Assignments of backbone 1H, 13C, and 15N resonances and secondary structure of ribonuclease H from Escherichia coli by heteronuclear three-dimensional NMR spectroscopy.

The assignments of individual magnetic resonances of backbone nuclei of a larger protein, ribonuclease H from Escherichia coli, which consists of 155 amino acid residues and has a molecular mass of 17.6 kDa are presented. To remove the problem of degenerate chemical shifts, which is inevitable in proteins of this size, three-dimensional NMR was applied. The strategy for the sequential assignment was, first, resonance peaks of amides were classified into 15 amino acid types by 1H-15N HMQC experiments with samples in which specific amino acids were labeled with 15N. Second, the amide 1H-15N peaks were connected along the amino acid sequence by tracing intraresidue and sequential NOE cross peaks. In order to obtain unambiguous NOE connectivities, four types of heteronuclear 3D NMR techniques, 1H-15N-1H 3D NOESY-HMQC, 1H-15N-1H 3D TOCSY-HMQC, 13C-1H-1H 3D HMQC-NOESY, and 13C-1H-1H 3D HMQC-TOCSY, were applied to proteins uniformly labeled either with 15N or with 13C. This method gave a systematic way to assign backbone nuclei (N, NH, C alpha H, and C alpha) of larger proteins. Results of the sequential assignments and identification of secondary structure elements that were revealed by NOE cross peaks among backbone protons are reported.     

Preparation of 2'-deoxyribonucleosides with an identically 2H/13C-labeled sugar residue.

Thymidine with the stereoselectively 2H/13C-Labeled sugar moiety, (2'R)(5'S)-[1',2',3',4',5'-(13)C5;2',5'-(2)H2]-thymidine, was synthesized from uniformly 13C-labeled glucose, via the selectively deuterated ribose derivative prepared by the stereo-controlled deuteride transfer reactions. The labeled sugar moiety of the thymidine was then transferred to 2'-deoxyadenosine, 2'-deoxyguanosine, and 2'-deoxyuridine, by the enzymatic transglycosylation reactions by purine and pyrimidine nucleoside phosphorylases, in good yields. Labeled 2'-deoxyuridine was chemically converted to 2'-deoxycytidine. Consequently, all of the 2'-deoxynucleosides prepared by this method has the identically labeled sugar moiety. By using DNA oligomers containing the identically labeled sugar residue for NMR studies, any possible complexity in NMR data analyses expected to be observed for DNA oligomers containing variously labeled nucleosides can be minimized.     

Preparation of partially 2H/13C-labelled RNA for NMR studies. Stereo-specific deuteration of the H5" in nucleotides

An effective in vitro enzymatic synthesis is described for the production of nucleoside triphosphates (NTPs) which are stereo-specifically deuterated on the H5" position with high selectivity (>98%), and which can have a variety of different labels (13C, 15N, 2H) in other positions. The NTPs can subsequently be employed in the enzymatic synthesis of RNAs using T7 polymerase from a DNA template. The stereo-specific deuteration of the H5" immediately provides the stereo-specific assignment of H5' resonances in NMR spectra, giving access to important structural parameters. Stereo-chemical H-exchange was used to convert commercially available 1,2,3,4,5,6,6-2H-1,2,3,4,5,6-13C-D-glucose (d7-13C6-D-glucose) into [1,2,3,4,5,6(R)-2H-1,2,3,4,5,6-13C]-D-glucose (d6-13C6-D-glucose). [1',3',4',5"-2H-1',2',3',4',5'-13C]GTP (d4-13C5-GTP) was then produced from d6-13C6-D-glucose and guanine base via in vitro enzymatic synthesis employing enzymes from the pentose-phosphate, nucleotide biosynthesis and salvage pathways. The overall yield was approximately 60 mg NTP per 1 g glucose, comparable with the yield of NTPs isolated from Escherichia coli grown on enriched media. The d4-13C5-GTP, together with in vitro synthesised d5-UTP, d5-CTP and non-labelled ATP, were used in the synthesis of a 31 nt RNA derived from the primer binding site of hepatitis B virus genomic RNA. (13C,1H) hetero-nuclear multiple-quantum spectra of the specifically deuterated sample and of a non-deuterated uniformly 13C/15N-labelled sample demonstrates the reduced spectral crowding and line width narrowing compared with 13C-labelled non-deuterated RNA.     

