An NMR and mutational study of the pseudoknot within the gene 32 mRNA of bacteriophage T2: insights into a family of structurally related RNA pseudoknots.

NMR methods were used to investigate a series of mutants of the pseudoknot within the gene 32 messenger RNA of bacteriophage T2, for the purpose of investigating the range of sequences, stem and loop lengths that can form a similar pseudoknot structure. This information is of particular relevance since the T2 pseudoknot has been considered a representative of a large family of RNA pseudoknots related by a common structural motif, previously referred to as 'common pseudoknot motif 1' or CPK1. In the work presented here, a mutated sequence with the potential to form a pseudoknot with a 6 bp stem2 was shown to adopt a pseudoknot structure similar to that of the wild-type sequence. This result is significant in that it demonstrates that pseudoknots with 6 bp in stem2 and a single nucleotide in loop1 are indeed feasible. Mutated sequences with the potential to form pseudoknots with either 5 or 8 bp in stem2 yielded NMR spectra that could not confirm the formation of a pseudoknot structure. Replacing the adenosine nucleotide in loop1 of the wild-type pseudoknot with any one of G, C or U did not significantly alter the pseudoknot structure. Taken together, the results of this study provide support for the existence of a family of similarly structured pseudoknots with two coaxially stacked stems, either 6 or 7 bp in stem2, and a single nucleotide in loop1. This family includes many of the pseudoknots predicted to occur downstream of the frameshift or readthrough sites in a significant number of viral RNAs.     

An NMR and mutational analysis of an RNA pseudoknot of Escherichia coli tmRNA involved in trans-translation.

Transfer-messenger RNA (tmRNA) is a unique molecule that combines properties from both tRNA and mRNA, and facilitates a novel translation reaction termed trans -translation. According to phylogenetic sequence analysis among various bacteria and chemical probing analysis, the secondary structure of the 350-400 nt RNA is commonly characterized by a tRNA-like structure, and four pseudoknots with different sizes. A mutational analysis using a number of Escherichia coli tmRNA variants as well as a chemical probing analysis has recently demonstrated not only the presence of the smallest pseudoknot, PK1, upstream of the internal coding region, but also its direct implication in trans -translation. Here, NMR methods were used to investigate the structure of the 31 nt pseudoknot PK1 and its 11 mutants in which nucleotide substitutions are introduced into each of two stems or the linking loops. NMR results provide evidence that the PK1 RNA is folded into a pseudoknot structure in the presence of Mg(2+). Imino proton resonances were observed consistent with formation of two helical stem regions and these stems stacked to each other as often seen in pseudoknot structures, in spite of the existence of three intervening nucleo-tides, loop 3, between the stems. Structural instability of the pseudoknot structure, even in the presence of Mg(2+), was found in the PK1 mutants except in the loop 3 mutants which still maintained the pseudoknot folding. These results together with their biological activities indicate that trans -translation requires the pseudoknot structure stabilized by Mg(2+)and specific residues G61 and G62 in loop 3.     

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.     

Solution structure of the pseudoknot of SRV-1 RNA, involved in ribosomal frameshifting

RNA pseudoknots play important roles in many biological processes. In the simian retrovirus type-1 (SRV-1) a pseudoknot together with a heptanucleotide slippery sequence are responsible for programmed ribosomal frameshifting, a translational recoding mechanism used to control expression of the Gag-Pol polyprotein from overlapping gag and pol open reading frames. Here we present the three-dimensional structure of the SRV-1 pseudoknot determined by NMR. The structure has a classical H-type fold and forms a triple helix by interactions between loop 2 and the minor groove of stem 1 involving base-base and base-sugar interactions and a ribose zipper motif, not identified in pseudoknots so far. Further stabilization is provided by a stack of five adenine bases and a uracil in loop 2, enforcing a cytidine to bulge. The two stems of the pseudoknot stack upon each other, demonstrating that a pseudoknot without an intercalated base at the junction can induce efficient frameshifting. Results of mutagenesis data are explained in context with the present three-dimensional structure. The two base-pairs at the junction of stem 1 and 2 have a helical twist of approximately 49 degrees, allowing proper alignment and close approach of the three different strands at the junction. In addition to the overwound junction the structure is somewhat kinked between stem 1 and 2, assisting the single adenosine in spanning the major groove of stem 2. Geometrical models are presented that reveal the importance of the magnitude of the helical twist at the junction in determining the overall architecture of classical pseudoknots, in particular related to the opening of the minor groove of stem 1 and the orientation of stem 2, which determines the number of loop 1 nucleotides that span its major groove.     

