Isolation of deoxyribonucleic acid from mammalian tissues

1. DNA has been isolated from different mammalian tissues. The DNA preparations were free from RNA, protein and polysaccharides and have a similar range of sedimentation coefficients (approx. 24s). 2. Protein was removed by a two-stage extraction with a phenol-cresol mixture by using a detergent with 4-aminosalicylate in the first stage and sodium chloride in the second. 3. Polysaccharides remained in solution when DNA was precipitated with 2-butoxyethanol in the presence of 0.5m-sodium chloride and 1.5m-sodium benzoate. 4. Ribosomal RNA was removed by precipitation in the presence of 3m-sodium chloride at 0 degrees , when DNA remained soluble.     

Isolation of nucleic acids from plants by differential solvent precipitation.

The purification of nucleic acids from plant tissue is often made difficult by the presence of contaminating carbohydrate polymers and polyphenols. A procedure for the simultaneous isolation of DNA and translatable RNA from plants is described. The method removes most of the polysaccharides and polyphenols extracted with nucleic acids in a single step by taking advantage of differences in solubility of these compounds in the solvent 2-butoxyethanol. Stepwise addition of 2-butoxyethanol to phenol extracts of specific ionic strength precipitates nucleic acids largely free of contaminants. Subsequent separation of RNA from DNA by precipitation with LiCl was optimised to give a high recovery of translationally active RNA. Successful isolation of nucleic acids from strawberry (Fragaria X ananassa) receptacle, a particularly recalcitrant tissue, and from a range of tissues of other plant species demonstrates the general applicability of the method.     

Simultaneous Extraction of RNA and DNA from Rat Liver with Cupric Sulfate

Homogenization of fresh rat livers in 0.5mM cupric sulfate and 0.5% sodium dodecyl sulfate yielded both RNA and DNA in the aqueous phase after treatment vith phenol at 0–4°C. Effective deproteinization was achieved by three additional phenol treatments. Nucleic acids vere freed from Cu²⁺by repeated precipitation with ethanol in the presence of EDTA. The final yield was 6–7 mg/g of liver, of which about 20% was DNA and 11% tRNA. Physicochenical studies showed that pure tRNA, undegraded rRKA (30S, 18S) and native DNA (s°_{20, w} = 24.4S) were isolated by this procedure.     

Ribonucleic acid synthesis by Escherichia coli C3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of the coliphage-induced double-stranded ribonucleic acid

1. The efficiency of extracting nucleic acids from Escherichia coli after five methods of obtaining cell lysis was determined. 2. The recovery of various nucleic acid species isolated after chromatography on methylated albumin-coated kieselguhr was also examined. 3. Double-stranded coliphage-induced RNA was isolated from infected bacteria and its resistance to ribonuclease digestion under various conditions determined. 4. The involvement of double-stranded RNA during the infection process was demonstrated. 5. The time-course of the syntheses in infected cells of double-stranded RNA, DNA, single-stranded coliphage and 16s ribosomal RNA, transfer RNA and ribosomal 23s RNA was examined. 6. It was demonstrated that the syntheses of DNA, transfer RNA and ribosomal RNA decreased 10-15min. after infection. 7. Synthesis of coliphage RNA commenced 10-15min. after infection and double-stranded RNA was also synthesized from about 10min. after coliphage adsorption.     

Isolation and characterization of ribosomal ribonucleic acid

1. Ribosomal RNA has been prepared by extracting tissues with a phenol–cresol mixture, and ribosomal RNA can be selectively precipitated with m-cresol. No rapidly labelled RNA was associated with this material. 2. However, if RNA and DNA are extracted with 4-aminosalicylate and phenol–cresol mixture and the nucleic acids precipitated, DNA, glycogen and s-RNA (transfer RNA) can be extracted with 3m-sodium acetate and in this case rapidly labelled RNA remains associated with the ribosomal RNA. 3. The ribosomal RNA is stable in the presence of concentrated salt solution and, although the secondary structure is lost by heating at 70° in 10mm-sodium acetate, it can be re-formed in the presence of 200mm-sodium acetate. 4. The 28s and 18s components have been separated and their base compositions determined.     

