共查询到20条相似文献,搜索用时 15 毫秒
1.
Wolbachia surface protein (WSP) is an eight beta-barrel transmembrane structure which participates in host immune response, cell
proliferation, pathogenicity and controlled cell death program. The protein has four extracellular loops containing hyper variable
regions separated by conserved regions. The WSP structure is homologous to Neisseria surface protein (Nsp A) which has about
34% similarity including antigenic variation and hydrophilicity. Recombination has a large impact on diversity of this protein
including positive selection which is major constraint on protein evolution. The molecular mechanism through which Wolbachia
induces various reproductive anomalies is unclear; a key feature observed for such anomalies might be because of Wolbachia
undergoing extensive recombination. In Wolbachia, increased recombination is observed in ankyrin proteins, surface proteins and in
some hypothetical proteins. Genetic divergence is extensive in the WSP gene, WSP is known to be a chimeric protein involved in
host-symbiont interactions. Here we predicted the structural and functional variations in WSP sequences of Wolbachia present in D.
melanogaster, A. tabida and in B. malayi. 相似文献
2.
Adhesion is an important virulence function for Entamoeba histolytica, the causative agent of amoebic dysentery. Lipid rafts, cholesterol-rich domains, function in compartmentalization of cellular processes. In E. histolytica, rafts participate in parasite-host cell interactions; however, their role in parasite-host extracellular matrix (ECM) interactions has not been explored. Disruption of rafts with a cholesterol extracting agent, methyl-β-cyclodextrin (MβCD), resulted in inhibition of adhesion to collagen, and to a lesser extent, to fibronectin. Replenishment of cholesterol in MβCD-treated cells, using a lipoprotein-cholesterol concentrate, restored adhesion to collagen. Confocal microscopy revealed enrichment of rafts at parasite-ECM interfaces. A raft-resident adhesin, the galactose/N-acetylgalactosamine-inhibitable lectin, mediates interaction to host cells by binding to galactose or N-acetylgalactosamine moieties on host glycoproteins. In this study, galactose inhibited adhesion to collagen, but not to fibronectin. Together these data suggest that rafts participate in E. histolytica-ECM interactions and that raft-associated Gal/GalNAc lectin may serve as a collagen receptor. 相似文献
3.
FeoB in bacteria and archaea is involved in the uptake of ferrous iron (Fe2+), an important cofactor in biological electron transfer and catalysis. Unlike any other known prokaryotic membrane protein, FeoB contains a GTP-binding domain at its N-terminus. We determined high-resolution X-ray structures of the FeoB G-domain from Methanococcus jannaschii with and without bound GDP or Mg2+-GppNHp. The G-domain forms the same dimer in all three structures, with the nucleotide-binding pockets at the dimer interface, as in the ATP-binding domain of ABC transporters. The G-domain follows the typical fold of nucleotide-binding proteins, with a β-strand inserted in switch I that becomes partially disordered upon GTP binding. Switch II does not contact the nucleotide directly and does not change its conformation in response to the bound nucleotide. Release of the nucleotide causes a rearrangement of loop L6, which we identified as the G5 region of FeoB. Together with the C-terminal helix, this loop may transmit the information about the nucleotide-bound state from the G-domain to the transmembrane region of FeoB. 相似文献
4.
5.
Junyi Yan Chun-Ling Sun Seokyung Shin Marc Van Gilst C. Michael Crowder 《Cell death & disease》2021,12(7)
Mitochondria are the main oxygen consumers in cells and as such are the primary organelle affected by hypoxia. All hypoxia pathology presumably derives from the initial mitochondrial dysfunction. An early event in hypoxic pathology in C. elegans is disruption of mitochondrial proteostasis with induction of the mitochondrial unfolded protein response (UPRmt) and mitochondrial protein aggregation. Here in C. elegans, we screen through RNAis and mutants that confer either strong resistance to hypoxic cell death or strong induction of the UPRmt to determine the relationship between hypoxic cell death, UPRmt activation, and hypoxia-induced mitochondrial protein aggregation (HIMPA). We find that resistance to hypoxic cell death invariantly mitigated HIMPA. We also find that UPRmt activation invariantly mitigated HIMPA. However, UPRmt activation was neither necessary nor sufficient for resistance to hypoxic death and vice versa. We conclude that UPRmt is not necessarily hypoxia protective against cell death but does protect from mitochondrial protein aggregation, one of the early hypoxic pathologies in C. elegans.Subject terms: Necroptosis, Energy metabolism 相似文献
6.