The frameshift stimulatory signal of human immunodeficiency virus type 1 group O is a pseudoknot

Human immunodeficiency virus type 1 (HIV-1) requires a programmed -1 ribosomal frameshift to produce Gag-Pol, the precursor of its enzymatic activities. This frameshift occurs at a slippery sequence on the viral messenger RNA and is stimulated by a specific structure, downstream of the shift site. While in group M, the most abundant HIV-1 group, the frameshift stimulatory signal is an extended bulged stem-loop, we show here, using a combination of mutagenesis and probing studies, that it is a pseudoknot in group O. The mutagenesis and probing studies coupled to an in silico analysis show that group O pseudoknot is a hairpin-type pseudoknot with two coaxially stacked stems of eight base-pairs (stem 1 and stem 2), connected by single-stranded loops of 2nt (loop 1) and 20nt (loop 2). Mutations impairing formation of stem 1 or stem 2 of the pseudoknot reduce frameshift efficiency, whereas compensatory changes that allow re-formation of these stems restore the frameshift efficiency to near wild-type level. The difference between the frameshift stimulatory signal of group O and group M supports the hypothesis that these groups originate from a different monkey to human transmission.     

Mutational analysis of the RNA pseudoknot involved in efficient ribosomal frameshifting in simian retrovirus-1.

Mutational effects on frameshifting efficiency of the RNA pseudoknot involved in ribosomal frameshifting in simian retrovirus-1 (SRV-1) have been investigated. The primary sequence and the proposed secondary structure of the SRV-1 pseudoknot are similar to those of other efficient frameshifting pseudoknots in mouse mammary tumor virus (MMTV) and feline immunodeficiency virus (FIV), where an unpaired adenine nucleotide intercalates between stem 1 and stem 2. In SRV-1 pseudoknot, the adenine nucleotide in between stem 1 and stem 2 has a potential to form an A*U base pair with the last uridine nucleotide in the loop 2, resulting in a continuous A-form helix with coaxially stacked stem 1 and stem 2. To test whether this A*U base pairing and coaxial stacking of stem 1 and stem 2 is absolutely required for efficient frameshifting in SRV-1, a series of mutants changing this potential A.U base pair to either G.C base pair or A.A, A.G, A.C, G.A, G.G mismatch is generated, and their frameshifting efficiencies are investigated in vitro using rabbit reticulocyte lysate translation assay. The frameshifting abilities of these mutant pseudoknots are similar to that of the wild-type pseudoknot, suggesting that the A*U base pair in between stem 1 and stem 2 is not necessary to promote efficient frameshifting in SRV-1. These results reveal that coaxial stacking of stem 1 and stem 2 with a Watson-Crick A.U base pair in between two stems is not a required structural feature of the pseudoknot for promoting efficient frameshifting in SRV-1. Our mutational data suggest that SRV-1 pseudoknot adopts similar structural features common to other efficient frameshifting pseudoknots as observed in MMTV and FIV.     

Equilibrium unfolding pathway of an H-type RNA pseudoknot which promotes programmed -1 ribosomal frameshifting.

