The Structure of Triple Helical Poly(U)·Poly(A)·Poly(U) Studied by Raman Spectroscopy

Abstract

Using Raman spectroscopy, we examined the ribose-phosphate backbone conformation, the hydrogen bonding interactions, and the stacking of the bases of the poly(U)·poly(A) ·poly(U) triple helix. We compared the Raman spectra of poly(U)·poly(A)·poly(U) in H₂O and D₂O with those obtained for single-stranded poly(A) and poly(U) and for double-stranded poly(A)·poly(U). The presence of a Raman band at 863 cm^?1 indicated that the backbone conformations of the two poly(U) chains are different in the triple helix. The sugar conformation of the poly(U) chain held to the poly(A) by Watson-Crick base pairing is C3′ endo; that of the second poly(U) chain may be C2′ endo. Raman hypochromism of the bands associated with base vibrations demonstrated that uracil residues stack to the same extent in double helical poly(A)·poly(U) and in the triple-stranded structure. An increase in the Raman hypochromism of the bands associated with adenine bases indicated that the stacking of adenine residues is greater in the triple helix than in the double helical form. Our data further suggest that the environment of the carbonyls of the uracil residues is different for the different strands.     

Pressure dependence of the helix-coil transition temperature for polynucleic acid helices

Thermal denaturation of DNA's and the corresponding helix–coil transformation of artificial polyribonucleic and polydeoxyribonucleic acids have been studied extensively both theoretically^1–13 and experimentally. ^14–30 Much less work has been carried out on the properties of these polynucleic acids at high pressure, and in particular, on the presure dependence of the helix–coil transition temperature.^31–33 Light-scattering techniques have been used in this study to measure the pressure dependence of the helix–coil transition temperature of the two- and three-stranded helices of polyriboadenylic and polyribouridilic acids and of calf thymus DNA. From the slopes of the transition temperature vs. pressure curves and heats of transition obtained from the literature,^20,34 the following volume changes from these helix–coil transitions have been obtained: (a) ?0.96 cc/mole of nucleotide base pairs for the poly (A + U) transition, (b) +0.35 cc/mole of nucleotide base trios for the poly (A + 2U) transition, and (c) +2.7 cc/mole of nucleotide base pairs for the DNA transition. The relative magnitudes and signs of these volume changes which show that poly (A + U) is destabilized by increased pressure, whereas poly (A + 2U) and calf thymus DNA are stabilized by increased pressure, indicates that further development of the helix–coil transition theory for polynucleotides is needed.     

The structure of triple helical poly(U).poly(A).poly(U) studied by Raman spectroscopy

Using Raman spectroscopy, we examined the ribose-phosphate backbone conformation, the hydrogen bonding interactions, and the stacking of the bases of the poly(U).poly(A).poly(U) triple helix. We compared the Raman spectra of poly(U).poly(A).poly(U) in H2O and D2O with those obtained for single-stranded poly(A) and poly(U) and for double-stranded poly(A).poly(U). The presence of a Raman band at 863 cm-1 indicated that the backbone conformations of the two poly(U) chains are different in the triple helix. The sugar conformation of the poly(U) chain held to the poly(A) by Watson-Crick base pairing is C3' endo; that of the second poly(U) chain may be C2' endo. Raman hypochromism of the bands associated with base vibrations demonstrated that uracil residues stack to the same extent in double helical poly(A).poly(U) and in the triple-stranded structure. An increase in the Raman hypochromism of the bands associated with adenine bases indicated that the stacking of adenine residues is greater in the triple helix than in the double helical form. Our data further suggest that the environment of the carbonyls of the uracil residues is different for the different strands.     

The nature of different influence of Cd<Superscript>2+</Superscript> ions on the conformational equilibrium of triple-stranded polyribonucleotides poly(U)•poly(A)•poly(U) and poly(I)•poly(A)•poly(I) in aqueous solutions

The influence of Cd²⁺ ions on the conformational equilibrium of single-stranded (poly(U), poly(A), poly(I)) and triple-stranded polyribonucleotides (A2I, A2U) in aqueous solutions (0.1 M Na⁺ pH 7) has been investigated using difference UV spectroscopy and thermal denaturation. Analysis of the shape and intensity of the DUV spectra of poly(A), poly(I), and A2I has revealed the presence of two types of complex formed as a result of (i) interaction between Cd²⁺ and the N7 atoms of purines, producing macrochelates; and (ii) binding of Cd²⁺ to the N1 atoms of poly(A) and poly(I). Since Cd²⁺ ions are not bound to heteroatoms of the bases in A2U, the conformation of the structure remains stable up to 0.02 M Cd²⁺. There is a critical Cd²⁺ concentration (～1.5?10^?4 M) above which A2I assumes a new helical conformation with lower thermal stability. It is supposed that, upon the formation of the “metallized” A2I triplex, the Cd²⁺ ions are located inside the triple helix and form bridges between the hypoxanthine and adenine of the homopolynucleotide strands.     