MQ-HCN-based pulse sequences for the measurement of 13C1′-1H1′, 13C1′-15N, 1H1′-15N, 13C1′-13C2′, 1H1′-13C2′, 13C6/8-1H6/8, 13C6/8-15N, 1H6/8-15N, 13C6-13C5, 1H6-13C5 dipolar couplings in 13C, 15N-labeled DNA (and RNA)

A suite of multiple quantum (MQ) HCN-based pulse sequences has been developed for the purpose of collecting dipolar coupling data in labeled nucleic acids. All the pulse sequences are based on the robust MQ-HCN experiment which has been utilized for assignment purposes in labeled nucleic acids for a number of years and provides much-needed resolution for the dipolar coupling measurements. We have attempted to collect multiple couplings centered on the 13C1' and 13C6/8 positions. Six pulse sequences are described, one each for measurement of one-bond 13C1'-1H1' and 13C6/8-1H6/8 couplings, one for measurement of one-bond 13C1'-15N and two-bond 1H1'-15N couplings, one for measurement of one-bond 13C6/8-15N and two-bond 1H6/8-15N couplings, one for measurement of one-bond 13C1'- 13C2' and two-bond 1H1'-13C2' couplings, and one for measurement of one-bond 13C6-13C5 and two-bond 1H6-13C5 couplings in the bases of C and T. These sequences are demonstrated for a labeled 18 bp DNA duplex in a 47 kDa ternary complex of DNA, CBFbeta, and the CBFalpha Runt domain, thus clearly demonstrating the robustness of the pulse sequences even for a very large complex.     

The secondary structure of the colicin E3 immunity protein as studied by 1H-1H and 1H-15N two-dimensional NMR spectroscopy.

By performing 1H-1H and 1H-15N two-dimensional (2D) nuclear magnetic resonance (NMR) experiments, the complete sequence-specific resonance assignment was determined for the colicin E3 immunity protein (84 residues; ImmE3), which binds to colicin E3 and inhibits its RNase activity. First, the fingerprint region of the spectrum was analyzed by homonuclear 1H-1H HOHAHA and NOESY methods. For the identification of overlapping resonances, heteronuclear 1H-15N (HMQC-HOHAHA, HMQC-NOESY) experiments were performed, so that the complete 1H and 15N resonance assignments were provided. Then the secondary structure of ImmE3 was determined by examination of characteristic patterns of sequential backbone proton NOEs in combination with measurement of exchange rates of amide protons and 3JHN alpha coupling constants. From these results, it was concluded that ImmE3 contains a four-stranded antiparallel beta-sheet (residues 2-10, 19-22, 47-49, and 71-79) and a short alpha-helix (residues 31-36).     

Combination of heteronuclear 1H-15N and 1H-13C three-dimensional nuclear magnetic resonance experiments for amide-directed sequential assignment in larger proteins

A new strategy for the sequential assignment of backbone proton resonances in larger proteins involving a unique combination of four types of heteronuclear three-dimensional (3D) NMR spectroscopies is reported. This method relies on the uniform labeling of amide nitrogens with 15N and of alpha-carbons with 13C. Heteronuclear 1H-15N TOCSY-HMQC and NOESY-HMQC experiments can reveal connections between cross-peaks arising from the NHi-C alpha Hi-1 and NHi-C alpha Hi connectivities in the finger-print region in in general. They also specifically reveal the sequential amide-amide connectivities among the amide cross-peaks for the alpha-helices. Heteronuclear 1H-13C HMQC-TOCSY and HMQC-NOESY experiments can reveal connections between cross-peaks arising from the NHi-C alpha Hi and NHi+1-C alpha Hi connectivities in the finger-print region in general. The combination of the two sets of results reveals the complete unambiguous sequential connection of cross-peaks for the proton resonances in the peptide backbone. The application of the new strategy is reported for a protein, ribonuclease H, with a molecular weight of 17.6 kDa.     

A comparison of the different DNA binding specificities of the bZip proteins C/EBP and GCN4.

