Definitive Solution Structures for the 6-Formylated Versions of 1-(βD-Ribofuranosyl)-, 1-(2′-Deoxy-β-D-Ribofuranosyl)-, and 1-β-D-Arabinofuranosyluracil,and of Thymidine

Abstract

ROESY and NOESY NMR spectroscopic analyses of the ribofuranosyl (1a), 2′-deoxyribofuranosyl (1b), and arabinofuranosyl (1c) derivatives of 6-formyluracil in (CD₃)₂SO and D₂O solutions have established that each exclusive 7,05′-cyclic hemiacetal diastereomer of 1a,b and the major 7,O2′-cyclic hemiacetal diastereomer of 1c possess the 7R configuration. In addition, (7R)-1c has been shown to be thermodynamically more stable than (7S)-1c, contrary to our previous indication. A new, higher yielding synthetic route to 1a has been developed, 1b has been obtained for the first time in crystalline form, the route to 1c has been modified to better accommodate large scale preparations, and a new, fourth member of this class, 6-formylthymidine (1d), has been synthesized and its solution structures in (CD₃)₂SO, D₂O, and CD₃OD have been determined. Antitumor and antiviral evaluations of 1a-c have revealed no significant levels of activity.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

New Coumaronochromones from White Lupin,Lupinus albus L. (Leguminosae)

A further investigation of the isoflavonoid constituents occurring in roots of the white lupin (Lupinus albus L. cv. Kievskij Mutant) has yielded five new coumaronochromones named lupinalbin A (la), B (2a), C (3), D (4) and E (5). These isoflavonoids were identified by physicochemical methods involving the use of biogenetically related 2′-hydroxyisoflavones as reference compounds. The presence of the rare dihydrofurano-isoflavone, erythrinin C (16), in white lupin roots has also been established.     

Simple and Stereoselective Syntheses of Nucleoside Analogues with a Benzo[c]furan Glycone Moiety

Abstract

A series of d4T analogues have been synthesised in which the 2′,3′-didehydro-2′,3′-dideoxyribose moiety is replaced by a benzo[c]furan core. A simple strategy has been developed to access a range of compounds for biological screening. In addition, a stereoselective approach has been achieved with view to permit more detailed studies.     

Efficient Synthesis of 8-Thiosubstituted Guanine Derivatives as Potential Tools for Biochemical and Biological Studies

Abstract

A method for the selective introduction of the N²-(dimethylamino)methylene group into 8-thio-9-(2-hydroxyethoxymethyl)guanine (1) has been developed. The effect of the N²-amidine protection on the S-alkylation of 1 was studied.     

New Nucleoside Analogues for the Recognition of Pyrimidine-Purine Inversion Sites

Abstract

A new nucleoside designed to enhance triplex stability has been synthesised in 15 steps starting from sugar 2. This pathway contains the sugar derivative 9 which is a useful intermediate for the introduction of other natural and unnatural bases into the 2′-aminoethoxy nucleoside containing scaffold.     

A NEW CLASS OF BIHETEROCYCLIC THIOGLYCOSIDES FROM PYRIDINE-2-(1H)-THIONES

ABSTRACT

A reported method for preparation of a new class of biheterocyclic thioglycosides via reaction of pyridinethiones with 2,3,4,6-tetra- O -acetyl-α-D-gluco- and galactopyranosyl bromides has been studied.     

Phthaloyl Strategy—A New Approach Towards Oligodeoxyribonucleotide Synthesis

Abstract

A new rapid strategy for machine-aided oligodeoxyribonucleotide synthesis has been established utilizing phthaloyl groups for protection of the heterocyclic amino functions within the phosphoramidite approach. A large number of DNA-sequences has been synthesized. Due to high purity and speed of performance this strategy offers an excellent alternative to the common used acyl approach.     

Solution Phase Synthesis of Dithymidine Phosphorodithioate Using New S-Protecting Groups in Combination with a Chemoselective Coupling Reagent (PyNOP)

Abstract

ABSTRACT

A method for the synthesis of O-thymidin-3′-yl S-alkyl dithiophosphate monomers 1 with different S-protecting groups has been developed. These have been used for solution phase synthesis of dithymidine phosphorodithioate by a new phosphotriester method. Coupling reactions are fast (15 min.) and the products are free from phosphorothioate contaminations.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

A preliminary empirical model for studying plant productivity based on measurement of CO2 assimilation

Abstract

A preliminary model for estimating plant production on the basis of CO₂ absorption has been developed according to empirical equations defined by fitting data obtained by a portable IRGA. The model has been tested for four forage species in a grassland for which the productivity was estimated by a rotation-mowing method.     

A Monoclonal Antibody that Specifically Recognizes m'A Nucleoside

Abstract

A hybridoma against the nucleoside m⁶A has been obtained from mouse spleen. This hybridoma was named H65 and it secretes monoclonal antibodies anti-m⁶A. The competition assays showed that the monoclonal antibody was highly specific for m⁶A nucleoside.     

An Improved Post-Synthetic Substitution Approach for Synthesis of Oligodeoxynucleotides Containing Labile 4-Substituted Thymines

Abstract

A simple procedure is described for the preparation of a versatile oligodeoxynucleotide which contains 4-phenylthiothymidine. This versatile oligomer has been successfully used for synthesis of oligonucleotides containing labile 5-methyl-N⁴, N⁴-ethanocytosine (7) or 4-azido-5-methyl-2-pyrimidinone-1-β-(2′-deoxyriboside) (8).     

