A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

Synthesis of 2′-Deoxyribonucleoside Derivatives of 1-Deazapurine

Abstract

5, 7-Dichloro-3H-imidazo[4, 5-b]pyridine (4) is a versatile base which can be coupled with a variety of sugar moieties and transformed in a series of 7-alkyl(aryl)amino-derivatives by reacting with the corresponding amines. In this paper synthesis, structure elucidation and ADA inhibitory activity of 2′-deoxyribonucleoside derivatives of N⁶-substituted 1-deazaapurines are described.     

Microbial Synthesis of Purine 2′-Amino-2′-deoxyribosides

The microbial synthesis of some purine 2′-amino-2′-deoxyribonucleosides from purine bases and 2′-amino-2′-deoxyuridine is described. Various bacteria, especially Erwinia herbicola, Salmonella schottmuelleri, Enterobacter aerogenes and Escherichia coli, were able to transfer the aminoribosyl moiety of 2′-amino-2′-deoxyuridine to purine bases (transaminoribosylation) in the presence of inorganic phosphate. The optimum conditions for the reaction were pH 7.0 and 63°C. No reaction was observed in the absence of inorganic phosphate and the optimum concentration of it was around 30 mm. Adenine, guanine, 2-chlorohypoxanthine and hypoxanthine were transformed to the corresponding 2′-amino-2′-deoxyribonucleosides by the catalytic activity of the wet cell paste of Enterobacter aerogenes AJ 11125. The enzymatically synthesized purine 2′-amino-2′-deoxyribonucleosides were isolated and identified by physicochemical means. 2′-Amino-2′-deoxyadenosine strongly inhibited the growth of Hela cells in tissue culture, and the ED⁵⁰ was 2.5μ/ml.     

Synthesis,evaluation of anti-HIV-1 and anti-HCV activity of novel 2′,3′-dideoxy-2′,2′-difluoro-4′-azanucleosides

A series of 2′,3′-dideoxy-2′,2′-difluoro-4′-azanucleosides of both pyrimidine and purine nucleobases were synthesized in an efficient manner starting from commercially available L-pyroglutamic acid via glycosylation of difluorinated pyrrolidine derivative 15. Several 4′-azanucleosides were prepared as a separable mixture of α- and β-anomers. The 6-chloropurine analogue was obtained as a mixture of N⁷ and N⁹ regioisomers and their structures were identified based on NOESY and HMBC spectral data. Among the 4′-azanucleosides tested as HIV-1 inhibitors in primary human lymphocytes, four compounds showed modest activity and the 5-fluorouracil analogue (18d) was found to be the most active compound (EC₅₀ = 36.9 μM) in this series. None of the compounds synthesized in this study demonstrated anti-HCV activity.     

Efficient Synthesis of 2′-Amino-2′-deoxypyrimidine 5′-Triphosphates

Abstract

The synthesis of 2′-amino-2′-deoxypyrimidine 5′-triphosphates is described. The 2′-amino-2′-deoxyuridine 5′-triphosphate is obtained from uridine in four steps with 25% overall yield. The 2′-amino-2′-deoxycytidine 5′-triphosphate is obtained from uridine in seven steps with 13% overall yield.     