Belinda J. Morahan Georgina B. Sallmann Valentina Dubljevic 《Experimental parasitology》2009,122(4):280-288
The Apicomplexan parasites Toxoplasma and Plasmodium, respectively, cause toxoplasmosis and malaria in humans and although they invade different host cells they share largely conserved invasion mechanisms. Plasmodium falciparum merozoite invasion of red blood cells results from a series of co-ordinated events that comprise attachment of the merozoite, its re-orientation, release of the contents of the invasion-related apical organelles (the rhoptries and micronemes) followed by active propulsion of the merozoite into the cell via an actin-myosin motor. During this process, a tight junction between the parasite and red blood cell plasma membranes is formed and recent studies have identified rhoptry neck proteins, including PfRON4, that are specifically associated with the tight junction during invasion. Here, we report the structure of the gene that encodes PfRON4 and its apparent limited diversity amongst geographically diverse P. falciparum isolates. We also report that PfRON4 protein sequences elicit immunogenic responses in natural human malaria infections. 相似文献
7.
A Bartoletti-Stella E Mariani I Kurelac A Maresca M F Caratozzolo L Iommarini V Carelli L H Eusebi A Guido G Cenacchi L Fuccio M Rugolo A Tullo A M Porcelli G Gasparre 《Cell death & disease》2013,4(6):e663
Mitochondrial biogenesis is an orchestrated process that presides to the regulation of the organelles homeostasis within a cell. We show that γ-rays, at doses commonly used in the radiation therapy for cancer treatment, induce an increase in mitochondrial mass and function, in response to a genotoxic stress that pushes cells into senescence, in the presence of a functional p53. Although the main effector of the response to γ-rays is the p53-p21 axis, we demonstrated that mitochondrial biogenesis is only indirectly regulated by p53, whose activation triggers a murine double minute 2 (MDM2)-mediated hypoxia-inducible factor 1α (HIF1α) degradation, leading to the release of peroxisome-proliferator activated receptor gamma co-activator 1β inhibition by HIF1α, thus promoting mitochondrial biogenesis. Mimicking hypoxia by HIF1α stabilization, in fact, blunts the mitochondrial response to γ-rays as well as the induction of p21-mediated cell senescence, indicating prevalence of the hypoxic over the genotoxic response. Finally, we also show in vivo that post-radiotherapy mitochondrial DNA copy number increase well correlates with lack of HIF1α increase in the tissue, concluding this may be a useful molecular tool to infer the trigger of a hypoxic response during radiotherapy, which may lead to failure of activation of cell senescence. 相似文献
8.
Satoshi Akanuma 《Journal of molecular biology》2008,382(2):458-466
The (β/α)8-barrel is one of the most common folds functioning as enzymes. The emergence of two (β/α)8-barrel enzymes involved in histidine biosynthesis, each of which has a twofold symmetric structure, has been proposed to be a consequence of tandem duplication and fusion of a (β/α)4-half-barrel. However, little evidence has been found for the existence of an ancestral half-barrel in the evolution of other (β/α)8-barrel proteins. In order to detect remnants of an ancestral half-barrel in the (β/α)8-barrel structure of Escherichia coli N-(5′-phosphoribosyl)anthranilate isomerase, we engineered three potential half-barrel units, (β/α)1-4, (β/α)3-6, and (β/α)5-8. Among these three arrangements, only (β/α)3-6 is stable; it exists in equilibrium between monomeric and dimeric forms. Thus, the central segment of N-(5′-phosphoribosyl)anthranilate isomerase from E. coli can serve as a half-barrel precursor. A tandem duplication of (β/α)3-6 yielded predominantly monomeric structures that were quite stable. This result exemplified that the structural characteristics of noncovalently assembled half-barrels could be improved by duplication and fusion. Moreover, our results may provide information regarding the local structural units that encompass interactions important for the early folding events of this ubiquitous protein conformation. 相似文献
9.
10.
11.
