Immunohistochemical study on oxytocin-like substance in the human placenta

Our previous studies have demonstrated that a large quantity of oxytocin (OT)-like substance exists in human placental tissue. In the present study, the localization of the OT-like substance in the human placenta was investigated by the PAP (peroxidase and antiperoxidase complex) immunohistochemical method. The results demonstrated that the site of syncytiotrophoblast was positively stained by specific antiserum to OT, whereas the tissue was not significantly stained by normal rabbit serum (NRS). These results suggest that the OT-like substance might be localized in syncytiotrophoblast of the placental tissue.     

Hormone activity of a synthetic decapeptide with the adrenocorticotropin-like sequence of human immunoglobulin G1

The antiproliferative and immunosuppressivein vitro effects ofimmunocortin, a synthetic adrenocorticotropin-like (ACTH-like) decapeptide H-Val-Lys-Lys-Pro-Gly-Ser-Ser-Val-Lys-Val-OH, whose sequence corresponds to segment 11–20 of the variable part of the human IgG1 heavy chain, were studied. At concentrations of 10⁻¹¹−10⁻⁷ M, immunocortin was found to inhibit the growth of the human MT-4 T-lymphoblastoid cell line, to suppress the blast transformation of thymocytes, and to decrease the spontaneous mobility of peritoneal macrophages and their bactericidal action toward the virulent strainSalmonella typhimurium 415. By using a¹²⁵I-labeled “addressing” fragment of ACTH {[¹²⁵I]ACTH (13–24)}, we showed that MT-4 cells express specific receptors for ACTH (K _d 97 pM). Immunocortin and human ACTH (but not the heavy chain of IgG1) competitively inhibited the binding of [¹²⁵I]ACTH-(13–24) to these receptors withK _i1 of 0.38 andK _i2 of 0.34 nM, respectively. Specific receptors for ACTH (K _d 5.8 nM) on mouse thymocytes were detected and characterized. The unlabeled immunocortin was shown to compete with labeled ACTH-(13–24) for binding to these receptors (K _i=1.8 nM), and this binding of immunocortin to receptors on thymocytes activates adenylate cyclase from these cells and increases the intracellular concentration of cAMP.     

Uptake of 125I-labelled α2-macroglobulin and albumin by human placental syncytiotrophoblast in vitro

We have investigated the binding and internalization of α₂-macroglobulin and serum albumin by human placental syncytiotrophoblast cells in vitro. The time course (obtained at 4°C) of α₂-macroglobulin binding indicated that an equilibrium was reached after 4 h. The binding of ¹²⁵I-labelled α₂-macroglobulin to syncytiotrophoblast cells was competitively reduced in the presence of excess unlabelled α₂-macroglobulin. When the concentration-dependence of binding was examined over a wide concentration range, non-linear regression analysis yielded a K_d of 6.4 nM. In the case of albumin, binding was weak and ligand dissociated from the cell surface during aqueous washing making it impractical to analyze the binding reaction. In other experiments, syncytiotrophoblast cells were incubated with ¹²⁵I-labelled α₂-macroglobulin at 37°C. Under these conditions, trypsin-resistant cell-associated radioactivity increased with time consistent with ligand internalization. ¹²⁵I-Labelled-ligand was internalized with a t_1/2 of about 5 min. After a lag period some radioactivity was released back into the incubation medium. When measured at times up to 210 min, this was found to consist of mostly TCA-precipitable material that had been lost from the cell surface. However, when the incubation was extended to 24 h, almost 15% of the initial cell-associated radioactivity was released to the extracellular medium as TCA-soluble material, consistent with a slow rate of ligand degradation. The specific binding of ⁶⁵Zn-labelled α₂M was similar to that of the ¹²⁵I-labelled ligand and trypsin-resistance measurements provided evidence of α₂M-mediated ⁶⁵Zn uptake. These results support a role for syncytiotrophoblast in the metabolism of α₂-macroglobulin during pregnancy and are also consistent with a role for α₂-macroglobulin in the maternal-fetal transport of zinc. J. Cell. Biochem. 68:427–435, 1998. © 1998 Wiley-Liss, Inc.     

On the application of the unlabelled peroxidase-antiperoxidase method to the investigations of the nervous tissue

The unlabelled peroxidase-antiperoxidase (PAP) method was applied to the nervous tissue, to investigate whether there are cells which show the localisation of immunoglobulins of IgG, IgA and IgM type. The experiments performed have shown no positive reaction with the PAP method in normal brain tissue. In tumor tissue some cells, rich in cytoplasm of gemistocyte-like appearance or reactive astrocytes stained positively with the PAP method. The reliablility and specificity of the reaction is discussed.     

