Induction of cleavage in topoisomerase I c-DNA by topoisomerase I enzymes from calf thymus and wheat germ in the presence and absence of camptothecin.

In this study, we further examined the sequence selectivity of camptothecin in mammalian topoisomerase I cDNA from human and Chinese hamster. In the absence of camptothecin, almost all the bases at the 3'-terminus of cleavage sites are T for calf thymus and wheat germ topoisomerase I. In addition, wheat germ topoisomerase I exhibits preference for C (or not T) at -3 and for T at -2 position. As for camptothecin-stimulated cleavage with topoisomerase I, G (or not T) at +1 is an additional strong preference. This sequence selectivity of camptothecin is similar to that previously found in SV40 DNA, suggesting that camptothecin preferentially interacts with topoisomerase I-mediated cleavage sites where G is the base at the 5'-terminus. These results support the stacking model of camptothecin (Jaxel et al. (1991) J. Biol. Chem. 266, 20418-20423). Comparison of calf thymus and wheat germ topoisomerase I-mediated cleavage sites in the presence of camptothecin shows that many major cleavage sites are similar. However, the relative intensities are often different. One of the differences was attributable to a bias at position -3 where calf thymus topoisomerase I prefers G and wheat germ topoisomerase I prefers C. This difference may explain the unique patterns of cleavage sites induced by the two enzymes. Sequencing analysis of camptothecin-stimulated cleavage sites in the surrounding regions of point mutations in topoisomerase I cDNA, which were found in camptothecin-resistant cell lines, reveals no direct relationship between DNA cleavage sites in vitro and mutation sites.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

DNA strand breakage by wheat germ type 1 topoisomerase

Properties of strand breakage in duplex and single-stranded DNA by the wheat germ type 1 DNA topoisomerase were investigated. Strand breakage in duplex DNA is dependent upon the use of denaturing conditions to inactivate the enzyme and terminate the reaction, whereas breakage of single-stranded DNA occurs under the normal reaction conditions and is not dependent upon denaturation. Breakage generates a free 5' hydroxyl group and enzyme bound to the 3' side of the break, presumably via the 3' phosphate group. The location of sites of breakage with both duplex and single-stranded DNA is not random. In all these respects the wheat germ enzyme closely resembles the rat liver type 1 topoisomerase. A comparison of the locations of the sites of breakage in duplex DNA generated by the topoisomerases from wheat germ and rat liver indicates a number of common sites, although the patterns of breakage are not identical.     

The different cleavage DNA sequence specificity explains the camptothecin resistance of the human topoisomerase I Glu418Lys mutant

Yeast cells expressing the Glu418Lys human topoisomerase I mutant display a camptothecin resistance that slowly decreases as a function of time. Molecular characterization of the single steps of the catalytic cycle of the purified mutant indicates that it has a relaxation activity identical to the wild-type protein but a different DNA sequence specificity for the cleavage sites when compared to the wild-type enzyme, as assayed on several substrates. In particular the mutant has a low specificity for CPT sensitive cleavable sites. In fact, the mutant has, at variance of the wild-type enzyme, a reduced preference for cleavage sites having a thymine base in position −1 of the scissile strand. This preference, together with the strict requirement for a thymine base in position −1 for an efficient camptothecin binding, explains the temporary camptothecin resistance of the yeast cell expressing the mutant and points out the importance of the DNA sequence in the binding of the camptothecin drug.     

Purification and characterization of wheat germ DNA topoisomerase I (nicking-closing enzyme)

Wheat germ contains an enzyme capable of removing supercoils from circular DNA. We have purified this enzyme using Polymin P fractionation, ammonium sulfate precipitation, and chromatography on Bio-Rex 70 and phenyl-Sepharose. Renaturation after electrophoresis on sodium dodecyl sulfate-polyacrylamide gels shows that topoisomerase activity is associated with a polypeptide with a Mr = about 111,000. The enzyme is similar to other eukaryotic type I DNA topoisomerases (nicking-closing enzymes) by the following criteria: it is capable of increasing or decreasing the topological linking number of covalently closed DNA substrate; it is capable of restoring an equilibrium distribution of linking numbers to DNA substrate with a single unique linking number; and it does not require magnesium ion or ATP for activity.     