Purification of 5S RNA from Plant Leaves

A simple and rapid method for large scale preparation of 5S RNA from plant leaves is described. To begin, all nucleic acids were extracted from the leaves with a mixture of phenol-chloroform-n-butyl alcohol and extracting buffer. After precipitation of the high-molecular-weight nucleic acids from the crude extract with 2 M LiCl, the low, molecular-weight RNA in the supernatant (containing about 6% 5S RNA) could be separated by eleetrophoresis on denatured polyaerylamide gels. The band of 5S RNA was excised from the preparatory slab gel under UV light and then purified by eleetrophoretie elution. In our experiments, several mg pure 5S RNA was obtained from 100 g leaves in a single run which takes about 4 days. The purified final produet was pure as showing a single hand on denatured polyaerylamide gel and a typical UV absorption peak of nucleic acid. The sedimentation coefficient (S20w) of the product was 4.6 as determined by ultracentrifugation.     

Carrier RNA enhancement of recovery of DNA from dilute solutions

A study of the use of carrier RNA to improve precipitation of DNA from dilute solutions was conducted to define the conditions which optimize DNA recovery. Replicate samples containing labeled pBR322 and increasing concentrations of commercially-available Torula yeast RNA were ethanol precipitated at -20 degrees C for 1 h in microfuge tubes obtained from various manufacturers. Nucleic acids were pelleted by centrifugation for either 5 or 30 min, dried and resuspended. Although recovery was not identical in each type of microfuge tube, in all cases the percent recovery increased when carrier was added. In most cases, extending centrifugation to 30 min did not significantly increase recovery. Recovery of unlabeled DNA's of heterogeneous molecular weight and conformation was also enhanced by the addition of carrier RNA. DNA's recovered by this method can be successfully digested with BamHI and ligated with T4 DNA ligase.     

Extraction of nucleic acids from lyophilized plant material

Four methods for extracting nucleic acids from lyophilized cotton (Gossypium hirsutum L. cv. Stoneville 62) leaves and roots were compared. They were based on the use of: (I) HC10₄; (II) KOH; (III) a mixture of 90% phenol, Tris (hydroxymethyl) aminomethane buffer, and sodium lauryl sulfate; and (IV) NaCl. (I) extracted large amounts of RNA but little DNA and extracted much carbohydrate and protein contaminants. (II) gave a good yield of both RNA and DNA but extracted such large amounts of contaminating material that purification of RNA on an anion exchange column was necessary. (III) extracted only part of the RNA and practically no DNA, but extracted contaminating materials. (IV) resulted in high yields of both RNA and DNA when modified to omit preliminary acid extraction of impurities. The use of cold trichloroacetic acid instead of ethanol, to precipitate NaCl-extracted nucleic acids, separated the nucleic acids from most of the carbohydrate and acid-soluble phosphate contaminants and resulted in good agreement among results by ultraviolet absorbance, pentose tests, and phosphate analysis. This method also resulted in lower protein contents and better ultraviolet absorption spectra than the other methods tested. Nucleic acids were extracted from leaves of 14 other species of plants, in addition to cotton, by this modified NaCl procedure.     

The messenger ribonucleic acid content of Bacillus subtilis 168

Bacillus subtilis 168 messenger RNA was determined by DNA-RNA hybridization techniques, with denatured DNA immobilized upon cellulose nitrate membrane filters. The following results were obtained. (1) Cultures of B. subtilis, growing exponentially in enriched glucose-salts medium at 37 degrees , incorporated [5-(3)H]uracil into both ribosomal and messenger RNA fractions without the kinetic delay expected from the presence of the intracellular nucleotide pools. (2) However short the time of labelling with exogenous labelled uracil (down to 7sec.), 32-36% of the rapidly labelled RNA was messenger RNA and 68-64% was an RNA with the hybridization characteristics of ribosomal RNA. Analysis of the apparent nucleotide base composition of total (32)P-labelled rapidly labelled RNA and the two RNA fractions separated by hybridization at a DNA/RNA ratio 5:1 confirmed this finding. Of the rapidly labelled RNA, 31% readily hybridized with DNA at low DNA/RNA ratios and had an apparent base composition like that of the DNA, whereas 69% was hybridized only at low efficiency at low DNA/RNA ratios and had a composition identical with that of ribosomal RNA. (3) In cultures dividing every 48min. at 37 degrees , kinetic analysis of RNA labelled over a 20min. period showed that the average life-time of messenger RNA was 2.7-3.0min. and that its amount was 3.0% of the total RNA. (4) The hybridization of (3)H-labelled randomly labelled RNA with DNA at a DNA/RNA ratio 5:1 showed that 2.9% of the randomly labelled RNA had the characteristics of messenger RNA. (5) Experiments carried out as described by Pigott & Midgley (1968) indicated that hybridization at low DNA/RNA ratios (5:1) effectively accounted for all the messenger RNA in a given specimen. The efficiency coefficient of RNA hybridization lay within the range of 90-95% input, if an excess of DNA sites was offered for RNA binding. (6) These measurements are compared with other results obtained by different methods, and reasons for any major disagreement are suggested.     

