 1-chloro-2,4-dinitrobenzene is the substrate. The dynamic properties of GSTM2-2 were investigated over a wide range of time scales using (15)N nuclear spin relaxation, residual dipolar couplings, and amide hydrogen-deuterium exchange rates. These data show that the majority of the protein backbone is rigid on the nanosecond to picosecond time scale for all forms of the enzyme. The presence of motion on the millisecond to microsecond time scale was detected for a small number of residues within the active site. These motions are likely to play a role in facilitating substrate binding and product release. The residual dipolar couplings also show that the conformation of the active site region is more open in solution than in the crystalline environment, further enhancing ligand accessibility to the active site. Amide hydrogen-deuterium exchange rates indicate a reduction in the dynamic properties of several residues near the active site due to the binding of ligand. GSH binding reduces the exchange rate of a number of residues in proximity to its binding site, while GSHEX causes a reduction in amide-exchange rates throughout the entire active site region. The location of the dinitrobenzene (DNB) ring in the GSDNB-GSTM2-2 complex was modeled using chemical shift changes that occur when GSDNB binds to the enzyme. The DNB ring makes a number of contacts with hydrophobic residues in the active site, including Met108. Replacement of Met108 with Ala increases the turnover number of the enzyme by a factor of 1.7. 相似文献
6.
Effects of antisense oligodeoxynucleotides against opioid receptors on the receptor mRNA contents 总被引:4,自引:0,他引:4
It was demonstrated in the previous study that the microinjection of antisense oligodeoxynucleotide (AS ODN) against mu-opioid receptor (MOR) into periaqueductal gray (PAG) of rat brain selectively decreased the MOR mRNA content in PAG, and the decrease in MOR mRNA content was enhanced by pretreatment of the PAG with MOR AS ODN. In the present investigation, effects of the pretreatment of PAG with AS ODN against kappa- or delta-opioid receptor (KOR or DOR) on the decrease in the MOR mRNA content induced by MOR AS ODN were examined. Both KOR and DOR AS ODNs significantly decreased the target mRNA contents, while they did not significantly change MOR mRNA content. The decrease in MOR mRNA content induced by MOR AS ODN, however, was significantly enhanced by the pretreatment of PAG with either KOR or DOR AS ODNs. Results show that the AS ODN has both the specific target mRNA decreasing action and the nonspecific enhancing action on the AS-induced decrease in the mRNA content. 相似文献
7.
Noonpakdee W Pothikasikorn J Nimitsantiwong W Wilairat P 《Biochemical and biophysical research communications》2003,302(4):659-664
The development of new effective antimalarial agents is urgently needed due to the ineffectiveness of current drug regimes on the most virulent human malaria parasite Plasmodium falciparum. Antisense (AS) oligodeoxynucleotides (ODNs) have shown promise as chemotherapeutic agents. Phosphorothioate AS ODNs against different regions of P. falciparum topoisomerase II gene were investigated. Chloroquine- and pyrimethamine-resistant P. falciparum K1 strain was exposed to phosphorothioate AS ODNs for 48 h and growth was determined by flow cytometric assay or by microscopic assay. Exogenous delivery of phosphorothioate AS ODNs between 0.01 and 0.5 microM significantly inhibited parasite growth compared with sense sequence controls suggesting sequence specific inhibition. This inhibition was shown to occur during maturation stages, with optimal inhibition being detected after 36 h. These results should prove useful in future designs of novel antimalarial agents. 相似文献
8.
9.