Immunohistochemical aspects of immunological cross-reaction and masking of epitopes for localization studies on pregnancy-associated plasma protein A

Summary The influence of antibody absorption procedures and proteolytic pre-treatment of formaldehyde-fixed placental tissue on the localization of pregnancy-associated plasma protein A by immunoperoxidase technique was examined.Apparently monospecific IgG fraction of the anti-plasma protein applied directly on fixed tissue resulted in staining of connective tissue and a thin apical rim of the syncytiotrophoblast. Further absorption of the antibody with foetal connective tissue abolished this staining reaction. Pre-treatment of the fixed placental tissue with trypsin prior to application of the antibody, which had been absorbed with connective tissue, resulted in staining within the cytoplasm of the syncytiotrophoblast exclusively. Identical staining was seen when this IgG preparation was used directly on frozen placental tissue.The results point to the importance of the specificity of the antibody preparations and of proteolytic unmasking of epitopes when fixed tissues are used for localization studies of pregnancy-associated plasma protein A by immunoperoxidase technique.     

Hydroxamate-activated peroxidases in potato tuber callus. Interaction with the determination of the cytochrome and the alternative pathways

In potato (Solatium tuberosum L. cv. Bintje and Doré) callus a very active hydrox-amate-stimulated NADH-dependent O₂-uptake develops during the growth of the callus, which is caused by a peroxidase. More than 95% of the peroxidase activity is found in the 40000 g supernatant. The total activity may be as high as 1000 times the respiratory acitivity of the callus tissue. At least two fractions, obtained by Sephadex gel filtration, can be distinguished showing this peroxidase activity, one of about 15 kDa and one > 50 kDa. The main properties of both fractions are: a) Hydroxamate at 0.2–0.5 mM gives half-maximal stimulation. Maximal stimulation is observed with 1–3 mM benzhydroxamate (BHAM) and 1–15 mM salicylhydroxamate (SHAM). Higher concentrations, especially of BHAM, give less or no stimulation. b) Hydroxamates are not consumed during the reaction. c) Both NADH and NADPH can serve as the electron donor for the reaction. The affinity for NAD(P)H is very low (K_m near 10 mM). In the absence of hydroxamates NAD(P)H is only slowly oxidized, with an even lower affinity. d) The peroxidase can carry out two reactions: an O₂-consuming and a H₂O₂-consuming reaction. In both reactions one NAD(P)H is consumed. In the first reaction H₂O₂ is formed which can be consumed in the second reaction, resulting in an overall stoichiometry of 2 NADH consumed for each O₂ molecule and in the production of H₂O. e) The reaction is completely blocked by cyanide, superoxide dismutase (EC 1.15.1.1) and (excess) catalase (EC 1.11.1.6), but not by antimycin A or azide. This peroxidase-mediated O₂-uptake might interfere with respiratory measurements. In experiments with isolated mitochondria this interference can be prevented by the addition of catalase to the reaction mixture. The use of high concentrations of hydroxamate is not allowed because of inhibitory effects on the cytochrome pathway. In intact callus tissue hydroxamates only stimulate O₂-uptake in the presence of exogenous NADH. In vivo the peroxidase does not appear to function in O₂-uptake, probably because of its localization (at least partly in the cell wall) and/or its low affinity for NADH. The use of hydroxamates in the determination of cytochrome and alternative pathway activity is discussed.     

Purification and partial characterization of an arginine binding molecule from human placenta

A binding molecule for L-arginine has been isolated from human placental membranes and partially characterized. It exhibits specificity for L-arginine almost exclusively with no apparent cooperativity of binding as seen by Scatchard analysis (K_d = 0.36nM). Enzymatic probes indicate a molecule containing important carbohydrate and lipid moieties.     