Jay M. Turetzky 《International journal for parasitology》2010,40(9):1037-1044
Like most intracellular pathogens, Toxoplasma synthesizes and secretes an arsenal of proteins to successfully invade its host cell and hijack host functions for intracellular survival. The rhoptries are key secretory organelles that inject proteins into the host cell where they are positioned to co-opt host processes, although little is known regarding how these proteins exert their functions. We show here that the rhoptry protein ROP13 is synthesized as a pre-pro-protein that is processed in the parasite. Processing occurs at a conserved SφXE cleavage site as mutagenesis of glutamic acid to alanine at the P1 position disrupts ROP13 maturation. We also demonstrate that processing of the prodomain is not necessary for rhoptry targeting and secretion. While gene disruption reveals that ROP13 is not essential for growth in fibroblasts in vitro or for virulence in vivo, we find that ROP13 is a soluble effector protein that can access the cytoplasm of host cells. Exogenously expressed ROP13 in human cells remains cytosolic but also appears toxic, suggesting that over-expression of this effector protein is disrupting some function within the host cell. 相似文献
12.
P Peidis A I Papadakis H Muaddi S Richard A E Koromilas 《Cell death and differentiation》2011,18(1):145-154
The eukaryotic cell responds to various forms of environmental stress by adjusting the rates of mRNA translation thus facilitating adaptation to the assaulting stress. One of the major pathways that control protein synthesis involves the phosphorylation of the α-subunit of eukaryotic initiation factor eIF2 at serine 51. Different forms of DNA damage were shown to induce eIF2α phosphorylation by using PERK, GCN2 or PKR. However, the specificity of the eIF2α kinases and the biological role of eIF2α phosphorylation pathway in the DNA damage response (DDR) induced by chemotherapeutics are not known. Herein, we show that PKR is the eIF2α kinase that responds to DDR induced by doxorubicin. We show that activation of PKR integrates two signaling pathways with opposing biological outcomes. More specifically, induction of eIF2α phosphorylation has a cytoprotective role, whereas activation of c-jun N-terminal kinase (JNK) by PKR promotes cell death in response to doxorubicin. We further show that the proapoptotic effects of JNK activation prevail over the cytoprotection mediated by eIF2α phosphorylation. These findings reveal that PKR can be an important inducer of cell death in response to chemotherapies through its ability to act independently of eIF2α phosphorylation. 相似文献
13.
Ching-Yi Lin Chi-Han Li Nu-Man Tsai Wei-Tung Hsu Fang-Hsing Chiang Chia-Ching Chang 《Biochemical and biophysical research communications》2009,388(2):283-289
Helicobacter pylori heat shock protein 60 (HpHsp60) was first identified as an adhesion molecule associated with H. pylori infection. Here we have analyzed the structure of HpHsp60 via amino acid BLAST, circular dichroism, and electrophoresis and the results indicate that most recombinant HpHsp60 molecules exist as dimers or tetramers, which is quite different from Escherichia coli Hsp60. Treatment of human monocytic cells THP-1 with HpHsp60 was found to up-regulate a panel of cytokines including IL-1α, IL-8, IL-10, IFN-γ, TNF-α, TGF-β, GRO, and RANTES. Carboxymethylated HpHsp60 molecules with a switched oligomeric status were able to further enhance NF-κB-mediated IL-8 and TNF-α secretion in THP-1 cells compared to unmodified HpHsp60 molecules. These results indicated that the oligomeric status of HpHsp60s might have an important role in regulating host inflammation and thus help facilitate H. pylori persistent infection. 相似文献
14.
Hua Wang Yan Fang Zhongzan Bao Xing Jin Wenjuan Zhu Lipeng Wang Teng Liu Haipeng Ji Haiying Wang Shiqing Xu Yanghu Sima 《Gene》2014
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress. 相似文献
15.