The equilibrium unfolding pathway of a 41-nucleotide frameshifting RNA pseudoknot from the gag-pro junction of mouse intracisternal A-type particles (mIAP), an endogenous retrovirus, has been determined through analysis of dual optical wavelength, equilibrium thermal melting profiles and differential scanning calorimetry. The mIAP pseudoknot is an H-type pseudoknot proposed to have structural features in common with the gag-pro frameshifting pseudoknots from simian retrovirus-1 (SRV-1) and mouse mammary tumor virus (MMTV). In particular, the mIAP pseudoknot is proposed to contain an unpaired adenosine base at the junction of the two helical stems (A15), as well as one in the middle of stem 2 (A35). A mutational analysis of stem 1 hairpins and compensatory base-pair substitutions incorporated into helical stem 2 was used to assign optical melting transitions to molecular unfolding events. The optical melting profile of the wild-type RNA is most simply described by four sequential two-state unfolding transitions. Stem 2 melts first in two closely coupled low-enthalpy transitions at low tmin which the stem 3' to A35, unfolds first, followed by unfolding of the remainder of the helical stem. The third unfolding transition is associated with some type of stacking interactions in the stem 1 hairpin loop not present in the pseudoknot. The fourth transition is assigned to unfolding of stem 1. In all RNAs investigated, DeltaHvH approximately DeltaHcal, suggesting that DeltaCpfor unfolding is small. A35 has the thermodynamic properties expected for an extrahelical, unpaired nucleotide. Deletion of A15 destabilizes the stem 2 unfolding transition in the context of both the wild-type and DeltaA35 mutant RNAs only slightly, by DeltaDeltaG degrees approximately 1 kcal mol-1(at 37 degrees C). The DeltaA15 RNA is considerably more susceptible to thermal denaturation in the presence of moderate urea concentrations than is the wild-type RNA, further evidence of a detectable global destabilization of the molecule. Interestingly, substitution of the nine loop 2 nucleotides with uridine residues induces a more pronounced destabilization of the molecule (DeltaDeltaG degrees approximately 2.0 kcal mol-1), a long-range, non-nearest neighbor effect. These findings provide the thermodynamic basis with which to further refine the relationship between efficient ribosomal frameshifting and pseudoknot structure and stability.     

A Characteristic Bent Conformation of RNA Pseudoknots Promotes –1 Frameshifting during Translation of Retroviral RNA

The structures of four different RNA pseudoknots that provide one of the signals required for ribosomal frameshifting in mouse mammary tumor virus have been determined by NMR. The RNA pseudoknots have similar sequences and assume similar secondary structures, but show significantly different frameshifting efficiencies. The three-dimensional structures of one frameshifting and one non-frameshifting RNA pseudoknot had been determined previously by our group. Here we determine the structures of two new RNA pseudoknots, and relate the structures of all four pseudoknots to their frameshifting abilities. The two efficient frameshifting pseudoknots adopt characteristic bent conformations with stem 1 bending towards the major groove of stem 2. In contrast, the two poor frameshifting pseudoknots have structures very different from each other and from the efficient frameshifters. One has linear, coaxially stacked stems, the other has stems twisted and bent, but in the opposite direction to the efficient frameshifters. Changes in loop size that favor bending (shorter loops) increase frameshifting efficiency; longer loops that allow linear arrangement of the stems decrease frameshifting. Frameshifting pseudoknots in feline immunodeficiency virus and simian retrovirus have different loop sequences, but the sequences at their stem junctions imply the same bent conformation as in the mouse mammary tumor viral RNA. The requirement for a precise pseudoknot conformation for efficient frameshifting strongly implies that a specific interaction occurs between the viral RNA pseudoknot and the host protein-synthesizing machinery.     

The stimulatory RNA of the Visna-Maedi retrovirus ribosomal frameshifting signal is an unusual pseudoknot with an interstem element

The stimulatory RNA of the Visna-Maedi virus (VMV) -1 ribosomal frameshifting signal has not previously been characterized but can be modeled either as a two-stem helix, reminiscent of the HIV-1 frameshift-stimulatory RNA, or as an RNA pseudoknot. The pseudoknot is unusual in that it would include a 7 nucleotide loop (termed here an interstem element [ISE]) between the two stems. In almost all frameshift-promoting pseudoknots, ISEs are absent or comprise a single adenosine residue. Using a combination of RNA structure probing, site directed mutagenesis, NMR, and phylogenetic sequence comparisons, we show here that the VMV stimulatory RNA is indeed a pseudoknot, conforming closely to the modeled structure, and that the ISE is essential for frameshifting. Pseudoknot function was predictably sensitive to changes in the length of the ISE, yet altering its sequence to alternate pyrimidine/purine bases was also detrimental to frameshifting, perhaps through modulation of local tertiary interactions. How the ISE is placed in the context of an appropriate helical junction conformation is not known, but its presence impacts on other elements of the pseudoknot, for example, the necessity for a longer than expected loop 1. This may be required to accommodate an increased flexibility of the pseudoknot brought about by the ISE. In support of this, (1)H NMR analysis at increasing temperatures revealed that stem 2 of the VMV pseudoknot is more labile than stem 1, perhaps as a consequence of its connection to stem 1 solely via flexible single-stranded loops.     

Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.     

A mutant RNA pseudoknot that promotes ribosomal frameshifting in mouse mammary tumor virus.