Cigarette smoking leads to uptake of a multitude of reactive chemicals including many electrophiles and may also give rise to oxidative stress. Human red blood cells are important targets for electrophilic and oxidant foreign compounds. We investigated the oxidative stress in erythrocytes upon cigarette smoking, and the response of antioxidant defense system against it. With this aim, simultaneous determination of erythrocyte superoxide dismutase (SOD), selenium dependent glutathione peroxidase (Se-GPx), catalase (CAT), glutathione S-transferase (GST) activities and plasma levels of thiobarbituric acid reactive substances (TBARS), and the degree of erythrocyte membrane lipid peroxidation (EMLP) were carried out in blood samples of smokers and their controls. Plasma TBARS levels and EMLP in smokers were significantly higher than the control levels (p < 0.01 and p < 0.005, respectively). SOD activity was diminished in smokers compared to nonsmoker controls (p < 0.005). Erythrocyte Se-GPx activity was also found significantly diminished in smokers (p < 0.005), while plasma Se-GPx activity was not changed. We observed that erythrocyte CAT activity was not different in smokers compared to nonsmoker controls. We found that the erythrocyte GST activity is significantly lower in young adult smokers (3.03 +/- 0.18 U/mg protein; mean +/- SEM; n = 46) than in nonsmoking contemporaries (3.98 +/- 0.26 U/mg protein; mean +/- SEM; n = 41). Together with previously reported data, it can be concluded that the decrease in GST activity leads to extra GST synthesis during erythrocyte proliferation. The same data were also analyzed for the sex differences. The statistically significant differences remained the same between nonsmoker and smoker females. Only EMLP degree and SOD activity were significantly different between nonsmoker and smoker males; however, when compared the parameters between male and female nonsmokers, GST activity was found to be significantly higher in females than that of males. 相似文献
10.
Bangtian Xu Tingting Tong Xin Wang Fang Liu Xiang Zhang Xiaolei Hu Xinpeng Li Xiaolan Yang Fei Liao 《Journal of enzyme inhibition and medicinal chemistry》2022,37(1):728
The linking of ethacrynic acid with ethylenediamine and 1,4-butanediamine gave EDEA and BDEA, respectively, as membrane-permeable divalent pro-inhibitors of glutathione S-transferase (GST). Their divalent glutathione conjugates showed subnanomolar inhibition and divalence-binding to GSTmu (GSTM) (PDB: 5HWL) at ∼0.35 min−1. In cisplatin-resistant SK-OV-3, COC1, SGC7901 and A549 cells, GSTM activities probed by 15 nM BDEA or EDEA revealed 5-fold and 1.0-fold increases in cisplatin-resistant SK-OV-3 and COC1 cells, respectively, in comparison with the susceptible parental cells. Being tolerable by HEK293 and LO2 cells, BDEA at 0.2 μM sensitised resistant SK-OV-3 and COC1 cells by ∼3- and ∼5-folds, respectively, released cytochrome c and increased apoptosis; EDEA at 1.0 μM sensitised resistant SK-OV-3 and A549 cells by ∼5- and ∼7-fold, respectively. EDEA at 1.7 μg/g sensitised resistant SK-OV-3 cells to cisplatin at 3.3 μg/g in nude mouse xenograft model. BDEA and EDEA are promising leads for probing cellular GSTM and sensitising cisplatin-resistant ovarian cancers. 相似文献
11.
Synthesis and properties of bile acid phosphoramidites 5'-tethered to antisense oligodeoxynucleotides against HCV. 总被引:1,自引:0,他引:1
Recently, we synthesized antisense oligonucleotides (AS-ODNs) directed against the non-coding-region (NCR) and the adjacent core region of the hepatitis C virus (HCV) RNA. Backbone modifications like phosphorothioates, methyl- and benzylphosphonates were introduced three at each end of the sequence. For improvement of liver specific drug targeting and/or hepatocellular uptake efficient AS-ODNs were covalently conjugated to biomolecules such as cholesterol or bile acids. The use of base-labile alkylphosphonates afforded mild conditions for deprotection of bile acid conjugated AS-ODNs. Here, we describe a convenient synthesis of new cholic acid and taurocholic acid phosphoramidites. Derivatization to taurocholic acid was effected directly before phosphitylation reaction, which is the last step of the phosphoramidite synthesis. These building blocks were coupled to the 5'-position of AS-ODNs in the last step of solid-phase synthesis. After mild deprotection, purification and characterization the properties of these modified AS-ODNs like their lipophilicity or their ability to form stable duplices to DNA and RNA were investigated. Enhanced lipophilicity and formation of stable duplices and heteroduplices makes bile acid conjugated AS-ODNs interesting as antiviral antisense therapeutics against HCV. 相似文献
12.