Sequence-dependent effect of camptothecin on human topoisomerase I DNA cleavage

We have studied the effect of the antitumor drug, camptothecin, on the interaction of human topoisomerase I with DNA at the sequence level. At a low molar ratio of enzyme to DNA, cleavage is prominent and unique, located at a previously described hexadecameric recognition sequence, while a number of strong additional cleavage sites appear in the presence of the drug. Camptothecin stimulates cleavage at the recognition sequence less than twofold, whereas cleavage at the additional sites is stimulated up to 200-fold. Camptothecin greatly enhances the stability of the cleavable complexes formed at the additional sites, whereas the complex formed at the hexadecameric sequence is only marginally affected. Cleavage was eliminated at certain sites in the presence of camptothecin. Taken together these observations demonstrate that at least three types of potential eukaryotic topoisomerase I cleavage sites can be distinguished by the use of camptothecin. Comparison of the sequences at the additional cleavage sites in the presence of camptothecin reveals that the most frequently cleaved dinucleotide is TG with no consensus for the flanking nucleotides.     

Sequence dependent modulating effect of camptothecin on the DNA-cleaving activity of the calf thymus type I topoisomerase.

High-resolution mapping of topol cleavages in the regions of human DNA including the oncogene c-Ha-ras and p53, has revealed three kinds of topol cleavage sites: cleavage sites not affected by camptothecin; cleavage sites reinforced only in the presence of camptothecin, and cleavage sites which weaken in the presence of camptothecin. Statistical analysis of sequences revealed certain nucleotide or dinucleotide preferences for three groups studied. The preferences in camptothecin-reduced sites predominate upstream from the cleavage point, whereas in camptothecin-induced sites the situation is reversed. The influence of camptothecin on cleavage sites induced by two molecular forms of topol has been also studied.     

Effect of camptothecin on the DNA-relaxing and DNA-cleavage activity of calf thymus topoisomerase I

Nucleotide sequences that are cleaved by calf thymus type I topoisomerase have been determined using cloned human Ha-ras and p53 genes. Localization and relative frequency of single-strand cleavages within these sequences were observed to change in the presence of the cytotoxic alkaloid camptothecin.     

Precipitation and carbohydrate-binding specificity studies on wheat germ agglutinin.

The ability of wheat germ agglutinin to form precipitates with a series of synthetic carbohydrate-protein conjugates and with carcinoembryonic antigen and its Smith degradation products was investigated. The precipitation reaction between wheat germ agglutinin and p-azophenyl 2-acetamido-2-deoxy-beta-D-glucopyranoside-bovine serum albumin was selected to examine the capacity of a large number of sugar haptens to inhibit this system. Our results indicate that the wheat germ agglutinin binding site is complementary to a sequence of three beta-(1 leads to 4)-linked N-acetyl-D-glucosamine units (N,N'N"-triacetyl chitotriose). The internal carbohydrate portion of carcinoembryonic antigen probably contains two such units and wheat germ agglutinin precipitates with untreated as well as sequentially Smith degraded carcinoembryonic antigen. Compared with other reports certain discrepancies in the relative binding affinities of per N-acetylated chitodextrins and N-acetyl-D-glucosamine were found. These differences are discussed in terms of the methods used and the proposed subsite hypothesis of Allen, A.K., Neuberger, A. and Sharon, N. (1973) Biochem. J. 131, 155-162.     

The basis for camptothecin enhancement of DNA breakage by eukaryotic topoisomerase I.

The eukaryotic topoisomerase I (topo I) is the target of the cytotoxic alkaloid camptothecin (CTT). In vitro, CTT enhances the breakage of DNA by topo I when the reaction is stopped with detergent. Although breakage at some sites is enhanced to a great extent while breakage at others is enhanced only minimally, CTT does not significantly change the breakage specificity of topo I in vitro. It has been suggested that CTT acts by slowing the reclosure step of the nicking-closing reaction. To test this hypothesis, we have measured the rate of reclosure for different break sites in the presence of CTT after adding 0.5 M NaCl to a standard low salt reaction. In support of the hypothesis, we find that topo I-mediated DNA breakage is enhanced the greatest at those sites where closure of the break is the slowest. These results suggest a mechanism for the toxicity of CTT in vivo.     