A single A-->G mutation that changes a potential A.U base pair to a G.U pair at the junction of the stems and loops of a non-frameshifting pseudoknot dramatically increases its frameshifting efficiency in mouse mammary tumor virus. The structure of the non-frameshifting pseudoknot APK has been found to be very different from that of pseudoknots that cause efficient frameshifting [Kang,H., Hines,J.V. and Tinoco,I. (1995) J. Mol. Biol. , 259, 135-147]. The 3-dimensional structure of the mutant pseudoknot was determined by restrained molecular dynamics based on NMR-derived interproton distance and torsion angle constraints. One striking feature of the mutant pseudoknot compared with the parent pseudoknot is that a G.U base pair forms at the top of stem 2, thus leaving only 1 nt at the junction of the two stems. The conformation is very different from that of the previously determined non-frameshifting parent pseudoknot, which lacks the A.U base pair at the top of the stem and has 2 nt between the stems. However, the conformation is quite similar to that of efficient frameshifting pseudoknots whose structures were previously determined by NMR. A single adenylate residue intervenes between the two stems and interrupts their coaxial stacking. This unpaired nucleotide produces a bent structure. The structural similarity among the efficient frameshifting pseudoknots indicates that a specific conformation is required for ribosomal frameshifting, further implying a specific interaction of the pseudoknot with the ribosome.     

Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those pseudoknots with a short loop 2.     

Conformational analysis of the telomerase RNA pseudoknot hairpin by Raman spectroscopy

We have measured the temperature-dependent Raman spectra of two 30-mer ribonucleotides that represent the wild-type (WT) and dyskeratosis congenita (DKC) mutant (MT) GC (107-108) --> AG structures of the pseudoknot hairpin region of human telomerase RNA. We have used these structures, previously characterized by UV-melting and NMR, as a model system for our Raman investigation. We observe that Raman hypochromism of vibrational bands, previously assigned to specific bases or conformational RNA markers, reflect temperature-dependent alterations in the pentaloop and stem structures of these two oligonucleotides. We also observe that the intense nu(s)(O-P-O) band at 812 cm(-1) indicates the presence of A-form backbone structure at relatively low temperatures in both the WT and MT RNA sequences. The mutation induces a decrease in the intensity of the uridine (rU) band at 1244 cm(-1) associated with C2'-endo/anti ribose conformation in the pentaloop. Two transition temperatures (T(m) ) were determined from the analysis of Raman difference intensity-temperature profiles of the 1256 cm(-1) band, which is associated with vibrations of cytidine (rC) residues, in particular, the C2'-endo/anti ribose conformation (T(m) 1 = 23.6 +/- 1.6 degrees C for WT and 19.7 +/- 2.8 degrees C for MT; T(m) 2 = 68.9 +/- 1.8 degrees C for WT and 70.9 +/- 1.1 degrees C for MT). From these results we can conclude that the DKC mutant 30-mer exhibits a lower stability in the pentaloop region and a slightly higher stability in the stem region than the WT 30-mer. This demonstrates that Raman bands, previously assigned to specific bases or conformational RNA markers, can be used to probe local structural features of the telomerase pseudoknot hairpin sequence.     

Untying the FIV frameshifting pseudoknot structure by MS3D

The structure of the putative feline immunodeficiency virus (FIV) ribosomal frameshifting pseudoknot (PK) has been investigated by a mass spectrometric three-dimensional (MS3D) approach, which involves the application of established solvent-accessibility probes and chemical crosslinkers with detection by electrospray ionization (ESI) Fourier transform mass spectrometry (FTMS). Regardless of their size, probed substrates can be treated with ribonucleases and analyzed by ESI-FTMS to obtain the correct position of chemically modified nucleotides. Protection maps and distance information can be utilized to generate 3D models using the constraint satisfaction algorithm provided by MC-SYM and the energy minimization modules included in CNS. Control experiments were performed on a mutant of mouse mammary tumor virus pseudoknot (VPK), for which an NMR structure is available. Comparison between the MS3D model and the high-resolution structure provided a approximately 3A root-mean-square deviation calculated from all the atoms present in double-stranded regions. Applied to FIV-PK, the MS3D approach confirmed that the selected sequence could fold into an actual pseudoknot, supporting the sequence alignment predictions. Characteristic features of H-type pseudoknots were recognized immediately, but a putative A13-U30 pair was not observed at the stem junction, making FIV-PK resemble VPK more closely than the initially suggested simian retrovirus type-1 pseudoknot. In our model, the unpaired U30 protrudes into the medium, while the hinging A13 assumes a stacked conformation that enables the stems to form a approximately 60 degrees bend and relieve the strain caused by a short loop 1. The model provided the basis to explain the different alkylation patterns observed in the absence and presence of Mg(2+), suggesting the possible formation of a specific metal-binding site between loop 1 and stem 2. This instance illustrates how the MS3D model of FIV-PK can be utilized effectively to generate hypotheses and support functional observations in the absence of a high-resolution structure.     