Scarbrough K 《Methods (San Diego, Calif.)》2000,22(3):255-260
Perturbation analysis has been crucial in the study of biological rhythms. Antisense technology provides investigators with new means to alter the internal milieu of the circadian clock itself. Practical aspects of the method and the theoretical background are presented in sufficient detail to enable others to design appropriate antisense oligodeoxynucleotides and use them for research purposes. This strategy will contribute substantially to the understanding of the influence of individual genes on rhythms in hormone secretion, metabolism, and behavior. 相似文献
13.
Radiation inactivation of microsomal glutathione S-transferase 总被引:1,自引:0,他引:1
Radiation inactivation analysis was used to determine the target size of rat liver microsomal glutathione S-transferase both in situ and following purification. When Tris-HCl-washed microsomes were irradiated, there was a 1.5-2.0-fold increase in enzymatic activity over the first 3-6 megarads followed by a decrease in enzymatic activity. Above 48 megarads the radiation inactivation curve of the Tris-HCl-washed microsomes was described by a monoexponential function which gave a target size of 48 kDa. The enzymatic activity of the microsomal enzyme was selectively increased by treating the Tris-HCl-washed microsomes either with N-ethylmaleimide or washing the microsomes with small unilamellar vesicles made from phosphatidylcholine. The inactivation curves obtained with both types of treated microsomes were simple monoexponential decays in enzymatic activity with target sizes of 46 kDa (N-ethylmaleimide) and 44 kDa (unilamellar vesicles). The microsomal enzyme was detergent solubilized and purified. The Mr value of the purified protein was 15,500 (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). These data suggest that the functional unit of the microsomal form of glutathione S-transferase in situ is a trimer. The target size of the purified enzyme solubilized in Triton X-100 was 85 kDa, and no increase in activity was observed at the lower radiation doses. The increase in the target size of the purified enzyme could not be ascribed solely to the presence of the detergent. This result suggests that the microsomal form of this enzyme can exist as catalytically active oligomers of different sizes depending on its environment. 相似文献
14.
W J Chen P C deSmidt R N Armstrong 《Biochemical and biophysical research communications》1986,141(3):892-897
Isozymes 3-3 and 4-4 of rat liver glutathione S-transferase are stereoselectively inhibited by the diastereomers of 9,10-dihydro-9-glutathionyl-10-hydroxyphenanthrene, 1. The conformation of the biphenyl moiety is the same in the enzyme -1 complex as in aqueous solution with the glutathionyl and hydroxy groups in the axial positions. Isozyme 4-4 is also inhibited by the four diastereomers of 1,2-diphenyl-1-(S-glutathionyl)-2-hydroxyethane. The stereoselectivity of inhibition is modest in all cases and is manifest in both the type of inhibition as well as the magnitude of Ki. 相似文献
15.
Glutathione S-transferases (GSTs) are ubiquitous enzymes and abundant in plants. They are intimately involved in plant metabolism and stress defense related to reactive oxygen species. Our project assigned particular reactions including novel ones to certain GST-isoforms. Transformed E. coli was used to express recombinant GST-isoforms from maize. An N-terminal His tag allowed their purification by affinity chromatography. Three GST-monomers had a molecular weight of 26, 27, 29 kDa, and aggregated to dimers when assayed for their enzymic properties. Four dimeric isoforms were used to study how they interact with tetrapyrroles (of the chlorophyll biosynthesis pathway). It was found that protoporphyrin IX (Proto IX), Mg-protoporphyrin and other tetrapyrroles are bound non-covalently ("liganded") to GSTs but not conjugated with reduced glutathione. This binding is non-covalent, and results in inhibition of conjugation activity, the degree depends on type of the porphyrin and GST-isoform. I50-values between 1-10 microM were measured for Proto IX, the inhibition by mesoporphyrin and Mg-protoporphyrin was 2- to 5-fold less. The ligand binding is noncompetitive for the substrate 1-chloro-2,4-dinitrobenzene and competitive for glutathione. The dimer GST 26/26 prevents the (non-enzymic) autoxidation of protoporphyrinogen to Proto IX, which produces phytotoxic reactive oxygen species in the light. GST 27/27 protects hemin against degradation. Protoporphyrinogen is formed in the plastid and then exported into the cytosol. Apparently binding by a suitable GST-isoform ensures that the highly autoxidizable protoporphyrinogen can safely reach the mitochondrium where it is processed to cytochrome. 相似文献
16.