The bZip proteins GCN4 and C/EBP differ in their DNA binding specificities: GCN4 binds well to the pseudopalindromic AP1 site 5'-A4T3G2A1C0T1C2'A3'T4'-3' and to the palindromic ATF/CREB sequence 5'-A4T3G2A1-C0*G0'T1'C2'A3'T4'-3'; C/EBP preferentially recognizes the palindromic sequence 5'-A4T3T2G1C0*G0'C1'A2'-A3'T4'-3'. According to the X-ray structures of GCN4-DNA complexes, five residues of the basic region of GCN4 are involved in specific base contacts: asparagine -18, alanine -15, alanine -14, serine -11 and arginine -10 (numbered relative to the start point of the leucine zipper, which we define as +1). In the basic region of C/EBP position -14 is occupied by valine instead of alanine, the other four residues being identical. Here we analyse the role of valine -14 in C/EBP-DNA complex formation. Starting from a C/EBP-GCN4 chimeric bZip peptide which displays C/EBP specificity, we systematically mutated position -14 of its basic region and characterized the DNA binding specificities of the 20 possible different peptides by gel mobility shift assays with various target sites. We present evidence that valine -14 of C/EBP interacts more strongly with thymine 2 than with cytosine 1' of the C/EBP binding site, unlike the corresponding alanine -14 of GCN4, which exclusively contacts thymine 1' of the GCN4 binding sites.     

Epitopic discrimination by monoclonal antibodies directed against the same alkylated nucleoside

Epitopic specificity of three monoclonal antibodies (mAb's) (coded as ER-6, ER-3, and EM-1) was examined through the utilization of haptenic structural analogs. The binding affinity expressed by the microscopic equilibrium constant (Ki) (Yuhasz, et al., Biochemistry 26, 2334-2342 (1987] of the immunizing hapten, O6-ethyl-2'-deoxy-guanosine (*G) and eight structural analogs, were analyzed by a nitrocellulose affinity filter assay (NAFA) and radioimmunoassay (RIA) for each mAb to determine the protein-hapten interaction between the epitope and the binding cavity. Several components of the *G hapten were determined to be critical for each mAb recognition, while all three mAb's were found to require the O6-ethyl moiety, conjugated guanine base ring, the glycosyl bond and the sugar ring C [1'] and C [2'] position. This investigation further probes and categorizes the binding specificity of the monoclonal antibodies after incorporation of the *G monomer into three short deoxyribooligomeric haptens: O6-ethyl-2'-deoxyguanylyl 3',5' deoxyadenosine (*GA), 2'-deoxyadenylyl 3',5' O6-ethyl-2'-deoxyguanylyl 3',5' 2'-deoxyadenosine (A*GA), and O6-ethyl-2'-deoxyguanylyl 3',5' 2'-deoxyadenylyl 3',5'-2'-deoxyadenylyl 3',5' 2'-deoxycytosine (*GAAC). Unlike the similar binding profiles for the monoclonal antibodies and the haptenic structural analogs, the binding profiles for the deoxyribooligomeric haptens were found to differ in their modes of recognition. These results will be compared to ascertain the key components of monomer and oligomer interaction of the binding cavity. It is important for investigations where monoclonal antibodies derived from small haptens are utilized in recognition of larger antigens containing those haptens.     

Condensation of activated diguanylates on a poly(C) template

We have studied the metal-ion catalysis of a number of reactions of the isomers of ImpGpG on a poly(C) template. In the absence of a catalytic metal ion, oligomers at least up to (pG)20 are obtained from the ImpGpG isomers in a 1-methylimidazole buffer. The Pb2+ ion improves the yield of longer oligomers and changes substantially the distribution of linkage isomers. The Pb2+ ion greatly improves the yield of longer oligomers obtained from G and ImpGpG on a poly(C) template. The self-condensation of ImpGpG in a 2, 6-lutidine buffer is much less efficient than in a 1-methylimidazole buffer. The Zn2+ greatly increases the yield of products from the [3'-5']-linked dimer, but fails to catalyze the formation of long oligomers from the [2'-5']-linked dimer. The bonds formed in the Zn2+-catalyzed self-condensation of ImpG3pG on poly(C) are mainly [3'-5']-linked.     

Deuteriation of sugar protons simplify NMR assignments and structure determination of large oligonucleotide by the 1H-NMR window approach.