Solution structure of a luteoviral P1-P2 frameshifting mRNA pseudoknot

A hairpin-type messenger RNA pseudoknot from pea enation mosaic virus RNA1 (PEMV-1) regulates the efficiency of programmed -1 ribosomal frameshifting. The solution structure and 15N relaxation rates reveal that the PEMV-1 pseudoknot is a compact-folded structure composed almost entirely of RNA triple helix. A three nucleotide reverse turn in loop 1 positions a protonated cytidine, C(10), in the correct orientation to form an A((n-1)).C(+).G-C(n) major groove base quadruple, like that found in the beet western yellows virus pseudoknot and the hepatitis delta virus ribozyme, despite distinct structural contexts. A novel loop 2-loop 1 A.U Hoogsteen base-pair stacks on the C(10)(+).G(28) base-pair of the A(12).C(10)(+).G(28)-C(13) quadruple and forms a wedge between the pseudoknot stems stabilizing a bent and over-rotated global conformation. Substitution of key nucleotides that stabilize the unique conformation of the PEMV-1 pseudoknot greatly reduces ribosomal frameshifting efficacy.     

An intermolecular RNA triplex provides insight into structural determinants for the pseudoknot stimulator of ?1 ribosomal frameshifting

An efficient −1 programmed ribosomal frameshifting (PRF) signal requires an RNA slippery sequence and a downstream RNA stimulator, and the hairpin-type pseudoknot is the most common stimulator. However, a pseudoknot is not sufficient to promote −1 PRF. hTPK-DU177, a pseudoknot derived from human telomerase RNA, shares structural similarities with several −1 PRF pseudoknots and is used to dissect the roles of distinct structural features in the stimulator of −1 PRF. Structure-based mutagenesis on hTPK-DU177 reveals that the −1 PRF efficiency of this stimulator can be modulated by sequential removal of base–triple interactions surrounding the helical junction. Further analysis of the junction-flanking base triples indicates that specific stem–loop interactions and their relative positions to the helical junction play crucial roles for the −1 PRF activity of this pseudoknot. Intriguingly, a bimolecular pseudoknot approach based on hTPK-DU177 reveals that continuing triplex structure spanning the helical junction, lacking one of the loop-closure features embedded in pseudoknot topology, can stimulate −1 PRF. Therefore, the triplex structure is an essential determinant for the DU177 pseudoknot to stimulate −1 PRF. Furthermore, it suggests that −1 PRF, induced by an in-trans RNA via specific base–triple interactions with messenger RNAs, can be a plausible regulatory function for non-coding RNAs.     

The role of RNA pseudoknot stem 1 length in the promotion of efficient -1 ribosomal frameshifting.

The ribosomal frameshifting signal present in the genomic RNA of the coronavirus infectious bronchitis virus (IBV) contains a classic hairpin-type RNA pseudoknot that is believed to possess coaxially stacked stems of 11 bp (stem 1) and 6 bp (stem 2). We investigated the influence of stem 1 length on the frameshift process by measuring the frameshift efficiency in vitro of a series of IBV-based pseudoknots whose stem 1 length was varied from 4 to 13 bp in single base-pair increments. Efficient frameshifting depended upon the presence of a minimum of 11 bp; pseudoknots with a shorter stem 1 were either non-functional or had reduced frameshift efficiency, despite the fact that a number of them had a stem 1 with a predicted stability equal to or greater than that of the wild-type IBV pseudoknot. An upper limit for stem 1 length was not determined, but pseudoknots containing a 12 or 13 bp stem 1 were fully functional. Structure probing analysis was carried out on RNAs containing either a ten or 11 bp stem 1; these experiments confirmed that both RNAs formed pseudoknots and appeared to be indistinguishable in conformation. Thus the difference in frameshifting efficiency seen with the two structures was not simply due to an inability of the 10 bp stem 1 construct to fold into a pseudoknot. In an attempt to identify other parameters which could account for the poor functionality of the shorter stem 1-containing pseudoknots, we investigated, in the context of the 10 bp stem 1 construct, the influence on frameshifting of altering the slippery sequence-pseudoknot spacing distance, loop 2 length, and the number of G residues at the bottom of the 5'-arm of stem 1. For each parameter, it was possible to find a condition where a modest stimulation of frameshifting was observable (about twofold, from seven to a maximal 17 %), but we were unable to find a situation where frameshifting approached the levels seen with 11 bp stem 1 constructs (48-57 %). Furthermore, in the next smaller construct (9 bp stem 1), changing the bottom four base-pairs to G.C (the optimal base composition) only stimulated frameshifting from 3 to 6 %, an efficiency about tenfold lower than seen with the 11 bp construct. Thus stem 1 length is a major factor in determining the functionality of this class of pseudoknot and this has implications for models of the frameshift process.     