The initiation of odontogenesis depends on the site-specific proliferation of mandibular epithelium beginning at Day 11 in embryonic mice. We have previously reported that the local expression of epidermal growth factor mRNA in the murine mandible is developmentally regulated, expressed at Days 9 and 10 immediately prior to the initiation of tooth bud formation at Day 11. Exposure of Day 9 mandibular explants to antisense oligomers of epidermal growth factor blocks the initiation of odontogenesis. These results are the first demonstration of the involvement of epidermal growth factor in the inductive specification of a complex epithelial derivative. 相似文献
17.
XinJing Tang Meng Su LiLi Yu Cong Lv Jie Wang ZhongJin Li 《Nucleic acids research》2010,38(11):3848-3855
Caged antisense oligodeoxynucleotides (asODNs) are synthesized by linking two ends of linear oligodeoxynucleotides using a photocleavable linker. Two of them (H30 and H40) have hairpin-like structures which show a large difference in thermal stability (ΔTm = 17.5°C and 11.6°C) comparing to uncaged ones. The other three (C20, C30 and C40) without stable secondary structures have the middle 20 deoxynucleotides complementary to 40-mer RNA. All caged asODNs have restricted opening which provides control over RNA/asODN interaction. RNase H assay results showed that 40-mer RNA digestion could be photo-modulated 2- to 3-fold upon light-activation with H30, H40, C30 and C40, while with C20, RNA digestion was almost not detectable; however, photo-activation triggered >20-fold increase of RNA digestion. And gel shift assays showed that it needed >0.04 μM H40 and 0.5 μM H30 to completely bind 0.02 μM 40-mer RNA, and for C40 and C30, it needed >0.2 μM and 0.5 μM for 0.02 μM 40-mer RNA binding. However, even 4 μM C20 was not able to fully bind the same concentration of 40-mer RNA. By simple adjustment of ring size of caged asODNs, we could successfully photoregulate their hybridization with mRNA and target RNA hydrolysis by RNase H with light activation. 相似文献
18.
Activation of the p38 signaling pathway by heat shock involves the dissociation of glutathione S-transferase Mu from Ask1 总被引:1,自引:0,他引:1
Despite the importance of the stress-activated protein kinase pathways in cell death and survival, it is unclear how stressful stimuli lead to their activation. In the case of heat shock, the existence of a specific mechanism of activation has been evidenced, but the molecular nature of this pathway is undefined. Here, we found that Ask1 (apoptosis signal-regulating kinase 1), an upstream activator of the stress-activated protein kinase p38 during exposure to oxidative stress and other stressful stimuli, was also activated by heat shock. Ask1 activity was required for p38 activation since overexpression of a kinase dead mutant of Ask1, Ask1(K709M), inhibited heat shock-induced p38 activation. The activation of Ask1 by oxidative stress involves the oxidation of thioredoxin, an endogenous inhibitor of Ask1. A different activation mechanism takes place during heat shock. In contrast to p38 induction by H(2)O(2), induction by heat shock was not antagonized by pretreatment with the antioxidant N-acetyl-l-cysteine or by overexpressing thioredoxin and was not accompanied by the dissociation of thioredoxin from Ask1. Instead, heat shock caused the dissociation of glutathione S-transferase Mu1-1 (GSTM1-1) from Ask1 and overexpression of GSTM1-1-inhibited induction of p38 by heat shock. We concluded that because of an alternative regulation by the two distinct repressors thioredoxin and GSTM1-1, Ask1 constitutes the converging point of the heat shock and oxidative stress-sensing pathways that lead to p38 activation. 相似文献
19.
The development of antisense technology as a generally useful tool relies on the use of potent agents and the utilization of many controls in experiments. Here we describe our experience using oligodeoxynucleotides (ODNs) containing C-5 propynyl pyrimidine and phosphorothioate modifications as broadly applicable gene inhibition agents in cell culture. Methods include selection of antisense sequences, synthesis and purification of ODNs, choice of controls, delivery methods (microinjection, cationic lipid transfection, and electroporation), and analysis of gene inhibition. 相似文献
20.
Zhao L Wang HP Zhang HJ Weydert CJ Domann FE Oberley LW Buettner GR 《Archives of biochemistry and biophysics》2003,417(2):212-218
Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques. 相似文献