Synthesis of 2′-Deoxyformycin B and 2′-Deoxyoxoformycin B

Abstract

3-β-D-Ribofuranosylpyazolo[4,3-d]pyrimidines (formycins)¹ modified in the heteroaromatic moiety are of biological interest as analogues of adenosine and guanosine, and have been the objects of intensive synthetic chemical effort by several groups.^2-9 2′-Deoxynucleosides^2c,2d,7b,13 and other analogties of the formycins modified in the sugar moiety^10-12 are also of potential interest, but have been less extensively studied. Examples of the 2′-deoxyribonucleoside type known to date include the 2′-deoxy-6-thioguanosine analogue 1, the 2′-deoxyadenosine (dAdo) analogue 2 (2′-deoxyformycin A),^10,13 and the 2-chloro-2′-deoxyadenosine analogue 3.^7b Compound 2 was found to be 10-15 times more potent than 2′-deoxyadenosine as an inhibitor of the growth of S49 cells, a murine lymphoma line of T-cell origin.¹³ Activity depended on 5′- phosphorylation, since mutants lacking the enzymes adenosine kinase (AK) and deoxycytidine kinase (dCK) were insensitive to the drug. Furthermore, activity was comparable in the presence and absence of an AK inhibitor, suggesting that 2, unlike dAdo, may be a poor substrate for adenosine deaminase. That 5′-phosphorylation of 2 was mediated by AK rather than dCK was indicated by the fact that miitants lacking only dCK retained sensitivity. This contrasted with the behavior of dAdo, which is known to be n substrate for both AK and dCK.¹⁴     

Synthesis of 1′,2′-methano-2′,3′-dideoxynucleosides as potential antivirals

The synthesis of constrained nucleosides has become an important tool to understand the SAR in the interaction between biological and synthetic nucleotides in the context of antisense oligonucleotide therapy. The incorporation of a cyclopropane into a furanose ring of a nucleoside induces some degree of constrain without affecting significantly the steric environment of a nucleoside. Here, we report a new, short and stereocontrolled synthesis of two constrained nucleosides analogues, 1′,2′- methano-2′,3′-dideoxyuridine 9, and the corresponding cytidine analog 12. X-ray crystallography revealed that the furanose ring in the constrained uridine and cytidine analogues was flattened with virtual loss of pseudorotation. The phosphoramidate esters of the novel constrained uridine and cytidine nucleosides, intended as prodrugs, were tested in cell-based assays for viral replication across the herpes virus family and HIV inhibition courtesy of Merck laboratories, Rahway. They were also tested in antiproliferative assays against colorectal and melanoma cell lines. Unfortunately, none of the compounds showed activity in these assays.     

Facile Synthesis of Base-Labile 2′-Deoxyribonucleosides: An Improved Synthesis of 2′-Deoxy-5-aza-Cytidine

Abstract

The use of the Fmoc group for the protection of the hydroxy functions of the sugar moiety gave an improved overall yield of 2′-deoxy-5-azacytidine (6β), due to the mildly-basic conditions required for its removal from the protected nucleoside.     

Synthesis of 2′-Substituted Sulfide-Linked Dinucleotides

Abstract

3′-Deoxy-3′-(2-mesyloxyethyl)ribofuranosylthymine derivative 3, and its 2′-methoxy (16) and 2′-deoxy (38) analogs were condensed with 5′-deoxy-5′-thiothymidine 4 and 17 or 2′-O-methyl-5′-deoxy-5′-thiouridine 34 and 37 to provide, after standard functional group transformations, thymidine-thymidine and uridine-thymidine dimers 9, 21, 43 and 47. Oxidation of model sulfide dimer 48 with oxone gave sulfone 49. It was not stable to 27% ammonia.     

Synthesis of 2′,3′-Dideoxyribavirin

Abstract

A synthesis of 1-(2,3-dideoxy-β-D-ribofuranosyl)-1,2,4-triazole-3-carboxamide (2′,3′-dideoxyribavirin, ddR) is described. Glycosylation of the sodium salt of 1,2,4-triazole-3-carbonitrile (5) with 1-chloro-2-deoxy-3,5-di-0-p-toluoyl-α-D-erythro-pentofuranose (1) gave exclusively the corresponding N-1 glycosyl derivative with β-anomeric configuration (6), which on ammonolysis provided a convenient synthesis of 2′-deoxyribavirin (7). Similar glycosylation of the sodium salt of methyl 1,2,4-triazole-3-carboxylate (2) with 1 gave a mixture of corresponding N-1 and N-2 glycosyl derivatives (3) and (4), respectively. Ammonolysis of 3 furnished yet another route to 7. A four-step deoxygenation procedure using imidazolylthiocarbonylation of the 3′-hydroxy group of 5′-0-toluoyl derivative (9a) gave ddR (11). The structure of 11 was proven by single crystal X-ray studies. In a preliminary in vitro study ddR was found to be inactive against HIV retrovirus.     