The role of single-strand breaks in the catenation reaction catalyzed by the rat type I topoisomerase

The type I topoisomerase from rat cells produces true catenanes from circular SV40 DNA in a reaction which is dependent on the presence of a single-strand break in at least one member of a pair of reacting molecules. The role of the single-strand break in the reaction was examined. Molecules containing a nick with a 3'-hydroxyl and 5'-phosphate or a nick with a 3'-phosphate and 5'-hydroxyl and molecules with single-stranded gaps were all found to be equally effective in the catenation reaction. It was found that the enzyme could, at a low frequency, break DNA by acting opposite a pre-existing single-strand break. Thus, incubation of nicked circular DNA in the presence of the topoisomerase, polynucleotide kinase, and [gamma-32P]ATP led to the production of a low level of labeled linear molecules containing covalently attached protein. Nicked linear molecules treated with topoisomerase in the absence of polynucleotide kinase generated fragments of sizes consistent with breakage in the opposite strand near the pre-existing nick. Based on these results, we propose that the catenation reaction may involve the transient production of linear intermediates by the action of the topoisomerase opposite a pre-existing nick in the DNA. Rejoining of the two ends by the enzyme could lead to the interlocking of two or more circular DNAs. In addition, these results suggest a possible role for the type I topoisomerase in illegitimate recombination.     

Platinated DNA adducts enhance poisoning of DNA topoisomerase I by camptothecin

Camptothecins constitute a novel class of chemotherapeutics that selectively target DNA topoisomerase I (Top1) by reversibly stabilizing a covalent enzyme-DNA intermediate. This cytotoxic mechanism contrasts with that of platinum drugs, such as cisplatin, which induce inter- and intrastrand DNA adducts. In vitro combination studies using platinum drugs combined with Top1 poisons, such as topotecan, showed a schedule-dependent synergistic activity, with promising results in the clinic. However, whereas the molecular mechanism of these single agents may be relatively well understood, the mode of action of these chemotherapeutic agents in combination necessitates a more complete understanding. Indeed, we recently reported that a functional homologous recombination pathway is required for cisplatin and topotecan synergy yet represses the synergistic toxicity of 1-beta-D-arabinofuranosyl cytidine in combination with topotecan (van Waardenburg, R. C., de Jong, L. A., van Delft, F., van Eijndhoven, M. A., Bohlander, M., Bjornsti, M. A., Brouwer, J., and Schellens, J. H. (2004) Mol. Cancer Ther. 3, 393-402). Here we provide direct evidence for Pt-1,3-d(GTG) poisoning of Top1 in vitro and demonstrate that persistent Pt-DNA adducts correlate with increased covalent Top1-DNA complexes in vivo. This contrasts with a lack of persistent lesions induced by the alkylating agent bis[chloroethyl]nitrosourea, which exhibits only additive activity with topotecan in a range of cell lines. In human IGROV-1 ovarian cancer cells, the synergistic activity of cisplatin with topotecan requires processive DNA polymerization, whereas overexpression of Top1 enhances yeast cell sensitivity to cisplatin. These results indicate that the cytotoxic activity of cisplatin is due, in part, to poisoning of Top1, which is exacerbated in the presence of topotecan.     

The inhibitory effects of camptothecin, a topoisomerase I inhibitor, on collagen synthesis in fibroblasts from patients with systemic sclerosis

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized by the production of autoantibodies to a wide range of self-antigens. Recent genome screens have implicated numerous chromosomal regions as potential SLE susceptibility loci. Among these, the 1q41 locus is of particular interest, because evidence for linkage has been found in several independent SLE family collections. Additionally, the 1q41 locus appears to be syntenic with a susceptibility interval identified in the NZM2410 mouse model for SLE. Here, we report the results of genotyping of 11 microsatellite markers within the 1q41 region in 210 SLE sibpair and 122 SLE trio families. These data confirm the modest evidence for linkage at 1q41 in our family collection (LOD = 1.21 at marker D1S2616). Evidence for significant linkage disequilibrium in this interval was also found. Multiple markers in the region exhibit transmission disequilibrium, with the peak single marker multiallelic linkage disequilibrium noted at D1S490 (pedigree disequilibrium test [PDT] global P value = 0.0091). Two- and three-marker haplotypes from the 1q41 region similarly showed strong transmission distortion in the collection of 332 SLE families. The finding of linkage together with significant transmission disequilibrium provides strong evidence for a susceptibility locus at 1q41 in human SLE.     