Analysis of the 5'-termini of nascent DNA chains synthesized in permeable cells of Bacillus subtilis

The nascent DNA synthesized by permeable cells of Bacillus subtilis in the presence of 5'-mercurideoxycytidine triphosphate and 2',3'-dideoxyATP has been isolated and characterized. The newly synthesized DNA was isolated free from other cellular nucleic acids by affinity chromatography on thiol-substituted agarose. The number average chain length of the nascent DNA synthesized in one minute at 25 degrees C was 33 nucleotide residues, due to the chain-terminating action of 2',3'-dideoxyATP. Several lines of evidence indicated that at least 90% of the DNA thus isolated carried a terminally phosphorylated RNA moiety at its 5'-end: (1) the nascent DNA was resistant to exonucleolytic degradation by spleen phosphodiesterase unless first hydrolyzed by strong alkali or ribonuclease; (2) the 5'-termini of nascent DNA could not be phosphorylated by polynucleotide kinase unless first treated with alkaline phosphatase or subjected to hydrolysis by strong alkali or ribonuclease; (3) alkaline hydrolysis of nascent DNA labeled with 32P at the 5'-end released unlabeled DNA with a free 5'-terminus and 32P-labeled ribonucleoside 3',5'-bisphosphates; (4) ribonuclease degradation of similarly labeled material produced an unlabeled DNA-containing polynucleotide fraction and 32P-labeled ribo-oligonucleotides; (5) chromatography on dihydroxyboryl cellulose showed that the RNA moiety lacked a 3'-terminal cis-diol grouping (even after treatment with alkaline phosphatase) unless first subjected to the 3'-exonucleolytic action of bacteriophage T4 DNA polymerase. The sequence of the ribonucleotide chains was elucidated by end-group labeling with polynucleotide kinase and digestion with various ribonucleases. The ribonucleotide moiety was primarily three and four residues in length with the predominant sequence (pp)pApG(pC)1-2pDNA. The possibility that it represents a primer for discontinuous DNA synthesis is discussed.     

Rapidly labelled ribonucleic acid from rat liver. Studies in the attachment to ribosomes and stimulation of the incorporation of amino acids into polypeptides in cell-free systems

1. Rapidly labelled RNA from rat liver, either as a complex with DNA (m-RNA-DNA) or with ribosomal RNA (m-RNA-RNA) binds to ribosomes in the polysome region. No binding could be demonstrated with ribosomal RNA or native DNA from Bacillus subtilis. 2. With ribosomes from rat liver, Escherichia coli or hepatoma the m-RNA-DNA stimulated incorporation of amino acids with rat-liver ribosomes only, whereas the m-RNA-RNA complex was effective with ribosomes from E. coli or the hepatoma. 3. Polyuridylic acid was effective as messenger RNA with all three ribosomes but much greater stimulation was obtained with ribosomes from E. coli and the hepatoma. 4. The degree of incorporation of phenylalanine with polyuridylic acid and ribosomes from a hepatoma was decreased by about 50% when ribosomal RNA was present.     

Pelagic-benthic coupling of nucleic acids in an abyssal location of the northeastern Atlantic Ocean.