Ion-induced folding of a kink turn that departs from the conventional sequence

Kink turns (k-turns) are important structural motifs that create a sharp axial bend in RNA. Most conform to a consensus in which a three-nucleotide bulge is followed by consecutive G•A and A•G base pairs, and when these G•A pairs are modified in vitro this generally leads to a failure to adopt the k-turn conformation. Kt-23 in the 30S ribosomal subunit of Thermus thermophilus is a rare exception in which the bulge-distal A•G pair is replaced by a non-Watson–Crick A•U pair. In the context of the ribosome, Kt-23 adopts a completely conventional k-turn geometry. We show here that this sequence is induced to fold into a k-turn structure in an isolated RNA duplex by Mg²⁺ or Na⁺ ions. Therefore, the Kt-23 is intrinsically stable despite lacking the key A•G pair; its formation requires neither tertiary interactions nor protein binding. Moreover, the Kt-23 k-turn is stabilized by the same critical hydrogen-bonding interactions within the core of the structure that are found in more conventional sequences such as the near-consensus Kt-7. T. thermophilus Kt-23 has two further non-Watson–Crick base pairs within the non-canonical helix, three and four nucleotides from the bulge, and we find that the nature of these pairs influences the ability of the RNA to adopt k-turn conformation, although the base pair adjacent to the A•U pair is more important than the other.     

Formation of triple-helical nucleic acids studied by using antibodies specific for poly(A).poly(U).poly(U)

The formation of the triple helix of poly(A).poly(U).poly(U) was studied by using antibodies specific to poly(A).poly(U).poly(U). the 10-11 base chain length for oligo(A) and the 20-30 base chain length for oligo(U) may be the minimum sizes required to maintain a stable triple helix. Double-stranded poly(A).poly(U) which was the core of triple-stranded poly(A).poly(U).poly(U) could bind poly(U) and produce an analogue of poly(A).poly(U).poly(U) reactive with the antibodies even if the poly(A) or poly(U) was brominated or acetylated to the extent of 35-55%. However, brominated or acetylated poly(U) did not produce a stable triple helix with double-stranded poly(A).poly(U).     

Interaction of magnesium ions with poly A and poly U

The binding of Mg⁺⁺ to poly A and poly U has been measured quantitatively by using the metallochromic indicator calmagite. The method is described in detail. It is shown that there is electrostatic interaction between the binding sites, viz., the phosphate groups, and the intrinsic association constant, for the specific binding can be determined. After extrapolation to zero ionic strength we find that, for the binding of Mg⁺⁺ to poly A, k_int = 4 × 10⁴ and for that, to poly U, k_int = 3 × 10⁴. The intrinsic enthalpy of association is negative. The effect of Mg⁺⁺ on the secondary structure of poly A and poly U has been studied by measuring the ultraviolet absorbance, optical rotatory dispersion and viscosity as a function of the amount of added Mg⁺⁺ ions. It was found that Mg⁺⁺ promotes the formation of a more ordered secondary structure by neutralizing or screening the negative charges. It is concluded from the absorbance measurements that for poly A at pH ? 7 and for poly U at pH >xs 9 this ordering involves stacking of the bases. Likewise, in solutions of UDP with a pH around 10, base stacking occurs on addition of Mg⁺⁺.     

The nature of different influence of Cd2+ ions on the conformation of three-stranded polyU-polyA-polyU and polyI-polyA-polyI in aqueous solution

The methods of UV (DUV) spectroscopy and thermal denaturation were used to study the effect of Cd2+ ions on the conformational equilibrium of three-stranded (A21, A2U) and single-stranded (poly U, poly A and poly I) polynucleotides in aqueous solutions containing 0.1 M Na+ (pH 7). An analysis of the form and intensities of DUV-spectra of poly A, poly I and A2I revealed the presence of two types of complexes: interaction with N7 of purines, resulting in the formation of macrochelates and binding to N1 of poly A and poly I. Cd2+ ions do not bind to heteroatoms of A2U nitrogen bases, and, therefore, the conformation of its structure remains unchanged up to a concentration of Cd2+ 0.01 M. A "critical" concentration (1.5x10(-4) M) of Cd2+ ions exists above which A2I transits cooperatively into a new helical conformation, which has a lower thermostability. It is supposed that, during the formation of metallized A2I, Cd2+ ions form bridges between the adenine and hypoxanthine of its homopolynucleotide circuits, being arranged inside the triple helix.     

