Combining Hi-C data with phylogenetic correlation to predict the target genes of distal regulatory elements in human genome

Defining the target genes of distal regulatory elements (DREs), such as enhancer, repressors and insulators, is a challenging task. The recently developed Hi-C technology is designed to capture chromosome conformation structure by high-throughput sequencing, and can be potentially used to determine the target genes of DREs. However, Hi-C data are noisy, making it difficult to directly use Hi-C data to identify DRE–target gene relationships. In this study, we show that DREs–gene pairs that are confirmed by Hi-C data are strongly phylogenetic correlated, and have thus developed a method that combines Hi-C read counts with phylogenetic correlation to predict long-range DRE–target gene relationships. Analysis of predicted DRE–target gene pairs shows that genes regulated by large number of DREs tend to have essential functions, and genes regulated by the same DREs tend to be functionally related and co-expressed. In addition, we show with a couple of examples that the predicted target genes of DREs can help explain the causal roles of disease-associated single-nucleotide polymorphisms located in the DREs. As such, these predictions will be of importance not only for our understanding of the function of DREs but also for elucidating the causal roles of disease-associated noncoding single-nucleotide polymorphisms.     

Modification-dependent restriction endonuclease,MspJI, flips 5-methylcytosine out of the DNA helix

MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNA molecules bound specifically to the tetramer and engaged with the enzyme''s two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act.     

Asymmetric Effect of Mechanical Stress on the Forward and Reverse Reaction Catalyzed by an Enzyme

The concept of modulating enzymatic activity by exerting a mechanical stress on the enzyme has been established in previous work. Mechanical perturbation is also a tool for probing conformational motion accompanying the enzymatic cycle. Here we report measurements of the forward and reverse kinetics of the enzyme Guanylate Kinase from yeast (Saccharomyces cerevisiae). The enzyme is held in a state of stress using the DNA spring method. The observation that mechanical stress has different effects on the forward and reverse reaction kinetics suggests that forward and reverse reactions follow different paths, on average, in the enzyme''s conformational space. Comparing the kinetics of the stressed and unstressed enzyme we also show that the maximum speed of the enzyme is comparable to the predictions of the relaxation model of enzyme action, where we use the independently determined dissipation coefficient for the enzyme''s conformational motion. The present experiments provide a mean to explore enzyme kinetics beyond the static energy landscape picture of transition state theory.     

Reproducibility and Consistency of In Vitro Nucleosome Reconstitutions Demonstrated by Invitrosome Isolation and Sequencing

Nucleosomes and their positions in the eukaryotic genome play an important role in regulating gene expression by influencing accessibility to DNA. Many factors influence a nucleosome''s final position in the chromatin landscape including the underlying genomic sequence. One of the primary reasons for performing in vitro nucleosome reconstitution experiments is to identify how the underlying DNA sequence will influence a nucleosome''s position in the absence of other compounding cellular factors. However, concerns have been raised about the reproducibility of data generated from these kinds of experiments. Here we present data for in vitro nucleosome reconstitution experiments performed on linear plasmid DNA that demonstrate that, when coverage is deep enough, these reconstitution experiments are exquisitely reproducible and highly consistent. Our data also suggests that a coverage depth of 35X be maintained for maximal confidence when assaying nucleosome positions, but lower coverage levels may be generally sufficient. These coverage depth recommendations are sufficient in the experimental system and conditions used in this study, but may vary depending on the exact parameters used in other systems.     

Single-strand DNA cleavages by eukaryotic topoisomerase II

A new purification method for eukaryotic type II DNA topoisomerase (EC 5.99.1.3) is described, and the avian enzyme has been purified and characterized. An analysis of the cleavage reaction has revealed that topoisomerase II can be trapped as a DNA-enzyme covalent complex containing DNA with double-stranded and single-stranded breaks. The data indicate that DNA cleavage by topoisomerase II proceeds by two asymmetric single-stranded cleavage and resealing steps on opposite strands (separated by 4 bp) with independent probabilities of being trapped upon addition of a protein denaturant. Single-strand cleavages were directly demonstrated at both strong and weak topoisomerase II sites. Thus, a match to the vertebrate topoisomerase II consensus sequence (sequence; see text) (N is any base, and cleavage occurs between -1 and +1) [Spitzner, J.R., & Muller, M.T. (1988) Nucleic Acids Res. 16, 5533-5556)] does not predict whether a cleavage site will be single stranded or double stranded; however, sites cleaved by topoisomerase II that contain two conserved consensus bases (G residue at +2 and T at +4) generally yield double-strand cleavage whereas recognition sites lacking these two consensus elements yield single-strand cleavages. Finally, single-strand cleavages with topoisomerase II do not appear to be an artifact caused by damaged enzyme molecules since topoisomerase II in freshly prepared, crude extracts also shows the property of single-strand cleavages.     

Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation,target binding and cleavage

CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9''s ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9''s off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex.     