Synthesis of 2′-O-Photocaged Ribonucleoside Phosphoramidites

The chemical synthesis and incorporation of the phosphoramidite derivatives of 2?′-O-photocaged ribonucleosides (A, C, G and U) with o-nitrobenzyl, α-methyl-o-nitrobenzyl or 4,5-dimethoxy-2-nitrobenzyl group into oligoribonucleotides are described. The efficiency of UV irradiated uncaging of these 2′-O-photocaged oligoribonucleotides was found in the order of α-methyl-o-nitrobenzyl < 4,5-dimethoxy-2-nitrobenzyl < 2′-O-o-nitrobenzyl.     

Concise and Efficient Synthesis of 3′-O-Tetraphosphates of 2′-Deoxyadenosine and 2′-Deoxycytidine

We describe concise and efficient synthesis of biologically very important 3′-O-tetraphosphates namely 2′-deoxyadenosine-3′-O-tetraphosphate (2′-d-3′-A4P) and 2′-deoxycytidine-3′-O-tetra-phosphate (2′-d-3′-C4P). N⁶-benzoyl-5′-O-levulinoyl-2′-deoxyadenosine was converted into N⁶-benzoyl-5′-O-levulinoyl-2′-deoxyadenosine-3′-O-tetraphosphate in 87% yield using a one-pot synthetic methodology. One-step concurrent deprotection of N⁶-benzoyl and 5′-O-levulinoyl groups using concentrated aqueous ammonia resulted 2′-d-3′-A4P in 74% yield. The same synthetic strategy was successfully employed to convert N⁴-benzoyl-5′-O-levulinoyl-2′-deoxycytidine into 2′-d-3′-C4P in 68% yield.     

Diastereo- and Enantioselective Synthesis of 1′-C-Branched N,O-Nucleosides

Abstract

A synthetic approach towards 1′-C-branched N, O-nucleosides is reported, based on 1,3-dipolar cycloaddition of ethoxycarbonylnitrone. The asymmetric version of the process exploits the presence of a chiral auxiliary at the carbon atom of nitrone and leads to β-D and β-L nucleosides in good yields.     

Improved Synthesis of 2′-Fluoro-2′-Deoxyadenosine and Synthesis and Carbon-13 NMR Spectrum of Its 3′,5′-Cyclic Phosphate Derivative1

Abstract

Some improvements were made on synthetic method for 2′-fluoro-2′-deoxyadenosine (11). Thus 11 was obtained in an overall yield of 9.3% starting from adenosine. 2′-Fluoro-2′-deoxyadenosine 3′,5′-cyclic phosphate (13), an analogue of cAMP, was synthesized from 11. The carbon-13 NMR spectrum was measured. The sugar carbon signals can be unambiguously assigned since the C1′ C2′ and C3′ have different ¹³C-¹⁹F coupling constants. Comparison of the data with those of other 3′,5′-cyclic phosphate derivatives confirms the assignments of C3′ and C4′ signals previously proposed by us.     

Synthesis of Some 2′,3′-Dideoxy-2′-C-Methyl-Substituted Nucleosides

Abstract

Nucleoside analogues analogues1-(2′,3′-dideoxy-2′-C-hydroxymethyl-β-D-erythro-pentofuranos-yl)thymine (1), 2′,3′-dideoxy-2′-C-hydroxymethylcytidine (2), 2′,3′-dideoxy-2′-C-hydroxymethyladenosine (3), 1-(2′-C-azidomethyl-2′,3′-dideoxy-β-D-erythro-pento-furanosyl)thymine (4), 2′-C-azidomethyl-2′,3′-dideoxycytidine (5), and 2′3′-dideoxy-2′-C-methylcytidine (6) have been synthesized from (S)-4-hydroxymethyl-y-butyro-lactone (7)     