A calorimetric investigation of the heats of binding of Mg ++ to poly A, to poly U, and to their complexes

The heats of binding of Mg⁺⁺ ions to poly A, poly U, and to their complexes, in the presence of Na⁺ ions, have been measurd calorimetrically. In all cases the heat, ΔH(θ), exhibitis a distinct dependence on the extent of binding, θ, and in the cases of poly A and poly U also on the Na⁺ concentration. The values of ΔH(θ) range from +2 to +3 kcal/mole of Mg⁺⁺ bound at θ = 0 to 1.3 kcal/mole at θ = 0.5 except in poly A where at θ = 0 ΔH(θ) = ?2 to ?3 kcal/mole. This is interpreted as being due to a facilitation of base stacking by the binding of Mg⁺⁺. The extent of facilitation is consistent with current estimates of base stacking. A similar effect but of much smaller magnitude is believed to obtain in poly A poly U. An interpretation of the dependence of ΔH(θ) on θ in terms of simple electrostatic interactions, but neglecting solvent effects, was attempted and found to be inadequate.     

Demonstration of G . U wobble base pairs by Raman and IR spectroscopy

When guanine and uracil form hydrogen bonds in the pairing scheme first proposed by Crick one would expect that poly(A,G) will form an unperturbed double helix with poly U at room temperature in a dilute electrolyte solution (0.1 M NaCl). We have demonstrated by Raman- and IR-spectroscopy that the secondary structure of poly(A.G) · poly U is very similar to the structure of poly A · poly U; only the thermal stability of the double helix seems slightly lower than the stability of poly A · poly U, whereas the average helix length is unaffected by the dispersed G · U base pairs. From our input ratio of guanine and adenine we estimate that about every fourth base pair is a wobble pair.     

Sequence and conformational effects on imino proton exchange in A.T- and A.U-containing DNA and RNA duplexes

¹H-nmr relaxation has been used to study the effect of sequence and conformation on imino proton exchange in adenine–thymine (A · T) and adenine–uracil (A · U) containing DNA and RNA duplexes. At low temperature, relaxation is caused by dipolar interactions between the imino and the adenine amino and AH2 protons, and at higher temperature, by exchange with the solvent protons. Although room temperature exchange rates vary between 3 and 12s^?1, the exchange activation energies (E_α) are insensitive to changes in the duplex sequence (alternating vs homopolymer duplexes), the conformation (B-form DNA vs A-form RNA), and the identity of the pyrimidine base (thymine vs uracil). The average value of the activation energy for the five duplexes studied, poly[d(A-T)], poly[d(A) · d(T)], poly[d(A-U)], Poly[d(A) · d(U)], and poly[r(A) · r(U)], was 16.8 ± 1.3 kcal/mol. In addition, we find that the average E_α for the A.T base pairs in a 43-base-pair restriction fragment is 16.4 ± 1.0 kcal/mol. This result is to be contrasted with the observation that the E_α of cytosine-containing duplexes depends on the sequence, conformation, and substituent groups on the purine and pyrimidine bases. Taken together, the data indicate that there is a common low-energy pathway for the escape of the thymine (uracil) imino protons from the double helix. The absolute values of the exchange rates in the simple sequence polymers are typically 3–10 times faster than in DNAs containing both A · T and G · C base pairs.     

Theory of melting of the triple helix poly (A + 2U) for a 1 : 2 mixture of Poly A to Poly U

The Zimm-Bragg theory is extended to treat the melting of the triple helix poly (A + 2U) for a solution with a 1 : 2 mole ratio of poly A to poly U. Only the case for long chains is considered. For a given set of parameters the theory predicts the fraction of segments in the triple helix, double helix, and random coil states as a function of temperature. Four nucleation parameters are introduced to describe the two order–disorder transitions (poly (A + 2U) ? poly A + 2 poly U and poly (A + U) ? poly A + poly U) and the single order–order transition (poly (A + 2U) ? poly (A + U) + poly U). A relation between the nucleation parameters is obtained which reduces the number of independent parameters to three. A method for determining these parameters from experiment is presented. From the previously published data of Blake, Massoulié and Fresco⁸ for [Na⁺] = 0.04, we find σ_T = 6.0 × 10^?4, σ_D = 1.0 × 10^?3, and σσ* = 1.5 × 10^?3. σ_T and σ_D are the nucleation parameters for nucleating a triple helix and double helix, respectively, from a random coil region. σσ* is the nucleation parameter for nucleating a triple helix from a double helix and a single strand. Melting curves are generated from the theory and compared with the experimental melting curves.     

Bulge loops used to measure the helical twist of RNA in solution.