The inhibitory effects of camptothecin, a topoisomerase I inhibitor, on collagen synthesis in fibroblasts from patients with systemic sclerosis

The main manifestation of systemic sclerosis (SSc) is the overproduction of extracellular matrix, predominantly type I collagen. This study was undertaken to evaluate the effects of noncytotoxic doses of the topoisomerase I inhibitor camptothecin (CPT) on collagen production in the activated dermal fibroblasts from patients with SSc and healthy donors. The fibroblasts were cultured in the presence or absence of CPT. Production of collagenous proteins by fibroblasts was determined in cell and matrix layers by ELISA and in conditioned media by [³H]proline incorporation, gel electrophoresis, and autoradiography. Expression of α2(I) collagen (COL1A2) mRNA was measured by northern blot, and the activity of COL1A2 promoter was determined by a chloramphenicol acetyltransferase assay. CPT (10^-7 M) decreased the deposition of type I collagen by 68%, of type III by 38%, and of type VI by 21% in SSc fibroblasts and to a lesser degree in healthy controls. Similarly, CPT (10^-8 M to 10^-6 M) significantly inhibited secretion of newly synthesized collagenous proteins into conditioned media by 50%. CPT (10^-8 M to 10^-6 M) caused a significant dose-dependent inhibition of COL1A2 mRNA levels and COL1A2 promoter activity, both by as much as 60%. The inhibitory effect of CPT on collagen production by fibroblasts from patients with SSc suggests that topoisomerase I inhibitors may be effective in limiting fibrosis in such patients.     

Human DNA topoisomerase I: quantitative analysis of the effects of camptothecin analogs and the benzophenanthridine alkaloids nitidine and 6-ethoxydihydronitidine on DNA topoisomerase I-induced DNA strand breakage.

Human DNA topoisomerase I (topo I) has been purified from normal placenta and from a recombinant baculovirus expression system. A new radiolabeled plasmid DNA assay has been used to quantitate the activity of the purified enzymes and to compare the ability of several types of topo I-targeted drugs to induce topo I-mediated DNA strand breaks. The 100-kDa recombinant enzyme form isolated from the baculovirus expression system is able to relax 2564 ng of supercoiled M-13 mp19 plasmid per minute per nanogram of enzyme. The addition of camptothecin (1 microM) to the reaction lowers the rate to 1282 ng per minute per nanogram of enzyme. The 100-kDa topo I from human placenta is able to relax 1092 ng of supercoiled plasmid per minute per nanogram of enzyme and the 68-kDa topo I form from placenta is able to relax 2069 ng of supercoiled plasmid per minute per nanogram of enzyme. Camptothecin (1 microM) decreases the relaxation rate of the placental enzymes about 50%. In the presence of several different types of topo I-targeted drugs, both the recombinant and placental enzymes are induced to cleave plasmid DNA. Quantitative DNA cleavage assays with radioactive plasmid DNA and 9-aminocamptothecin, topotecan, SN-38, 10, 11-methylenedioxycamptothecin, 7-ethyl-10, 11-methylenedioxycamptothecin, 7-chloromethyl-10, 11-methylenedioxycamptothecin, nitidine, and 6-ethoxy-5, 6-dihydronitidine indicate that the order of potency in inducing topo I-mediated DNA breakage is methylenedioxycamptothecin analogs > SN-38 > 9-aminocamptothecin > topotecan and camptothecin > nitidine compounds. The order of potency correlates with the half-lives of the topo I-DNA drug complex determined with radiolabeled DNA in 0.45 M NaCl at 30 degrees C. The half-life of the complex formed with 7-chloromethyl-10,11-methylenedioxycamptothecin is greater than 90 min whereas the half-life of the topo I-DNA complex with 6-ethoxy-5, 6-dihydronitidine is less than 15 s. The other drugs tested were found to have drug complex half-lives which fall between these two extremes.