Synthesis and Evaluation of 2′-Deoxy-2′-Spirodiflurocyclopropyl Nucleoside Analogs

The preparation of 2′-deoxy-2′-siprodifluorocyclopropany-lnucleoside analogs has been achieved from α-d-glucose in several steps. The key step in the synthesis was the introduction of the difluorocyclopropane through a difluorocarbene type reaction at the 2′-position. Then, a series of novel 2′-deoxy-2′-spirodifluorocyclopropanyl nucleoside analogs were synthesized using the Vorbrüggen method. All the synthesized nucleosides were characterized and subsequently evaluated against hepatitis C and influenza A virus strains in vitro.     

Synthesis of 2′-C-α-Methyl-2′,3′-dideoxynucleosides

Abstract

A general method for the synthesis of 2′-C-α-methyl-2′,3′-dideoxynucleosides is presented. Stereofacial selectivity of the 2-C-methylation reaction of γ-lactone has been investigated, in which the presence of a bulky group at the 5-hydroxymethyl produced the α-isomer as a major product. During glycosylation, the α-methyl group directed the formation of nucleosides in favor of the ß-isomer. This methodology is applied to the synthesis of some new pyrimidine and purine nucleosides.

     

Benzimidazole 2′-Isonucleosides: Design,Synthesis, and Antiviral Activity of 2-Substituted-5,6-Dichlorobenzimidazole 2′-Isonucleosides

Abstract

2,5,6-Trihalogenated benzimidazole-β-D-ribofuranosyl nucleosides and 2-substituted amino-5,6-dichlorobenzimidazole-β-L-ribofuranosyl nucleosides are potent and selective inhibitors of human cytomegalovirus (HCMV). The D-ribofuranosyl analogs are metabolized rapidly in vivo rendering them unsuitable as drug candidates. The primary source of instability is thought to be the anomeric bond. The synthesis of a series of chemically stable benzimidazole-2′-isonucleosides is presented. The synthetic schemes employed are based on nucleophilic displacements of a 2′-tosylate from carbohydrate intermediates with 2-bromo-5,6-dichlorobenzidazole. 2-Bromo and 2-isopropyl amino analogs with 3′- and 5′-oxo and deoxy substitutions were prepared. The benzimidazole-2′-isonucleosides presented here demonstrated reduced activity against HCMV when compared to other D-ribofuranosyl benzimidazole analogs. In addition, they were not found to be inhibitors of HIV.     

Chemical Synthesis of Cap Analogues: P1,P2-Dinucleoside-5′-diphosphates

Abstract

A procedure was developed for the chemical synthesis of P¹,P²-dinucleoside-5′-diphosphates (N₁(5′)pp(5′)N₂) on a nanomolar scale Reaction conditions for activating purine-5′-monophosphates (pA, pG, and pm⁷G) by 1,1′-carbonyldiimidazole were studied and optimized in respect to solvents and amount of activating reagent used. Various dinucleoside-5′-diphosphates were synthesized in 62-98% yield by incubating activated and non-activated purine-5′-monophosphates. Two unexpected by-products were formed by competition reactions: the imidazolidate of the non-activated nucleotide and the corresponding symmetrically substituted dinucleoside-5′-diphosphate. A mechanism is proposed to explain the observed side reactions.     

Conformationally Locked Nucleoside Analogs. Synthesis of 2′-Deoxy-2′-C, 4′-C-Bridged Bicyclic Nucleosides

Abstract

1-α-Methylarabinose was converted, in three steps, to 2-deoxy-2-methyleneribose derivative 3, which was subjected to hydroboration to give 2-α-hydroxymethyl derivative 4 exclusively. 4 was converted to 2,4-bis(hydroxymethyl)ribose derivative 6 in four steps. Mesylation, detritylation, and ring closure, followed by hydrolysis of the mesyl group at O5, gave 3,6-dioxabicyclo[3,2,1]octane derivative 8. After acetylation, 8 was coupled with silylated 6-chloropurine to give desired α- and β-bicyclic-sugar nucleosides.