The concept of the 1H-NMR window has been developed and examined through a comparative study of NOESY spectra of a self-complementary Dickerson's dodecamer (I) [5'd(5C6G7C8G9A10A11T12T13C-14G15C16G)2(3')], a self-complementary 20-mer (II) [(5'd(1C2G3C4G5C6G7C8G9A10A11T12T13C14G15C16G17C18G19C20G)2(3')] in which the core part consists of the same Dickerson's dodecamer sequence with the flanking CGCG residues at both 3' and 5'-ends, and the partly-deuteriated (shown by underlined CGCG residues at both 3' and 5'-ends) analogous duplex (III) [5'd(1C2G3C4G5C6G7C8G9A10A11T12T13C14G15C16G17C18G19C20G)2(3')] in which the core 5C to 16G part (i.e. 1H-NMR window) consists of the natural Dickerson's dodecamer sequence. A comparison of their NOESY spectra clearly demonstrates that the severe overlap of proton resonances in the larger DNA duplex (II) has been successfully reduced in the partly-deuterated duplex (III) as a result of specific incorporations of the sugar-deuteriated nucleotide residues in the latter [stereospecific > 97 atom % 2H enrichment at H2', H2' and H3' sites, approximately 85 atom % 2H enrichment at H4' and approximately 20 atom % 2H enrichment at H1' (see refs. 10 and 11) in the 20-mer duplex (III)]. These simplifications of the resonance overlap by the deuteriation approach have enabled unequivocal chemical shift assignments and extraction of the quantitative NOE data in the 1H-NMR window part of duplex (III). A comparison of the 12-nucleotide long 1H-NMR window in (III) with that of the 12-mer duplex (I) also shows the scope of studying the changes in conformation and dynamics of the core 12-mer region in (III) which result from the increase of molecular weight due to the DNA chain extension. It is noteworthy that such a study is clearly impossible for the natural 20-mer (II) because of the inherent problem of the overlap of resonances.     

The differences in the T2 relaxation rates of the protons in the partially-deuteriated and fully protonated sugar residues in a large oligo-DNA ('NMR-window') gives complementary structural information.

Selective incorporation of the stereospecifically deuteriated sugar moieties (> 97 atom % 2H enhancements at H2', H2', H3' and H5'/5' sites, approximately 85 atom % 2H enhancement at H4' and approximately 20 atom % 2H enhancement at H1') in DNA and RNA by the 'NMR-window' approach has been shown to solve the problem of the resonance overlap [refs. 1, 2 & 3]. Such specific deuterium labelling gives much improved resolution and sensitivity of the residual sugar proton (i.e. H1' or H4') vicinal to the deuteriated centers (ref. 3). The T2 relaxation time of the residual protons also increases considerably in the partially-deuteriated (shown by underline) sugar residues in dinucleotides [d(CpG), d(GpC), d(ApT), d(TpA)], trinucleotide r(A2'p5'A2'p5'A) and 20-mer DNA duplex 5'd(C1G2C3-G4C5G6C7G8A9A10T11T12C13G14C15G16C17G18C19G20)(2) 3'. The protons with shorter T2 can be filtered away using a number of different NMR experiments such as ROESY, MINSY or HAL. The NOE intensity of the cross-peaks in these experiments includes only straight pathway from H1' to aromatic proton (i-i and i-i + 1) without any spin-diffusion. The volumes of these NOE cross-peaks could be measured with high accuracy as their intensity is 3 to 4 times larger than the corresponding peaks in the fully protonated residues in the normal NOESY spectra. The structural informations thus obtainable from the residual protons in the partially-deuteriated part of the duplex and the fully protonated part in the 'NMR window' can indeed complement each other.     

Study of the structure of phage lambda operator OR1 using two-dimensional 1H-NMR-spectroscopy

NOESY spectroscopy at 500 HMz was employed to assign resonances of nonexchangeable protons in the 1H NMR spectrum of the synthesized 17 base pair duplex of deoxyribonucleotides comprising the OR1 operator, one of the specific binding sites for the bacteriophage lambda cro repressor. A pure absorption spectrum that was obtained by the phase sensitive detection technique allowed to perform a resonance assignment of base and deoxyribose protons, excepting H-5'- and H-5"-protons, on the basis of a single NOESY experiment, mixing time 200 ms. The sequential assignment strategy for 2D NMR spectra of oligonucleotides was used for this purpose. The data obtained and the previous results on OR3 are discussed in the view of the conformation of operators in solution. It is shown that both duplexes exist in the DNA B-form with its intrinsic anti conformation of the nucleotides. Conformation of DNA segments with identical primary structures are similar, and local deviations from the classical B-form are determined by a nucleotide sequence.     