Hartmann C Chami M Zachariae U de Groot BL Engel A Grütter MG 《Journal of molecular biology》2008,377(2):352-363
The vacuolar protein sorting (Vps) pathway, in which Vps4 class I AAA-ATPases play a central role, regulates growth factor receptors, immune response, and developmental signaling, and participates in tumor suppression, apoptosis, and retrovirus budding. We present the first atomic structure of the nucleotide-free yeast His6ΔNVps4p dimer and its AMPPNP (5′-adenylyl-β,γ-imidodiphosphate)-bound tetradecamer, derived from a cryo electron microscopy map. Vps4p dimers form two distinct heptameric rings and accommodate AAA cassettes in a head-to-head—not in a head-to-tail—fashion as in class II AAA-ATPases. Our model suggests a mechanism for disassembling ESCRT (endosomal sorting complex required for transport) complexes by movements of substrate-binding domains located at the periphery of the tetradecamer during ATP hydrolysis in one ring, followed by translocation through the central pore and ATP hydrolysis in the second ring. 相似文献
16.
We developed a Drosophila model in which the dengue virus NS3 protein is expressed in a tissue specific and inducible manner. Dengue virus NS3 is a multifunctional protein playing a major role during viral replication. Both protease and helicase domains of NS3 are interacting with human and insect host proteins including innate immune components of the host machinery. We characterized the NS3 transgenic flies showing that NS3 expression did not affect fly development. To further study the links between NS3 and the innate immune response, we challenge the flies with gram-positive and gram-negative bacteria. Interestingly, the Drosophila transgenic flies expressing NS3 were more susceptible to bacterial infections than control flies. However ubiquitous or immune-specific NS3 expression affected neither the life span nor the response to a non-infectious stress of the flies. In conclusion, we generated a new in vivo system to study the functional impact of DENV NS3 protein on the innate immune response. 相似文献
17.
18.
Due to its ability to emit light, the luciferase from Renilla reniformis (RLuc) is widely employed in molecular biology as a reporter gene in cell culture experiments and small animal imaging. To accomplish this bioluminescence, the 37-kDa enzyme catalyzes the degradation of its substrate coelenterazine in the presence of molecular oxygen, resulting in the product coelenteramide, carbon dioxide, and the desired photon of light. We successfully crystallized a stabilized variant of this important protein (RLuc8) and herein present the first structures for any coelenterazine-using luciferase. These structures are based on high-resolution data measured to 1.4 Å and demonstrate a classic α/β-hydrolase fold. We also present data of a coelenteramide-bound luciferase and reason that this structure represents a secondary conformational form following shift of the product out of the primary active site. During the course of this work, the structure of the luciferase's accessory green fluorescent protein (RrGFP) was also determined and shown to be highly similar to that of Aequorea victoria GFP. 相似文献
19.
20.
Michail Iakovidis Paulo J. P. L. Teixeira Moises Exposito-Alonso Matthew G. Cowper Theresa F. Law Qingli Liu Minh Chau Vu Troy Minh Dang Jason A. Corwin Detlef Weigel Jeffery L. Dangl Sarah R. Grant 《Genetics》2016,204(1):337-353
We identified loci responsible for natural variation in Arabidopsis thaliana (Arabidopsis) responses to a bacterial pathogen virulence factor, HopAM1. HopAM1 is a type III effector protein secreted by the virulent Pseudomonas syringae strain Pto DC3000. Delivery of HopAM1 from disarmed Pseudomonas strains leads to local cell death, meristem chlorosis, or both, with varying intensities in different Arabidopsis accessions. These phenotypes are not associated with differences in bacterial growth restriction. We treated the two phenotypes as quantitative traits to identify host loci controlling responses to HopAM1. Genome-wide association (GWA) of 64 Arabidopsis accessions identified independent variants highly correlated with response to each phenotype. Quantitative trait locus (QTL) mapping in a recombinant inbred population between Bur-0 and Col-0 accessions revealed genetic linkage to regions distinct from the top GWA hits. Two major QTL associated with HopAM1-induced cell death were also associated with HopAM1-induced chlorosis. HopAM1-induced changes in Arabidopsis gene expression showed that rapid HopAM1-dependent cell death in Bur-0 is correlated with effector-triggered immune responses. Studies of the effect of mutations in known plant immune system genes showed, surprisingly, that both cell death and chlorosis phenotypes are enhanced by loss of EDS1, a regulatory hub in the plant immune-signaling network. Our results reveal complex genetic architecture for response to this particular type III virulence effector, in contrast to the typical monogenic control of cell death and disease resistance triggered by most type III effectors. 相似文献