共查询到20条相似文献,搜索用时 31 毫秒
1.
《Nucleosides, nucleotides & nucleic acids》2013,32(5-8):1089-1091
Abstract A systematic study to evaluate the ability of 5′-DNA-3′-p-(N)-PNA-(C) chimeras to form triple helix structures has been undertaken. Preliminary results carried out on a 16-mer chimera with three PNA monomers at the 3′-end showed the formation of a stable DNA-PNA/DNA/DNA triplex, having similar conformational behaviour to a canonical DNA/DNA/DNA triplex. 相似文献
2.
Birendra K. Bhattacharya Rodrigo V. Devivar Ganapathi R. Revankar 《Nucleosides, nucleotides & nucleic acids》2013,32(6):1269-1287
Abstract A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A10:T10) at pH 7.0. 相似文献
3.
Tamer Nasr Yosuke Taniguchi Tomoko Takaki Hidenori Okamura Shigeki Sasaki 《Nucleosides, nucleotides & nucleic acids》2013,32(12):841-860
(1S,3S,4R)-1-Phenyl-1-thymidyl-3-hydroxy-4-hydroxymethylcyclopentane (10) and their analogs were synthesized, incorporated into the oligodeoxynucleotides, and their properties were evaluated for the formation of duplex and triplex DNA. The known chiral cyclopentanone derivative was converted into the corresponding ketimine sulfonamide derivative, which was subjected to a stereoselective PhLi addition. The formed sulfonamide was hydrolyzed to afford the primary amino group, on which the thymine moiety was built. The benzyl protecting groups were removed to form the nucleoside analog having a phenyl group and the thymine unit at the 1′ position of a carbocyclic skeleton (10). In the estimation of the oligodeoxynucleotides incorporating 10 for duplex and triplex formation, the carbocyclic nucleoside analog 10 did not show the stabilizing effect for duplex formation; on the other hand, it stabilized the triplex. Therefore, the skeleton of the phenyl-substituted carbocyclic nucleoside analog 10 may be a platform for the formation of stable triplex DNA. 相似文献
4.
Effective sequence-specific recognition of duplex DNA is possible by triplex formation with natural oligonucleotides via Hoogsteen H-bonding. However, triplex formation is in practice limited to pyrimidine oligonucleotides that bind duplex A-T or G-C base pair DNA sequences specifically at homopurine sites in the major groove as T·A-T and C+ ·G-C triplets. Here we report the successful modelling of novel unnatural nucleosides that recognize the C-G DNA base pair by Hoogsteen-like major groove interaction. These novel Hoogsteen nucleotides are examined within model A-type and B-type conformation triplex structures since the DNA triplex can be considered to incorporate A-type and/or B-type configurational properties. Using the same deoxyribose-phosphodiester and base-deoxyribose dihedral angle configuration, a triplet comprised of a C-G base pair and the novel Hoogsteen nucleotide, Y2, replaces the central T·A-T triplet in the triplex. The presence of any structural or energetic perturbations due to the central triplet in the energy-minimized triplex is assessed with respect to the unmodified energy minimized (T·A-T)11 starting structures. Incorporation of this novel triplet into both A-type and B-type natural triplex structures provokes minimal change in the configuration of the central and adjacent triplets. 相似文献
5.
Birendra K. Bhattacharya Mohan V. Chari Ross H. Durland Ganapathi R. Revankar 《Nucleosides, nucleotides & nucleic acids》2013,32(1-2):45-63
Abstract A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0. 相似文献
6.
Rong Cao Carl F. Venezia Bruce A. Armitage 《Journal of biomolecular structure & dynamics》2013,31(6):844-857
Abstract The DNA binding behavior of a tricationic cyanine dye (DiSC3+(5)) was studied using the [Poly(dA-dT)]2, [Poly(dI-dC)]2 and Poly(dA)?Poly(dT) duplex sequences and the Poly(dA) ?2Poly(dT) triplex. Optical spectroscopy and viscometry results indicate that the dye binds to the triplex structure by intercalation, to the nonalternating Poly(dA)?Poly(dT) duplex through minor groove binding and to the alternating [Poly(dA-dT)]2 duplex by a combination of two binding modes: intercalation at low concentration and dimerization within the minor groove at higher concentration. Dimerization occurs at lower dye concentrations for the [Poly(dI-dC)]2 sequence, consistent with our previous investigations on an analogous monocationic cyanine dye. [Seifert, J.L., et al. (1999) J. Am. Chem. Soc. 121, 2987–2995] These studies illustrate the diversity of DNA binding modes that are available to a given ligand structure. 相似文献
7.