The impact of dyskeratosis congenita mutations on the structure and dynamics of the human telomerase RNA pseudoknot domain

The pseudoknot domain is a functionally crucial part of telomerase RNA and influences the activity and stability of the ribonucleoprotein complex. Autosomal dominant dyskeratosis congenita (DKC) is an inherited disease that is linked to mutations in telomerase RNA and impairs telomerase function. In this paper, we present a computational prediction of the influence of two base DKC mutations on the structure, dynamics, and stability of the pseudoknot domain. We use molecular dynamics simulations, MM-GBSA free energy calculations, static analysis, and melting simulations analysis. Our results show that the DKC mutations stabilize the hairpin form and destabilize the pseudoknot form of telomerase RNA. Moreover, the P3 region of the predicted DKC-mutated pseudoknot structure is unstable and fails to form as a defined helical stem. We directly compare our predictions with experimental observations by calculating the enthalpy of folding and melting profiles for each structure. The enthalpy values are in very good agreement with values determined by thermal denaturation experiments. The melting simulations and simulations at elevated temperatures show the existence of an intermediate structure, which involves the formation of two UU base pairs observed in the hairpin form of the pseudoknot domain.     

A procedure for RNA pseudoknot prediction

The RNA pseudoknot has been proposed as a significant structuralmotif in a wide range of biological processes of RNAs. A pseudoknotinvolves intramolecular pairing of bases in a hairpin loop withbases outside the stem of the loop to form a second stem andloop region. In this study, we propose a method for searchingand predicting pseudoknots that are likely to have functionalmeaning. In our procedure, the orthodox hairpin structure involvedin the pseudoknot is required to be both statistically significantand relatively stable to the others in the sequence. The basesoutside the stem of the hairpin loop in the predicted pseudoknotare not entangled with any formation of a highly stable secondarystructure in the sequence. Also, the predicted pseudoknot issignificantly more stable than those that can be formed froma large set of scrambled sequences under the assumption thatthe energy contribution from a pseudoknot is proportional tothe size of second loop region and planar energy contributionfrom second stem region. A number of functional pseudoknotsthat have been reported before can be identified and predictedfrom their sequences by our method.     

Thermodynamic characterization of the Saccharomyces cerevisiae telomerase RNA pseudoknot domain in vitro

Recent structural and functional characterization of the pseudoknot in the Saccharomyces cerevisiae telomerase RNA (TLC1) has demonstrated that tertiary structure is present, similar to that previously described for the human and Kluyveromyces lactis telomerase RNAs. In order to biophysically characterize the identified pseudoknot secondary and tertiary structures, UV-monitored thermal denaturation experiments, nuclear magnetic resonance spectroscopy, and native gel electrophoresis were used to investigate various potential conformations in the pseudoknot domain in vitro, in the absence of the telomerase protein. Here, we demonstrate that alternative secondary structures are not mutually exclusive in the S. cerevisiae telomerase RNA, tertiary structure contributes 1.5 kcal mol(-1) to the stability of the pseudoknot (≈ half the stability observed for the human telomerase pseudoknot), and identify additional base pairs in the 3' pseudoknot stem near the helical junction. In addition, sequence conservation in an adjacent overlapping hairpin appears to prevent dimerization and alternative conformations in the context of the entire pseudoknot-containing region. Thus, this work provides a detailed in vitro characterization of the thermodynamic features of the S. cerevisiae TLC1 pseudoknot region for comparison with other telomerase RNA pseudoknots.