Spatial and temporal changes in sedimentary nucleic acid concentrations in an abyssal locality of the northeastern Atlantic Ocean were investigated in relation to fluxes of nucleic acids produced in the photic layer. Sediment trap material, collected between 1996 and 1998 at depths of 1,000, 3,000, and 4,700 m, and sediment samples were analyzed for DNA and RNA content. Nucleic acid concentrations in the sediments were very high and displayed significant temporal changes, whereas mesoscale variability was low. DNA and RNA concentrations generally displayed opposite temporal patterns, which are likely to be dependent on the nature and characteristics of DNA and RNA molecules. Nucleic acid fluxes were high and displayed clear seasonal changes apparently coupled with seasonal pulses of primary production. However, while median values of DNA fluxes were relatively similar in all sediment traps, median values of RNA fluxes almost doubled from the 1,000- to the 4,700-m depth, suggesting differences in the metabolic activity of microbes associated with sinking particles. Significant relationships between DNA concentrations in the sediments and DNA fluxes and between RNA concentrations and RNA fluxes, indicating the presence of a clear pelagic-benthic coupling of particulate nucleic acids, were observed. The benthic system investigated was not steady state since we estimated that, from September 1996 to October 1998, nucleic acid concentration in the sediments decreased by about 165 mg of DNA m(-2). Vertical profiles revealed a significant decrease in DNA concentration with depth in the sediments, reaching an asymptotic value of about 5 microg g(-1). This DNA fraction constitutes a pool of potentially refractory DNA (accounting for 16 to 40% of the total DNA pool) that might be buried in the sediments.     

Nucleic acid synthesis and ribonucleic acid polymerase specificity in germinating and outgrowing spores of Bacillus subtilis.

Nucleic acid synthesis was studied during germination and outgrowth of normal spores of Bacillus subtilis, as well as of spores carrying the genome of phage phie. In a system in which development was restricted to the spore-darkening phase, synthesis of ribonucleic acid (RNA), but not deoxyribonucleic acid (DNA), was detected. The extent of RNA synthesis and turnover, during this phase was similar for the two types of spores. In a partially darkened population of spores of either type, there was little RNA degradation, whereas there was considerable turnover in a fully darkened population. The DNA-dependent RNA polymerase of dormant or dark spores was not active in vitro with phi DNA as template, although a sigma-like factor could be separated from the polymerizing activity by zone centrifugation. Within 40 min after resuspension of dark spores in a medium that allows outgrowth, the enzyme acquired the ability to transcribe the phage DNA efficiently. During outgrowth, both normal and carrier spores synthesized DNA, but in carrier spores this DNA was almost entirely phage specific. The pattern of RNA accumulation in normal spores was in two distinct phase (0 to 60 min and 90 to 180 min). The second phase was absent in outgrowing carrier spores. The burst of phage in carrier spores occurred at 160 to 180 min.     

Covalent cross-linking of transfer ribonucleic acid to the ribosomal P site. Mechanism and site of reaction in transfer ribonucleic acid.

The covalent cross-linking of unmodified Escherichia coli N-acetylvalyl-tRNA to the 16S RNA of Escherichia coli ribosomes upon near-UV irradiation previously reported by us [Schwartz, I., & Ofengand, J. (1978) Biochemistry 17, 2524--2530] has been studied further. Up to 70% of the unmodified tRNA, nonenzymatically bound to tight-couple ribosomes at 7 mM Mg2+, could be cross-linked by 310--335-nm light. Covalent attachment was solely to the 16S RNA. It was dependent upon both irradiation and the presence of mRNA but was unaffected by the presence or absence of 4-thiouridine in the tRNA. The kinetics of cross-linking showed single-hit behavior. Twofold more cross-linking was obtained w-th tight-couple ribosomes than with salt-washed particles. Puromycin treatment after irradiation released the bound N-acetyl[3H]valine, demonstrating that the tRNA was covalently bound at the P site and that irradiation and covalent linking did not affect the peptidyl transferase reaction. Cross-linking was unaffected by the presence of O2, argon, ascorbate (1 mM), or mercaptoethanol (10 mM). Prephotolysis of a mixture of tRNA and ribosomes in the absence of puly(U2,G) did not block subsequent cross-linking in its presence nor did it generate any long-lived chemically reactive species. There was a strong tRNA specificity. E. coli tRNA1Val and tRNA1Ser and Bacillus subtilis tRNAVal and tRNAThr could be cross-linked, but E. coli tRNA2Val, 5-fluorouracil-substituted tRNA1Val, tRNAPhe, or tRNAFMet could not. By sequence comparison of the reactive and nonreactive tRNAs, the site of attachment in the tRNA was deduced to be the 5'-anticodon base, cmo5U, or ,o5U in all of the reactive tRNAs. The attachment site in 16S RNA is described in the accompanying paper [Zimmerman, R. A., Gates, S. M., Schwartz, I., & Ofengand, J. (1979) Biochemistry (following paper in this issue)]. The link between tRNA and 16S RNA is either direct or involves mRNA bases at most two nucleotides apart since use of the trinucleotide GpUpU in place of poly(U2,G) to direct the binding and cross-linking of N-acetylvalyl-tRNA to the P site did not affect either the rate or yield of cross-linking. Both B. subtilis tRNAVal (mo5U) and E. coli tRNA1Val (cmo5U) gave the same rate and yield of cross-linking when directed by the trinucleotide GpUpU. Therefore, the presence of the charged carboxyl group in the cmo5U-containing tRNA apparently does not markedly perturb the orientation of this base with respect to its reaction partner in the 16S RNA. The cross-linking of AcVal-tRNA only takes place from the P site. At 75 mM KCl and 75 mM NH4Cl, less than 0.4% cross-linking was found at the A site, while 55.5% was obtained at the P site. However, when the salt concentration was lowered to 50 mM NH4Cl, 5% cross-linking to the A site was detected, compared to 49% at the P site. Thus, a simple change in the ionic strength of the incubation mixture was able to alter the affinity labeling pattern of the ribosome.     