《Nucleosides, nucleotides & nucleic acids》2013,32(5-8):1187-1189
Abstract We synthesized pyrrolidino-C-nucleosides, incorporated them into oligodeoxynucleotides and investigated their pairing properties. The thermal duplex and triplex stabilities were measured. While triplex formation is destabilized in the case of pyrrolidino-pseudo-U and -T, pyrrolidino-pseudo-iso-C leads to an increase of the Tm value for third strand dissociation. Duplexes are destabilized with all pyrrolidino-C-nucleosides. 相似文献
8.
The modes of binding of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐Bifuran]‐5‐carboximidamide (DB832) to multi‐stranded DNAs: human telomere quadruplex, monomolecular R‐triplex, pyr/pur/pyr triplex consisting of 12 T*(T·A) triplets, and DNA double helical hairpin were studied. The optical adsorption of the ligand was used for monitoring the binding and for determination of the association constants and the numbers of binding sites. CD spectra of DB832 complexes with the oligonucleotides and the data on the energy transfer from DNA bases to the bound DB832 assisted in elucidating the binding modes. The affinity of DB832 to the studied multi‐stranded DNAs was found to be greater (Kass ≈ 107M?1) than to the duplex DNA (Kass ≈ 2 × 105M?1). A considerable stabilizing effect of DB832 binding on R‐triplex conformation was detected. The nature of the ligand tight binding differed for the studied multi‐stranded DNA depending on their specific conformational features: recombination‐type R‐triplex demonstrated the highest affinity for DB832 groove binding, while pyr/pur/pyr TTA triplex favored DB832 intercalation at the end stacking contacts and the human telomere quadruplex d[AG3(T2AG3)3] accommodated the ligand in a capping mode. Additionally, the pyr/pur/pyr TTA triplex and d[AG3(T2AG3)3] quadruplex bound DB832 into their grooves, though with a markedly lesser affinity. DB832 may be useful for discrimination of the multi‐sranded DNA conformations and for R‐triplex stabilization. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 8–20, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com 相似文献
9.
Teodoro M. Paner Frank J. Gallo Mitchel J. Doktycz Albert S. Benight 《Biopolymers》1993,33(12):1779-1789
CD spectra and melting curves were collected for a 28 base-pair DNA fragment in the form of a DNA dumbbell (linked on both ends by T4 single-strand loops) and the same DNA sequence in the linear form (without end loops). The central 16 base pairs (bp) of the 28-bp duplex region is the poly(pu) sequence: 5′-AGGAAGGAGGAAAGAG-3′. Mixtures of the dumbbell and linear DNAs with the 16-base single-strand sequence 5′-TCCTTCCTCCTTTCTC-3′ were also prepared and studied. At 22°C, CD measurements of the mixtures in 950 mM NaCl, 10 mM sodium acetate, 1 mM EDTA, pH 5.5, at a duplex concentration of 1.8 μM, provided evidence for triplex formation. Spectroscopic features of the triplexes formed with either a dumbbell or linear substrate were quite similar. Melting curves of the duplex molecules alone and in mixtures with the third strand were collected as a function of duplex concentration from 0.16 to 2.15 μM. Melting curves of the dumbbell alone and mixtures with the third strand were entirely independent of DNA concentration. In contrast, melting curves of the linear duplex alone or mixed with the third strand were concentration dependent. At identical duplex concentrations, the dumbbell alone melts ~20°C higher than the linear duplex. The curve of the linear duplex displayed a significant pretransition probably due to end fraying. On melting curves of mixtures of the dumbbell or linear duplex with the third strand, a low temperature transition with much lower relative hyperchromicity change (~ 5%) was observed. This transition was attributed to the melting of a new molecular species, e.g., the triplex formed between the duplex and single-strand DNA molecules. In the case of the dumbbell/single-strand mixture, these melting transitions of the triplex and the dumbbell were entirely resolvable. In contrast, the melting transitions of the linear duplex and the triplex overlapped, thereby preventing their clear distinction. To analyze the data, a three-state equilibrium model is presented. The analysis utilizes differences in relative absorbance vs temperature curves of dumbbells (or linear molecules) alone and in mixtures with the third strand. From the model analysis a straightforward derivation of fT(T), the fraction of triplex as a function of temperature, was obtained. Analysis of fT vs temperature curves, in effect melting curves of