Complete conformational family of 2',3'-didehydro-2',3'-dideoxyguanosine: quantum chemical and electron density topological study

Comprehensive conformational analysis of the biologically active nucleoside 2',3'-didehydro-2',3'-dideoxyaguanosine (d4G) has been performed at the MP2/6-311++G(d,p)//DFT B3LYP/6-31G(d,p) level of theory. The energetic, geometrical and polar characteristics of twenty d4G conformers as well as their conformational equilibrium were investigated. The electron density topological analysis allowed us to establish that the d4G molecule is stabilized by nine types of intramolecular interactions: O5'H...N3, O5'H...C8, C8H...O5', C2'H...N3, C5'H1...N3, C5'H2...N3, C8H...H1C5', C8H...H2'C5' and N2H1...O5'. The obtained results of conformational analysis permit us to think that d4G may be a terminator of the DNA chain synthesis in the 5'-3' direction. Thus it can be inferred that d4G competes with canonical 2'-deoxyaguanosine in binding an active site of the corresponding enzyme.     

Assignment of phosphorus-31 and nonexchangeable proton resonances in a symmetrical 14 base pair lac pseudooperator DNA fragment

The 31P chemical shifts of all 13 phosphates and the chemical shifts of nearly all of the non-exchangeable protons of a symmetrical 14 base pair lac pseudooperator DNA fragment have been assigned by regiospecific labeling with oxygen-17 and two-dimensional NMR techniques. At 22 degrees C, 8 of the 13 phosphorus resonances can distinctly be resolved while the remaining 5 resonances occur in two separate overlapping regions. The 31P chemical shifts of this particular 14 base pair oligonucleotide do not follow the general observation that the more internal the phosphate is located within the oligonucleotide sequence the more upfield the 31P resonance occurs, as shown from other 31P assignment studies. Failure of this general rule is believed to be a result of helical distortions that occur along the oligonucleotide double helix, on the basis of the analysis of Callidine [Callidine, C.R. (1982) J. Mol. Biol. 161, 343-352]. Notable exceptions to the phosphate position relationship are 5'-Py-Pu-3' dinucleotide sequences, which resonate at a lower field strength than expected in agreement with similar results as reported by Ott and Eckstein [Ott, J., & Eckstein, F. (1985) Biochemistry 24, 253]. A reasonable correlation exists between 31P chemical shifts values of the 14-mer and the helical twist sum function of Calladine. The most unusual 31P resonance occurs most upfield in the 31P spectrum, which has been assigned to the second phosphate position (5'-GpT-3') from the 5' end. This unusual chemical shift may be the result of the predicted large helical twist angle that occurs at this position in the 14-mer sequence. Further, it is believed that the large helical twist represents a unique structural feature responsible for optimum binding contact between lac repressor protein and this 14-mer lac pseudooperator segment. Assignments of proton resonances were made from two-dimensional 1H-1H nuclear Overhauser effect (NOESY) connectivities in a sequential manner applicable to right-handed B-DNA, in conjunction with two-dimensional homonuclear and heteronuclear J-correlated spectroscopies (1H-1H COSY and 31P-1H HETCOR). Most nonexchangeable base proton and deoxyribose proton (except for some unresolved H4', H5', and H5" protons) resonances were assigned.     

The DNA structure responds differently to physiological concentrations of K(+) or Na(+)

The influence of monovalent cations on DNA conformation and readout is an open question. This NMR study of DNA with either Na(+) or K(+) at physiological concentrations shows that the nature of the cation affects the (31)P chemical shifts (deltaP) and the sequential distances H2'(i)-H6/8(i+1), H2"(i)-H6/8(i+1), and H6/8(i)-H6/8(i+1). The deltaP and distance variations ascertain that the nature of the cation affects the DNA overall structure, i.e. both the conformational equilibria between the backbone BI (epsilon-zeta <0 degrees ) and BII (epsilon-zeta >0 degrees ) states and the helical parameters, via their strong mechanical coupling. These results reveal that Na(+) and K(+) interactions with DNA are different and sequence-dependent. These ions modulate the overall intrinsic properties of DNA, and possibly its packaging and readout.     