High salt- and SDS-stable DNA binding protein complexes with ATPase and protein kinase activity retained in chromatin-depleted nuclei.

Cell lysis in presence of SDS and proteinase K followed by salting-out of residual polypeptides by dehydration and precipitation with saturated sodium chloride solution [Miller, S.A., Dykes, D.D. and Polesky, H.F., Nucleic Acids Res., 16, 1215, 1988] efficiently resolves deproteinized DNA. However, this DNA is still associated with prominent polypeptides which remain stably attached to DNA during further treatments, e.g. during repeated salting-out steps, prolonged incubation of DNA in 1% SDS or 4 M urea at 56 degrees C and ethanol precipitation. The persistent polypeptides (62, 52 and 40 kDa) released from Ehrlich ascites cell DNA were further characterized. Microsequencing indicates that the DNA binding polypeptides are not yet characterized at the sequence level. Nuclease digestion of the DNA releases stable DNA-protein complexes with the shape of globular particles (12.8 +/- 0.8 nm) and their larger aggregates in which DNA remains protected from nuclease digestion. The isolated DNA-polypeptide complexes show ATPase (Km = 7.4 x 10(-4) M) and protein kinase activity. Antibodies reveal a parallel distribution of the complexes with chromatin, however, the complexes are retained in chromatin-depleted nuclei.     

Influence of growth condition on the concentration of potassium in Bacillus subtilis var. niger and its possible relationship to cellular ribonucleic acid, teichoic acid and teichuronic acid

1. Mg(2+)-limited Bacillus subtilis var. niger, growing in a chemostat in a simple salts medium, contained considerably more potassium and phosphorus than Mg(2+)-limited Aerobacter aerogenes growing in a similar medium at corresponding dilution rates. 2. Growth of the bacillus in a K(+)-limited environment did not lower the cellular potassium and phosphorus contents, the molar proportions of cell-bound magnesium, potassium, RNA (as nucleotide) and phosphorus being approximately constant at 1:13:5:13 (compared with 1:4:5:8 in Mg(2+)-limited or K(+)-limited A. aerogenes). 3. Growth of B. subtilis in a phosphate-limited environment caused the cellular phosphorus content to be lowered to a value similar to that of Mg(2+)-limited A. aerogenes, but the potassium content was not correspondingly lowered; the molar potassium:magnesium ratio varied from 14 to 17 with changes in dilution rate from 0.4 to 0.1hr.(-1). 4. Whereas over 70% of the cell-bound phosphorus of Mg(2+)-limited or K(+)-limited A. aerogenes was contained in the nucleic acids, these polymers accounted for less than 50% of the phosphorus present in similarly limited B. subtilis; much phosphorus was present in the walls of the bacilli, bound in a teichoic acid-type compound composed of glycerol phosphate and glucose (but no alanine). 5. Phosphate-limited B. subtilis cell walls (from organisms grown at a dilution rate of 0.2hr.(-1)) contained little phosphorus and no detectable amounts of teichoic acid, but 40% of the cell-wall dry weight could be accounted for by a teichuronic acid-type compound; this contained a glucuronic acid and galactosamine, neither of which could be detected in the walls of Mg(2+)-limited B. subtilis grown at a corresponding rate. 6. It is suggested that the high concentration of potassium in growing B. subtilis (compared with A. aerogenes) results from the presence of large amounts of anionic polymer (teichoic acid or teichuronic acid) in the bacillus cell walls.     