the triplexes, provided evaluation of thermodynamic parameters of the melting transition. For the triplex formed with the dumbbell substrate, the total transition enthalpy is ΔHT = 118.4 ± 12.8 kcal/mol (7.4 ± 0.8 kcal/mol per triplet unit) and the total transition entropy is ΔST = 344 ± 36.8 cal/K · mol (eu) (21.5 ± 2.3 eu per triple unit). The transition curves of the triplex formed with the linear duplex substrate displayed two distinct regions. A broad pretransition region from fT = 0 to 0.55 and a higher, sharper transition above fT = 0.55. The transition parameters derived from the lower temperature region of the curve are ΔH′T = 44.8 ± 9.6 kcal/mol and ΔS′T = 112 ± 33.6 eu (or ΔH′ = 2.8 ± 0.6 kcal/mol and ΔS′ = 7.0 ± 2.1 eu per triplet). These values are probably too small to correspond to actual melting of the triplex but instead likely reveal effects of end fraying of the duplex substrate on triplex stability. Transition parameters of the upper transition are ΔH′T = 128.0 ± 2.3 kcal/mol and ΔS′T = 379.2 ± 6.4 eu (ΔH′ = 8.0 ± 0.2 kcal/mol and ΔS′ = 23.7 ± 0.4 eu per triplet) in good agreement (within experimental error) with the transition parameters of the triplex formed with the dumbbell substrate. Supposing this upper transition reflects actual dissociation of the third strand from the linear duplex substrate this triplex is comparable in thermodynamic stability to the triplex formed with a dumbbell substrate. Even so, the biphasic melting character of the linear triplex obscures the whole analysis, casting doubt on its absolute reliability. Apparently triplexes formed with a dumbbell substrate offer technical advantages over triplexes formed from linear or hairpin duplex substrates for studies of DNA triplex stability. © 1993 John Wiley & Sons, Inc. 相似文献
10.
Mark R. Player Ratan Maitra Robert Silverman Paul F. Torrence 《Nucleosides, nucleotides & nucleic acids》2013,32(7-9):1221-1222
Abstract We have identified a region within a 1 kb HIV gag RNA which can be ablated in vitro using a 2,5-A antisense chimera. The cleavage was specific and almost complete at a concentration of 100 nM chimera. 相似文献
11.
Abstract The replacement of phosphodiester linkages of the polyanion DNA with S-methylthiourea linkers provides the polycation deoxyribonucleic S-methylthiourea (DNmt). Molecular dynamics studies to 1,220 ps of the hybrid triplex formed from octameric DNmt strands d(Tmt)8 with a complementary DNA oligomer strand d(Ap)8 have been carried out with explicit water solvent and Na counterions under periodic boundary conditions using the CHARMM force field and the Ewald summation method. The Watson-Crick and Hoogsteen hydrogen-bonding patterns of the A/T tracts remained intact without any structural restraints for triplex structures throughout the simulation. The duplex portion of the triplex structure equilibrated at a B-DNA conformation in terms of the helical rise and other helical parameters. The dynamic structures of the DNmt·DNA·DNmt triplex were determined by examining histograms from the last 800 ps of the dynamics run. These included the hydrogen-bonding pattern (sequence recognition), three-centered bifurcating occurrences, minor groove width variations, and bending of tracts for the hybrid triplex structures. Together with the Watson-Crick hydrogen-bondings, the strong Hoogsteen hydrogen-bondings, the partially maintained three-centered bifurcatings in the Watson-Crick pair, and the medium-strength three-centered bifurcatings in the Hoogsteen pair suggest that the hybrid triplex is energetically favorable as compared to a duplex with similar base stacking, van der Waals interactions, and helical parameters. This is in agreement with our previously reported thermody- namic study, in which only triplex structures were observed in solution. The bending angle measured between the local axis vectors of the first and last helical axis segments is about 20° for the Watson-Crick portion of the averaged structure. Propeller twist (associated with three-centered hydrogen-bonding) up to ?30°, native to DNA AT base pairing, was also observed for the triplex structure. The sugar pseudorotation phase angles and the ring rotation angles for the DNA strand are within the C3′-endo domain and C2′-endo domain for the DNmt strand. Water spines are observed in both minor and major grooves throughout the dynamics run. The molecular dynamics simulations of the structural properties of DNmt·DNA·DNmt hybrid triplex is compared to the DNG·DNA·DNG hybrid triplex (In DNG the -O-(PO2-)-O- linkers in DNA is replaced by -NH-C(=N2)-NH-). 相似文献
12.