Multinuclear magnetic resonance studies of the 2Fe.2S* ferredoxin from Anabaena species strain PCC 7120. 2. Sequence-specific carbon-13 and nitrogen-15 resonance assignments of the oxidized form

Multinuclear two-dimensional NMR techniques were used to assign nearly all diamagnetic 13C and 15N resonances of the plant-type 2Fe.2S* ferredoxin from Anabaena sp. strain PCC 7120. Since a 13C spin system directed strategy had been used to identify the 1H spin systems [Oh, B.-H., Westler, W. M., & Markley, J. L. (1989) J. Am. Chem. Soc. 111, 3083-3085], the sequence-specific 1H assignments [Oh, B.-H., & Markley, J. L. (1990) Biochemistry (first paper of three in this issue)] also provided sequence-specific 13C assignments. Several resonances from 1H-13C groups were assigned independently of the 1H assignments by considering the distances between these nuclei and the paramagnetic 2Fe.2S* center. A 13C-15N correlation data set was used to assign additional carbonyl carbons and to analyze overlapping regions of the 13C-13C correlation spectrum. Sequence-specific assignments of backbone and side-chain nitrogens were based on 1H-15N and 13C-15N correlations obtained from various two-dimensional NMR experiments.     

Sequential assignment of the 1H and 31P resonances of the double stranded deoxynucleotide d (ATGCAT)2 by 2D-NMR correlation spectroscopy

31p-1H and 1H-1H chemical shift correlation spectroscopy are jointly used for providing a complete assignment of sugar proton (except H5' and H5") and phosphorus resonances in the double stranded oligonucleotide d (ATGCAT)2. In contrast to previous methods the specific assignment of overcrowded H5' H5" proton resonances is not required. Using the H3'-P coupling and also the long range H4'-P coupling, this quite general method can be easily implemented on intermediate field spectrometer. The present results pave the way to the 1H and 31P resonance assignment of longer double-stranded oligonucleotides.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

15N and 13C labeling of Escherichia coli tRNAs toward the NMR analysis.

Escherichia coli tRNAs were labeled with stable isotope 15N in vivo. Three species of tRNA, tRNA(Glu), tRNA(Lys) and tRNA(Ile), were purified by an HPLC system and their NMR spectra were observed. In heteronuclear 1H-15N multiple or single quantum coherence (HMQC or HSQC) spectra, the crosspeaks corresponding to NH3 of U and NH1 of G can be distinguished clearly since their 15N chemical shifts are significantly different from each other. Thus, this combination of 15N-labeling and the proton detected heteronuclear experiments are useful for the signal assignment and the conformational analysis of tRNAs. Furthermore, C1'- selective 13C-labeling of nucleotides was examined in vivo in order to resolve the H1' signals of tRNAs. By using a newly constructed E. coli mutant strain, the isotopic enrichments of more than 90% at C1' and of less than 10% for other ribose carbons were achieved.     

Conformational capacity of 2',3'-didehydro-2',3'-dideoxyadenosine as a key to understanding its biological activity: results of quantum chemical modelling

Comprehensive conformational analysis of the biologically active nucleoside 2',3'-didehydro-2',3'-dideoxyadenosine (d4A) has been performed at the MP2/6-311++G(d,p)//DFT B3LYP/6-31G(d,p) level of theory. The energetic, geometrical and polar characteristics of twenty one d4A conformers as well as their conformational equilibrium were investigated. The electron density topological analysis allowed us to establish that the d4A molecule is stabilized by eight types of intramolecular interactions: O5'H...N3, O5'H...C8, C8H...O5', C2'H...N3, C5'H1...N3, C5'H2...N3 Ta C8H...H1/2C5'. The obtained results of conformational analysis lead us to think that d4A may be a terminator of the DNA chain sythesis in the 5'-3' direction. Thus it can be inferred that d4A competes with canonical 2'-deoxyadenosine in binding an active site of the corresponding enzyme.