Purification of RNA-free plasmid DNA using alkaline extraction followed by Ultrogel A2 column chromatography

A procedure for extracting RNA-free plasmid DNA from bacterial cells is described. The method is simple and rapid enough to obtain pure plasmid DNA in 8 to 10 h after plasmid amplification. The protocol uses the alkaline extraction procedure described by Birnboim and Doly (1979, Nucl. Acid Res. 7, 1513-1523). Plasmid DNA is then separated from high-molecular-weight RNA by ammonium acetate precipitation and from low-molecular-weight RNA contaminants by Ultrogel A2 column chromatography. The plasmid DNA obtained by this inexpensive technique is sufficiently pure to be used for restriction endonuclease analysis, 5'-end labeling, S1 mapping, DNA sequencing, and colony hydridization.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

A new approach to the analysis of hybridization of bacterial nucleic acids. Analysis of ribosomal ribonucleic acids of Bacillus subtilis

A new graphical analytical technique is described for the hybridization of bacterial RNA with denatured homologous DNA immobilized on cellulose nitrate membrane filters. To a constant amount of DNA, various amounts of bacterial RNA were added and the percentage of input RNA bound was plotted against the DNA/RNA weight ratio in a given experiment. When RNA samples were used that hybridize to denatured DNA as a single species, the resulting curves (RNA-hybridization-efficiency curves) could be analysed to show the percentage of the DNA capable of specifically binding the RNA and could also be used to detect the presence of minor RNA contaminants in a purified specimen. The method could also estimate the relative amounts of two species of RNA in a mixture when these were hybridized independently to different DNA cistrons or cistron groups. As an example of RNA that can be studied in this way, the 16s and 23s ribosomal RNA species of Bacillus subtilis were chosen. These each behave in DNA-RNA hybridization as a single species and bind independently to different groups of DNA cistrons. The results obtained from hybridization-efficiency curves were compared with those obtained by the more usual method of saturating the specific DNA regions with excess of ribosomal RNA (hybridization-saturation curves). It was confirmed by both approaches that 0.15 (+/-0.02)% of B. subtilis DNA would hybridize with 16s ribosomal RNA, 0.30 (+/-0.02)% would hybridize with 23s ribosomal RNA, and 0.46 (+/-0.02)% would hybridize with (16s+23s) ribosomal RNA. This agreement suggested that mass-action equilibria between hybridized and free RNA had a negligible effect on the hybridization curves over the range of DNA and RNA concentrations employed.     

The release of radioactive nucleic acids and mucoproteins by trypsin and ethylenediaminetetra-acetate treatment of baby-hamster cells in tissue culture

Monolayers of baby-hamster kidney cells were grown on glass in tissue culture and harvested with trypsin or EDTA in order to investigate the cell surface macromolecules removed by these cell-disaggregating agents. The release of nucleic acids from the cells during the harvesting procedure was monitored by labelling the cellular RNA with [5-(3)H]uridine and the cellular DNA with [2-(14)C]thymidine. Treatment of the cells with EDTA was found to cause an increase in the permeability of the plasma membrane with 7.6% of the cellular RNA, but less than 1% of the cellular DNA, being released. Moreover, 61% of the cells harvested with EDTA were permeable to Trypan Blue. With crude trypsin, lysis of the cell occurred with the release of similar amounts of RNA and DNA amounting to about 11% of the total cellular nucleic acid. In contrast, crystalline trypsin released only 1% of the cellular nucleic acids. Since virtually all the cells (99%) after harvesting in crystalline trypsin were impermeable to Trypan Blue, this method was suitable for obtaining cell surface macromolecules without contamination by intracellular damage. [1-(14)C]Glucosamine was incorporated by the cells only into bound hexosamines and sialic acids. [By monitoring the release of radioactivity in high-molecular-weight material in such experiments a measure of the release of macromolecules containing amino sugars was obtained.] Of the total macromolecules containing amino sugars in the cells 33%, 24% and 13% were released when the cells were harvested with crude trypsin, crystalline trypsin or EDTA respectively. Crystalline trypsin also released 39% of the total sialic acid of the cell, whereas less than 1% of the cellular sialic acid was present in the EDTA-treated fraction. It is concluded that the macromolecules containing amino sugars released with crude trypsin and EDTA are likely to be heavily contaminated with intracellular material. However, the macromolecules released by crystalline trypsin appear to come from the cell surface.