Adenosine transport and nitrobenzylthioinosine binding in human placental membrane vesicles from brush-border and basal sides of the trophoblast

Summary The nucleoside transport activity of human placental syncytiotrophoblast brush-border and basal membrane vesicles was compared. Adenosine and uridine were taken up into an osmotically active space. Adenosine was rapidly metabolized to inosine, metabolism was blocked by preincubating vesicles with 2-deoxycoformycin, and subsequent adenosine uptake studies were performed in the presence of 2-deoxycoformycin. Adenosine influx by brush-border membrane vesicles was fitted to a two-component system consisting of a saturable system with apparent Michaelis-Menten kinetics (apparentK _m approx. 150 m) and a linear component. Adenosine uptake by the saturable system was blocked by nitrobenzylthioinosine (NBMPR), dilazep, dipyridamole and other nucleosides. Inhibition by NBMPR was associated with high-affinity binding of NBMPR to the brush-border membrane vesicles (apparentK _d 0.98±0.21nm). Binding of NBMPR to these sites was blocked by adenosine, inosine, uridine, thymidine, dilazep and dipyridamole, and the respective apparentK _i values were 0.23±0.012, 0.36±0.035, 0.78±0.1, 0.70±0.12 (mm), and 0.12 and 4.2±1.4 (nm). In contrast, adenosine influx by basal membrane vesicles was low (less than 10% of the rate observed with brush-border membrane vesicles under similar conditions), and hence no quantitative studies of adenosine uptake could be performed with these vesicles. Nevertheless, high-affinity NBMPR binding sites were demonstrated in basal membrane vesicles with similar properties to those in brushborder membrane vesicles (apparentK _d 1.05±0.13nM and apparentK _i values for adenosine, inosine, uridine, thymidine, dilazep and dipyridamole of 0.14±0.045, 0.54±0.046, 1.26±0.20, 1.09±0.18mm and 0.14 and 3.7±0.5nm, respectively). Exposure of both membrane vesicles to UV light in the presence of [³H]NBMPR resulted in covalent labeling of a membrane protein(s) with a broad apparentM _r on SDS gel electropherograms of 77,000–45,000, similar to that previously reported for many other tissues, including human erythrocytes. We conclude that the maternal (brush-border) and fetal (basal) surface of the human placental syncytiotrophoblast posses broad-specificity, facilitated-diffusion, NBMPR-sensitive nucleoside transporters.     

The Interaction of Synthetic Decapeptide SLTCLVKGFY with Human T Lymphocytes

The synthetic peptide SLTCLVKGFY, corresponding to the 364–373 amino acid sequence of the human IgG heavy chain (Immunorphin), was found to compete with [¹²⁵I] -endorphin for binding by high-affinity receptors on T lymphocytes isolated from the blood of healthy donors (K _i0.6 nM). The fragments 3–10, 4–10, 5–10, and 6–10 of Immunorphin also inhibited the binding (K _i2.2, 3.4, 8.0, and 15 nM, respectively). Specificity of these receptors was studied: they turned out to be insensitive to naloxone and [Met]enkephaline and, therefore, are not opioid. The K _dvalues of the specific binding of ¹²⁵I-labeled Immunorphin and its 6–10 fragment to the receptor were found to be 7.4 and 36.3 nM, respectively.     

Vanadate binding to the (Na + K)-ATPase

A particulate (Na + K)-ATPase preparation from dog kidney bound [⁴⁸V]-ortho-vanadate rapidly at 37°C through a divalent cation-dependent process. In the presence of 3 mM MgCl₂ theK _d was 96 nM; substituting MnCl₂ decreased theK _d to 12 nM but the maximal binding remained the same, 2.8 nmol per mg protein, consistent with 1 mol vanadate per functional enzyme complex. Adding KCl in the presence of MgCl₂ increased binding, with aK _0.5 for KCl near 0.5 mM; the increased binding was associated with a drop inK _d for vanadate to 11 nM but with no change in maximal binding. Adding NaCl in the presence of MgCl₂ decreased binding markedly, with anI ₅₀ for NaCl of 7 mM. However, in the presence of MnCl₂ neither KCl nor NaCl affected vanadate binding appreciably. Both the nonhydrolyzable, ,-imido analog of ATP and nitrophenyl phosphate, a substrate for the K-phosphatase reaction that this enzyme also catalyzes, decreased vanadate binding at concentrations consistent with their acting at the low-affinity substrate site of the enzyme; the presence of KCl increased the concentration of each required to decrease vanadate binding. Oligomycin decreased vanadate binding in the presence of MgCl₂, whereas dimethyl sulfoxide and ouabain increased it. With inside-out membrane vesicles from red blood cells vanadate inhibited both the K-phosphatase and (Na + K)-ATPase reactions; however, with the K-phosphatase reaction extravesicular K⁺ (corresponding to intracellular K⁺) both stimulated catalysis and augmented vanadate inhibition, whereas with the (Na + K)-ATPase reaction intravesicular K⁺ (corresponding to extracellular K⁺) both stimulated catalysis and augmented vanadate binding.     