A Stereospecific Synthesis of Pyrimidine β-D-2′-Deoxyribonucleosides

Abstract

A stereospecific route for the synthesis of pyrimidine 2′-β-D-deoxyribonucleosides has been developed using suitably modified methyl 2-deoxy-D-ribofuranosides. The stereochemistry of the nucleoside bond is dictated by the chirality at C-4 of the pentofuranose. A novel palladium hydroxide catalyzed alcholysis of a nucleoside bond has been discovered. Preliminary studies of the mechanism and limitations of this reaction are described.     

Chemical Synthesis and Cloning of a Gene Coding for Bacillus Subjilis Hbsu Protein

Abstract

A gene coding for Bacillus subtilis non-specifically DNA-binding HBsu protein has been chemically synthesized and cloned. The gene was designed to permit expression of the encoded protein in several ways.     

High SLC7A11 expression in normal skin of melanoma patients

BackgroundMelanoma is one of the highest metastatic cancers and its incidence is rapidly increasing. A great effort has been devoted to determine gene mutations and expression profiles in melanoma cells, but less attention has been given to the possible influence of melanin synthesis in melanocytes on melanomagenesis. SLC7A11 encodes the cystine/glutamate antiporter xCT and its expression increases the antioxidant capacity of cells by providing cysteine that may be used for glutathione (GSH) synthesis. Melanocytes, however, can also use cysteine for pheomelanin synthesis and pigmentation. Therefore, pheomelanin synthesis may lead to chronic oxidative stress. Possible consequences of this for melanomagenesis have never been explored.MethodsWe quantified the expression of SLC7A11 and other genes that are involved in the synthesis of pheomelanin but do not regulate the transport of cysteine from the extracellular medium to the cytosol (CTNS, MC1R, ASIP and SLC45A2) in non-tumorous skin of 45 patients of cutaneous melanoma and 50 healthy individuals. We controlled for the effects of Fitzpatrick skin type, age, gender, body mass, frequency of sun exposure and sunburns and number of melanocytic nevi, as well as for the intrinsic antioxidant capacity as given by the expression of the gene NFE2L2.ResultsThe expression of SLC7A11, but not of the other genes, was significantly higher in melanoma patients than in healthy individuals. This was independent of phenotypic factors and antioxidant capacity, thus supporting an effect of pheomelanin-induced oxidative stress on melanomagenesis.ConclusionOur findings indicate that SLC7A11 downregulation in normal epidermal melanocytes may represent a preventive treatment against melanoma.     

Building Blocks for Synthesis of Oligoarabinonucleotides: Preparation of Arabinonucleoside H-Phosphonates from Protected Ribonucleosides

Abstract

A straightforward and inexpensive synthesis of arabinonucleoside H-phosphonates has been developed. Arabinonucleosides were synthesised from protected ribonucleosides via 2′-keto derivatives. Reaction conditions have been optimised for compounds bearing labile N-protections. Further protecting group manipulation and phosphonylation gave the required H-phosphonate monomers.     

Design,synthesis and biological activity of N4-phenylsubstituted-7H-pyrrolo[2,3-d]pyrimidin-4-amines as dual inhibitors of aurora kinase A and epidermal growth factor receptor kinase

Simultaneous inhibition of multiple kinases has been suggested to provide synergistic effects on inhibition of tumour growth and resistance. This study describes the design, synthesis and evaluation of 18 compounds incorporating a pyrrolo[2,3-d]pyrimidine scaffold for dual inhibition of epidermal growth factor receptor kinase (EGFR) and aurora kinase A (AURKA). Compounds 1–18 of this study demonstrate nanomolar inhibition of EGFR and micromolar inhibition of AURKA. Compounds 1–18 allow for a structure–activity relationships (SAR) analysis of the 4-anilino moiety for dual EGFR and AURKA inhibition. Compound 6, a 4-methoxyphenylpyrrolo[2,3-d]pyrimidin-4-amine, demonstrates single-digit micromolar inhibition of both AURKA and EGFR and provides evidence of a single molecule with dual activity against EGFR and AURKA. Compound 2, the most potent inhibitor of EGFR and AURKA from this series, has been further evaluated in four different squamous cell head and neck cancer cell lines for downstream effects resulting from AURKA and EGFR inhibition.     

Japan Wine,its characteristics and research

ABSTRACT

A new rule stipulates that wine made in Japan from grapes harvested in Japan be labeled as “Japan wine”. The main grape varieties for Japan Wine, Koshu for white wine and Muscat Bailey A for red, are unique to Japan. Koshu is native to Japan and its origin, long unknown, has recently been revealed through DNA analysis. Wine made from this variety suffered from a lack of characteristic aroma, but a recent study has demonstrated its potential for producing wine with a citrus scent. Muscat Bailey A was bred in Japan. Its characteristic sweet aroma has been identified as being due to furaneol. Another characteristic of its wine is that it has a low concentration of proanthocyanidins (condensed tannin), and the reason for this was revealed recently. These and other studies have been conducted in wine companies, universities, and research institutes in Japan and support the development of Japan Wine.

Abbreviations: SSR: simple sequence repeat; SNP: single nucleotide polymorphism; 3MH: 3-mercaptohexan-1-ol; 4-HDMF: 4-hydroxy-2,5-dimethyl-3(2H)-furanone; PCA: principal component analysis     

Synthetic Approaches to 5:8-Fused Heterocyclic Systems. A Novel Rearrangement During the Synthesis of Imidazo[4,5-e][1,2,4]triazocine Ring System

Abstract

The attempted ring-closure of 4-amino-1-benzyl-5-[(N²-benzyl-N²-methoxy-carbonyl)hydrazinomethylenecarbonyl]imidazole (5b) in sodium hydride/dimethyl sulfoxide at 50–60 °C afforded 1,7-dibenzylxanthine (6) instead of the anticipated 5:8-fused heterocycle 4b. A tentative reaction pathway has been proposed for the observed transformation.