H. Torigoe A. Ferdous H. Watanabe T. Akaike A. Maruyama 《Nucleosides, nucleotides & nucleic acids》2013,32(6-7):1655-1656
Abstract The binding constant of a homopyrimidine oligonucleotide with its target duplex for the pyrimidine-motif triplex formation at neutral pH was analyzed and found to be remarkably higher in the presence of the poly (L-lysine)-graft-dextran copolymer than that without any triplex stabilizer or in the presence of spermine. The promoting effect mainly results from the considerable increase in the association rate constant. 相似文献
13.
E. Lesnik F. Hassman J. Barbeau K. Teng K. Weiler R. Griffey 《Nucleosides, nucleotides & nucleic acids》2013,32(7-9):1775-1779
Abstract Melting UV experiments and mixing curves indicated slow triplex formation between lysine comprising PNA and DNA complement in 100mM Na+ solution. 相似文献
14.
L. De Napoli G. Di Fabio A. Messere D. Montesarchio D. Musumeci G. Piccialli 《Nucleosides, nucleotides & nucleic acids》2013,32(6-7):1639-1640
Abstract New solid supports, functionalized with suitably protected 1,2,3-propanetriol and cis,cis-1,3,5-cyclohexanetriol, were efficiently prepared and used in the standard automated synthesis of 3′-3′ linked ODNs for triplex formation experiments. 相似文献
15.
Abstract We examined the effects of 1–(2-deoxy -2-fluoro-β-D-arabinofuranosyl)-thymine (or FMAU, a potent antiviral nucleoside) on the stability of duplex and triplexes. When compared the stability of the self-complementary 5′-A5T5 duplex with 5′-A5X5 (X = FMAU), duplex containing FMAU has much higher melting temperature (Tm). 5′-A6T5T3X3T5F3X3 and T3X3T5A6T5F3X3 form the parallel and antiparallel triplexes T3X3: A6:X3X3, respectively. The former exhibited the typical T:A:T triplex behavior with only one melting temperature at 70 °C and 45 °c in 1.0 M and 0.2 M NaCl solution, respectively, whereas the latter has two Tm values at 56 °C and 28 °C in 1.0 M solution. FMAU clearly stabilize the triplex structure as A6T22 which forms the parallel triplex T6:A6:T6 has also only one Tm at 54 °C and 37 °C in high and iow salt concentration solutions, respectively. A 31mer 5′-TCCTCCTTTTTTAGGAGGATTTTTTGGTGGT and 5′-TCCTCCTTTTTTAGGAGGATTTTTTX'X'TX'X'T (X' = 2′-deoxy-5-methylcytidine) were prepared to study their triplex forming potential. The former was found to have a week interaction of the Watson-Crick duplex with the mismatched third-strand at all pH. The latter formed a stable triplex at lower pH consistent with required protonation on the 5-methylcytosine base. For these studies we developed a simple PC desktop spreadsheet program to calculate the first derivative profile of the melting curve data. This paper is dedicated to Prof. Jacques H. van Boom on the occasion of his 60th birthday. 相似文献
16.
《Nucleosides, nucleotides & nucleic acids》2013,32(5-8):1097-1099
Abstract For the effective recognition of C:G interruption in homopurine-homopyrimidine duplex DNA, we examined triplex-forming ability and sequence-selectivity of a triplex-forming oligonucleotide (TFO) involving of 2′-O,4′-C-methylene bridged nucleic acid with 2-pyridone base analogue. We found that the modified TFO formed stable triplex with high binding affinity and sequence-selectivity. 相似文献
17.