The OmpL37 Surface-Exposed Protein Is Expressed by Pathogenic Leptospira during Infection and Binds Skin and Vascular Elastin

Pathogenic Leptospira spp. shed in the urine of reservoir hosts into freshwater can be transmitted to a susceptible host through skin abrasions or mucous membranes causing leptospirosis. The infection process involves the ability of leptospires to adhere to cell surface and extracellular matrix components, a crucial step for dissemination and colonization of host tissues. Therefore, the elucidation of novel mediators of host-pathogen interaction is important in the discovery of virulence factors involved in the pathogenesis of leptospirosis. In this study, we assess the functional roles of transmembrane outer membrane proteins OmpL36 (LIC13166), OmpL37 (LIC12263), and OmpL47 (LIC13050), which we recently identified on the leptospiral surface. We determine the capacity of these proteins to bind to host tissue components by enzyme-linked immunosorbent assay. OmpL37 binds elastin preferentially, exhibiting dose-dependent, saturating binding to human skin (K_d, 104±19 nM) and aortic elastin (K_d, 152±27 nM). It also binds fibrinogen (K_d, 244±15 nM), fibrinogen fragment D (K_d, 132±30 nM), plasma fibronectin (K_d, 359±68 nM), and murine laminin (K_d, 410±81 nM). The binding to human skin elastin by both recombinant OmpL37 and live Leptospira interrogans is specifically enhanced by rabbit antiserum for OmpL37, suggesting the involvement of OmpL37 in leptospiral binding to elastin and also the possibility that host-generated antibodies may promote rather than inhibit the adherence of leptospires to elastin-rich tissues. Further, we demonstrate that OmpL37 is recognized by acute and convalescent leptospirosis patient sera and also by Leptospira-infected hamster sera. Finally, OmpL37 protein is detected in pathogenic Leptospira serovars and not in saprophytic Leptospira. Thus, OmpL37 is a novel elastin-binding protein of pathogenic Leptospira that may be promoting attachment of Leptospira to host tissues.     

Identification of nucleoside transport binding sites in the human myocardium

The role of nucleoside transport in ischemia-reperfusion injury and arrhythmias has been well documented in various animal models using selective blockers. However, clinical application of nucleoside transport inhibitors remains to be demonstrated in humans. It is not known whether human heart has nucleoside transport similar to that of animals. The aim of this study is to pharmacologically identify the presence of nucleoside transport binding sites in the human myocardium compared to animals.Myocardial tissue was obtained from guinea pig left and right ventricle, canine left ventricle, human intraoperative right atrium and human cadaveric right atrium and right and left ventricles. Myocardial preparations were obtained from tissue samples after homogenized and a differential centrifugation.Equilibrium binding assays were performed using [³H]-p-nitrobenzylthioinosine (NBMPR) at room temperature in the presence or absence of non-radioactive NBMPR or other nucleoside transport blockers such as p-nitrobenzylthioguanosine dipyridamole, lidoflazine, papaverin, adenosine and doxorubcine. From saturation curves and inhibition kinetics, we determined the relative maximal binding (B_max) and dissociation constant (K_d) of [³H]-NBMPR binding of human myocardial preparations.Results demonstrated that the fresh human myocardial preparations have a specific binding site for NBMPR with a B_max of 283 ± 32 fmol/mg protein and K_d of 0.56 ± 0.12 nM. These values are lower than those obtained from guinea pigs (B_max = 1440 ± 187 fmol/mg protein and K_d = 0.21 ± 0.03 nM) and canine atrium (B_max 594 ± 73 fmol/mg protein, and K_d = 1.12 ± 0.22 nM).Displacement kinetics studies revealed the relative potencies (of certain unrelated drugs as follow: p-nitrobenzylthioguanosine > dipyridamole > lidoflazine > pavaverine > Diltazam > adenosine > doxyrubicin. It is concluded that human myocardium contains an active nucleoside transport site which may play a crucial role in post-ischemic reperfusion-mediated injury in a wide spectrum of ischemic syndromes.     