DNA cleavage by type III restriction-modification enzyme EcoP15I is independent of spacer distance between two head to head oriented recognition sites

The type III restriction-modification enzyme EcoP15I requires the interaction of two unmethylated, inversely oriented recognition sites 5'-CAGCAG in head to head configuration to allow an efficient DNA cleavage. It has been hypothesized that two convergent DNA-translocating enzyme-substrate complexes interact to form the active cleavage complex and that translocation is driven by ATP hydrolysis. Using a half-automated, fluorescence-based detection method, we investigated how the distance between two inversely oriented recognition sites affects DNA cleavage efficiency. We determined that EcoP15I cleaves DNA efficiently even for two adjacent head to head or tail to tail oriented target sites. Hence, DNA translocation appears not to be required for initiating DNA cleavage in these cases. Furthermore, we report here that EcoP15I is able to cleave single-site substrates. When we analyzed the interaction of EcoP15I with DNA substrates containing adjacent target sites in the presence of non-hydrolyzable ATP analogues, we found that cleavage depended on the hydrolysis of ATP. Moreover, we show that cleavage occurs at only one of the two possible cleavage positions of an interacting pair of target sequences. When EcoP15I bound to a DNA substrate containing one recognition site in the absence of ATP, we observed a 36 nucleotide DNaseI-footprint that is asymmetric on both strands. All of our footprinting experiments showed that the enzyme did not cover the region around the cleavage site. Analyzing a DNA fragment with two head to head oriented recognition sites, EcoP15I protected 27-33 nucleotides around the recognition sequence, including an additional region of 26 bp between both cleavage sites. For all DNA substrates examined, the presence of ATP caused altered footprinting patterns. We assume that the altered patterns are most likely due to a conformational change of the enzyme. Overall, our data further refine the tracking-collision model for type III restriction enzymes.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

A 145-base pair DNA sequence that positions itself precisely and asymmetrically on the nucleosome core.

A 145-bp DNA sequence, cloned from Escherichia coli, was reconstituted into nucleosome core particles by a number of methods. The behaviour of the resulting complex upon sucrose gradient sedimentation and nucleoprotein gel electrophoresis closely resembled that of control bulk nucleosome core particles. DNase I digestion of the 32P-end-labelled complex revealed the 10-bp periodicity of cleavages expected for DNA bound on a histone surface. The narrow cleavage sites observed (1 bp wide) imply that the sequence occupies a single preferred position on the nucleosome core, accurate to the level of single base pairs. By relating the digestion pattern observed to the pattern of site protection found for random sequence nucleosomes, the DNA position was found to be offset by 17 bp from that in the normal core particle. A number of experiments argue against the involvement of length or end effects and suggest that it is some feature of the DNA sequence itself that determines this precise positioning of DNA on the nucleosome.     

MaxHiC: A robust background correction model to identify biologically relevant chromatin interactions in Hi-C and capture Hi-C experiments

Hi-C is a genome-wide chromosome conformation capture technology that detects interactions between pairs of genomic regions and exploits higher order chromatin structures. Conceptually Hi-C data counts interaction frequencies between every position in the genome and every other position. Biologically functional interactions are expected to occur more frequently than transient background and artefactual interactions. To identify biologically relevant interactions, several background models that take biases such as distance, GC content and mappability into account have been proposed. Here we introduce MaxHiC, a background correction tool that deals with these complex biases and robustly identifies statistically significant interactions in both Hi-C and capture Hi-C experiments. MaxHiC uses a negative binomial distribution model and a maximum likelihood technique to correct biases in both Hi-C and capture Hi-C libraries. We systematically benchmark MaxHiC against major Hi-C background correction tools including Hi-C significant interaction callers (SIC) and Hi-C loop callers using published Hi-C, capture Hi-C, and Micro-C datasets. Our results demonstrate that 1) Interacting regions identified by MaxHiC have significantly greater levels of overlap with known regulatory features (e.g. active chromatin histone marks, CTCF binding sites, DNase sensitivity) and also disease-associated genome-wide association SNPs than those identified by currently existing models, 2) the pairs of interacting regions are more likely to be linked by eQTL pairs and 3) more likely to link known regulatory features including known functional enhancer-promoter pairs validated by CRISPRi than any of the existing methods. We also demonstrate that interactions between different genomic region types have distinct distance distributions only revealed by MaxHiC. MaxHiC is publicly available as a python package for the analysis of Hi-C, capture Hi-C and Micro-C data.     

Directed protein replacement in recombination full sites reveals trans-horizontal DNA cleavage by Flp recombinase.

One round of site-specific recombination between two DNA partners mediated by the Flp recombinase requires the breakage and reformation of four phosphodiester bonds. The reaction is accomplished by the combined action of four Flp monomers. Within the recombination complex, what is the relative disposition of a Flp monomer with respect to the target diester that it cleaves? To address this question, we have devised a strategy for the targeted orientation of Flp monomers within full-site recombination substrates. Our experimental design is not dependent on ''altered binding specificity'' of the recombinase. Analysis of the pattern of DNA cleavage by this method reveals no evidence for DNA cleavage in cis. A Flp monomer bound to its recognition element within the full site does not cleave the scissile phosphodiester bond adjacent to it. Our results are most consistent with ''trans-horizontal cleavage''. Cleavage by Flp occurs at the scissile phosphodiester distal to it, but within the same full site. The general experimental design employed here will be of widespread utility in mechanistic analyses of nucleic acid transactions involving multimeric DNA-protein assemblies.     

Alteration of apparent restriction endonuclease recognition specificities by DNA methylases.

An in vitro method of altering the apparent cleavage specificities of restriction endonucleases was developed using DNA modification methylases. This method was used to reduce the number of cleavage sites for 34 restriction endonucleases. In particular, single-site cleavages were achieved for Nhe I in Adeno-2 DNA and for Acc I and Hinc II in pBR322 DNA by specifically methylating all but one recognition sequence.