Bistra Iordanova Clinton S. Robison Eric T. Ahrens 《Journal of biological inorganic chemistry》2010,15(6):957-965
This paper describes the design and characterization of a novel ferritin chimera. The iron storage protein ferritin forms
a paramagnetic ferrihydrite core. This biomineral, when placed in a magnetic field, can decrease the transverse NMR relaxation
times (T
2 and T
2*) of nearby mobile water protons. Ferritin nucleic acid constructs have recently been studied as “probeless” magnetic resonance
imaging (MRI) reporters. Following reporter expression, ferritin sequesters endogenous iron and imparts hypointensity to T
2- and T
2*-weighted images in an amount proportional to the ferritin iron load. Wild-type ferritin consists of various ratios of heavy
H and light L subunits, and their ratio affects ferritin’s stability and iron storage capacity. We report a novel chimeric
ferritin with a fixed subunit stoichiometry obtained by fusion of the L and the H subunits (L*H and H*L) using a flexible
linker. We characterize these supramolecular ferritins expressed in human cells, including their iron loading characteristics,
hydrodynamic size, subcellular localization, and effect on solvent water T
2 relaxation rate. Interestingly, we found that the L*H chimera exhibits a significantly enhanced iron loading ability and
T
2 relaxation compared to wild-type ferritin. We suggest that the L*H chimera may be useful as a sensitive MRI reporter molecule. 相似文献
18.
《Nucleosides, nucleotides & nucleic acids》2013,32(5-8):1085-1087
Abstract N-Alkylated 4-guanidino-2-pyrimidinone-containing nucleosides, in which the guanidine group mimics the double hydrogen bond donor pattern of protonated cytosine, were introduced in polypyrimidine sequences to explore their triple-helix forming capabilites. UV and CD melting experiments showed that strands containing these base analogues did not form triplex complexes. 相似文献
19.
Ye Fangt Chunli Bai Youqi Tang Shwu-Bin Lin Lou-sing Kan 《Journal of biomolecular structure & dynamics》2013,31(4):485-493
Abstract Hydrated water molecules of pyrimidine/purine/pyrimidine DNA hairpin triplex was studied by a comparison of triplex (CC·AG6) formed by a host oligodeoxypyrimidine of 5′- d(TC)3T4(CT)3 (CC) with a target hexadeoxypurine 5′-d(AG)3 (AG6) strand and by triplexes (MM·AG6, MC·AG6, and CM·AG6) formed by oligonucleotides with the exact sequences as above except 5-methylcytosine replaced all (MM), 5′ end half (MC), and 3′ end half (CM) cytosine bases in CC via FT-IR spectroscopy in hydrated film. Results revealed that: (i) all these triplexes have a similar hydration pattern, in which water molecules probably bound in the N7 sites of adenines and guanines in the Crick-Hoogsteen groove, and to the methyl group of thymidines in the Watson-Hoogsteen groove. There are also some bound water molecules found at the O2 sites of thymines in both Watson-Crick and Crick-Hoogsteen grooves, (ii) In the CC·AG6 triplex the S-type sugars are always dominant in all hydrated states, whereas in MM·AG6 triplex the relative population of the N-type sugars is very close to that of the S-type between 86% and 66% of humidity. Furthermore, the sugar conformation in two partially modified triplexes (CM·AG6, and MC·AG6) are dominant by the N-type at lower humidity. This phenomenon might reflect that the degree of bound water varies among the binding sites of bases, (iii) The effect of introducing a methyl group on cytosine is to generates spine of hydrophobic region in MM (MC and MC). The enlarging hydrophobic area not only increase the stability in solution, and also the stability in sodium hydrated films of the pyrimidine/purine/pyrimidine hairpin triplexes. 相似文献
20.
《Nucleosides, nucleotides & nucleic acids》2013,32(5-8):1571-1573
Abstract For the effective recognition of C ? G interruption in homopurine-homopyrimidine duplex DNA, we examined triplex-forming ability and sequence-selectivity of a triplex-forming oligonucleotide (TFO) involving of 2′-O, 4′-C-methylene bridged nucleic acid with 1-isoquinolone base analogue. We found that the modified TFO formed stable triplex with high binding affinity and sequence-selectivity. 相似文献