Endogenous peroxidase in the lacrimal gland of the rat and its differentiation against injected catalase and horseradish-peroxidase

Summary The localization of endogenous peroxidase was studied in the glandula orbitalis (lacrimalis) externa of the rat by the method of Graham and Karnovsky (1966). Reaction product is visible in all cisternae of the rough endoplasmic reticulum including the perinuclear cisternae, in condensing vacuoles, and in all secretion granules. The Golgi cisternae seldom are peroxidase positive. Intercalated duct cells rarely contain reaction product in a few scattered cisternae of the rough endoplasmic reticulum and in secretion granules.After the injection of beef liver catalase reaction product is found in the capillary lumen. Both the injected catalase and the endogenous peroxidase are completely inhibited by 10^–2M aminotriazole, while the pseudoperoxidatic activity within the erythrocytes persists. After injection of horseradish-peroxidase reaction product is visible within the capillary lumen and also in the intercellular spaces between lacrimal gland cells. 10^–2M aminotriazole completely inhibits the endogenous peroxidase while the exogenous horseradish-peroxidase remains unaffected. The inhibitory effect of aminotriazole is not specific for catalase since lacrimal gland peroxidase is also inhibited.     

Selection of aptamers for aflatoxin M1 and their characterization

In the present work, aptamers against aflatoxin M1 and aflatoxin B1 were generated and tested for creating proof of principle of recognition of aflatoxin M1 by generated aptamers. The aptamers were selected through the process referred as systematic evolution of ligands by exponential enrichment. A total of 41 different aptamer (36 aptamers for aflatoxin M1 and 5 for aflatoxin B1) sequences were obtained. The determination of dissociation constant (K_d) values revealed that aptamers generated against aflatoxin M1 exhibited K_d values in the range of 35–1515 nM. Selected aptamers were grouped on the basis of the presence of common motifs or G‐quadruplex. We find it interesting that one aptamer with no conserved motif or G‐quadruplex had lowest K_d value (K_d = 35 nM). This structural motif is very distinct from motifs present in other aptamers. The K_d values of selected aptamers for aflatoxin B1 were in the range of 96–221 nM. One aptamer from each group was further tested for its ability to be used in aptasensor. The aptamer recognized aflatoxin M1 as indicated by color change (red to purple or blue) of aptamer‐coated gold nanoparticles in the presence of 250–500 nM aflatoxin M1. The aptamers can be used in developing methods for detection/estimation/separation of aflatoxin or antidote for aflatoxin toxicity. Copyright © 2014 John Wiley & Sons, Ltd.     

Unmasking by neuraminidase of specific chorionic gonadotrophin binding activity of human placental syncytiotrophoblast

Purified human placental syncytiotrophoblast consistently failed to bind specifically to 125I-labelled hCG. Treatment of the syncytiotrophoblast with neuraminidase resulted in the ability to bind 125I-labelled hCG that was displaceable by excess of unlabelled hCG. Neuraminidase treatment removed 73.8% of the total neuraminic acid of syncytiotrophoblast. The specific binding of 125I-labelled hCG increased linearly with increasing amount of neuraminidase-treated syncytiotrophoblast, was saturable and had a Ka = 1.6 x 10(7) M-1. Excess of GH, prolactin, placental lactogen or insulin did not inhibit the binding, whereas LH did so completely and FSH partly.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Interaction of Synthetic Dipeptide Bestim with Mouse Thymocytes and Macrophages

Tritium-labeled dipeptide bestim (γ-D-Glu-L-Trp) with a specific activity of 45 Ci/mmol was obtained by the high-temperature solid-state catalytic isotope exchange (HSCIE) reaction. [³H]bestim was found to bind with high affinity to mouse peritoneal macrophages (K _d 2.1 ± 0.1 nM) and thymocytes (K _d 3.1 ± 0.2 nM) and also plasma membranes isolated from these cells (K _d 18.6 ± 0.2 and 16.7 ± 0.3 nM respectively). The specific bonding of [³H]bestim with macrophages and thymocytes was inhibited by unlabeled dipeptide thymogen (L-Glu-L-Trp) (K _i 0.9 ± 0.1 and 1.1 ± 0.1 nM respectively). Treatment of the macrophages and thymocytes with trypsin led to their loss of capacity to bind [³H]bestim. Bestim at concentrations range of 0.1–1000 nМ reduced the adenylate cyclase activity in macrophage and thymocyte membranes.     

Vitellogenesis in the cockroach Nauphoeta cinerea: Separation of two classes of ovarian binding sites and calcium effects on binding and uptake

Two classes of vitellogenin binding sites with K_d-values of 7.3 nM and 290 nM were observed in follicle-membrane preparations of the cockroach Nauphoeta cinerea using a membrane-binding assay at pH 8. Separation of follicle cells and basal laminae from oocyte membranes prior to binding studies showed that the fraction consisting of follicle cells and basal laminae (FC/BL) contained high-affinity binding sites for vitellogenin (K_d=16.6 nM), whereas loweraffinity binding sites (K_d=200 nM) were found in the oocyte membrane fraction. The concentration of Ca²⁺ had a distinct effect on vitellogenin binding and uptake: maximal binding to the oocyte membrane fraction was observed at 0.3 mM Ca²⁺ and to the FC/BL fraction at 10 mM, whereas uptake of vitellogenin by oocytes in vitro was highest at 4 mM Ca²⁺. The calcium ionophore A23187 decreased vitellogenin uptake. This effect of A23187 could be counteracted by the calcium chelator Quin2. A hypothetical model for the uptake of vitellogenin into follicles of Nauphoeta cinerea is suggested.     

Expression of Inhibin/activin Subunits alpha (-α), beta A (-β A) and beta B (-β B) in Placental Tissue of Normal and Intrauterine Growth Restricted (IUGR) Pregnancies

During human pregnancy the placenta produces a variety of proteins like steroid hormones and their receptors that are responsible for the establishment and ongoing of the feto-placental unit. Inhibins are dimeric glycoproteins, composed of an α-subunit and one of two possible β-subunits (β _A or β _B). Aims of the present study were the determination of the frequency and tissue distribution patterns of the inhibin/activin subunits in human placental tissue of normal pregnancies and pregnancies complicated with fetal growth restriction (IUGR). Slides of paraffin embedded placental tissue were obtained after delivery from patients diagnosed with IUGR (n = 6) and normal term placentas (n = 8). Tissue samples were fixed and incubated with monoclonal antibodies inhibin/activin-subunits -α, -β _A, -β _B. Intensity of immunohistochemical reaction on the slides was analysed using a semi-quantitative score and statistical analysis was performed (P<0.05). A significant lower expression of the inhibin-α subunit in IUGR extravillous trophoblast compared to normal pregnancies was observed, while the inhibin-α immunostaining was significantly upregulated in syncytiotrophoblast. Additionally, a significant down-regulation of inhibin-β _B subunit in extravillous trophoblast cells in IUGR syncytiotrophoblast cells was demonstrated. A co-localisation of inhibin-α and the β-subunits was also observed, suggesting a production and secretion of intact inhibin A and inhibin B. Although the precise role of these inhibin/activin subunits in human placenta and IUGR pregnancies is still unclear, they could be involved in autocrine/paracrine signalling, contributing to several aspects like angiogenesis and tissue remodelling.     

Intracellular distinction between peroxidase and catalase in exocrine cells of rat lacrimal gland: A biochemical and cytochemical study

Summary The lacrimal gland (Glandula orbitalis externa) of rat contains both peroxidase and catalase and was used as a model for biochemical and cytochemical distinction between peroxidase and catalase. Both enzymes were isolated by ammonium sulfate precipitation from tissue homogenates, and the effects of fixation with glutaraldehyde and various conditions of incubation were investigated colorimetrically using DAB as hydrogen donor. The lacrimal gland peroxidase is strongly inhibited by glutaraldehyde treatment. In contrast, for catalase the fixation with glutaraldehyde is the prerequisite for demonstration of its peroxidatic activity. The maximal peroxidatic activity was obtained after treatment of catalase with 3% glutaraldehyde, higher concentrations being inhibitory. For lacrimal gland peroxidase, the maximal rate of oxidation of DAB is at pH 6.5, whereas for catalase it is at pH 10.5. The optimal concentration of H₂O₂ for lacrimal gland peroxidase is at 10⁻³ M and for peroxidatic activity of catalase at 10⁻¹ M. These optimal conditions obtained biochemically were applied to tissue sections of rat lacrimal gland. After the fixation of tissue with a low concentration of glutaraldehyde and incubation in the DAB medium at neutral pH containing 10⁻³ M H₂O₂ (Peroxidase medium), the reaction product was localized in the cisternae of the rough endoplasmic reticulum, in elements of the Golgi apparatus, and in secretory granules. After the fixation of tissue with 3% glutaraldehyde and incubation in the DAB-medium containing 10⁻¹ M H₂O₂ and at pH 10.5 (catalase medium), the staining in the endoplasmic reticulum, the Golgi-apparatus and in secretory granules was completely inhibited and reaction product was localized exclusively in small (0.2–0.5 μ) particles similar to small peroxisomes described in various other cell-types. This work was presented in part at the twenty-fifth Annual Meeting of the Histochemical Society, April 5–6, 1974. Atlantic City, N.J., J. Histochem. Cytochem.22, 288 (1974).