Bulge loops are commonly found in helical segments of cellular RNAs. When incorporated into long double-stranded RNAs, they may introduce points of flexibility or permanent bend that can be detected by the altered electrophoretic gel mobility of the RNA. We find that a single An or Un bulge loop near the middle of a long RNA helix significantly retards the RNA during polyacrylamide gel electrophoresis if n greater than or equal to 2. The mobility of an RNA containing two A2 bulges various periodically with the number of base pairs between the bulges. We interpret this to mean that A2 bulges varies periodically with the number of base pairs between the bulges. We interpret this to mean that Z2 bulges form torsionally stiff bends in the helix; the gel mobility reaches a minimum when the total helical twist between the bulges rotates the arms of the molecule into a cis conformation. The gel mobilities are proportional to the predicted end-to-end distance of the RNA if the average RNA helical repeat is 11.8 +/- 0.2 bp/turn and there is no helical twist (3 +/- 9 degrees) associated with the bulge (data obtained in 0.15 M Na+). Other sizes and sequences of bulges have very different effects on RNA helix conformation and flexibility. U2 bulges bend the helix to a much smaller degree than A2 bulges, while longer A or U bulge sequences probably allow bends of 90 degrees or more; all of these may be fairly flexible joints.(ABSTRACT TRUNCATED AT 250 WORDS)     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Interaction of metal ions with polynucleotides and related compounds. XXII. Effect of divalent metal ions on the conformational changes of polyribonucleotides

Changes in the conformation of poly(G), poly(C), poly(U), and poly(I) in the presence of divalent metal ions Mg²⁺, Ca²⁺, Mn²⁺, Co²⁺, Ni²⁺, Cu²⁺, Cd²⁺, and Zn²⁺ have been measured by means of ORD and u.v. spectra. Mg²⁺ and Ca²⁺ ions stabilize helical structures of all the polynucleotides very effectively at concentrations several orders of magnitude lower than the effective concentration of Na⁺ion. Cu²⁺ and Cd²⁺ destabilize the helical structure of polynucleotides to form random coils. Zn²⁺, Ni²⁺, Co²⁺, and Mn²⁺ions do not behave in such a clear-cut manner: they selectively stabilize some ordered structures, while destabilizing others, depending on the ligand strength of the nucleotide base as well as the preferred conformation of that polynucleotide.     

Circular dichroism evidence for G·U and G·T base pairing in poly[r(G-U)] and poly[d(G-T)]

We have measured the circular dichroism (CD) and absorption properties of poly[r(G-U)] and poly [d(G-T)] over a wide range of Na⁺ concentrations and temperatures. We find evidence for self-complexed forms of these polymers at lower temperatures and/or higher Na⁺ concentrations than generally needed for double-strand formation in other DNA and RNA polymers. These self-complexes could be composed of double-stranded regions with weak G·U or G·T base pairs.     

Novel extracellular ribonuclease from Bacillus intermedius--binase II: purification and some properties of the enzyme

The recombinant enzyme binase II was isolated from the culture liquid of Bacillus subtilis 3922 transformed with the pJF28 plasmid bearing the birB gene. The procedure of the enzyme purification included precipitation by polyethylene glycol with subsequent chromatography on DEAE-cellulose, heparin-Sepharose, and Toyopearl TSK-gel. The enzyme was purified 142-fold yielding a preparation with specific activity 1633 U/mg. The molecular weight of binase II is 30 kD. The enzyme is activated by Mg²⁺ and virtually completely inhibited by EDTA. The pH optimum for the reaction of RNA hydrolysis is 8.5. The properties of the enzyme are close to those of RNase Bsn from B. subtilis. The character of cleaving of synthetic single- and double-stranded polyribonucleotides by binase II suggests that the enzyme binds the substrate in the helix conformation, and its catalytic mechanism is close to that of RNase VI from cobra venom.     

The binding of Mg++ ions to polyadenylate, polyuridylate, and their complexes

The binding of Mg ⁺⁺ to polyadenylate (poly A), Polyuridylate(poly U), and their complexes, poly (A + U) and poly (A + 2U), was studied by means of a technique in which the dye eriochrome black T is used to measure the concentration of free Mg^?. The apparent binding constant K_X = [MgN]/[Mg⁺⁺][N], N = site for Mg⁺⁺ binding (the phosphate group of the nucleotide), was found to decrease rapidly as the extent of binding increased and, at low extents of binding, as the concentration of Na^? increased in poly A, poly (A + U), and poly (A + 2U), and somewhat less so in poly U. K_x is generally in the range 10⁴ > K_X > 10². The cause of these dependences is apparently, primarily, the displacement of Na⁺ by Mg⁺⁺ in poly U and poly (A + U) on the basis of the similarity of extents of displacement measured in this work and those measured potentiometrically. was calculated and was found to approach zero as the concentration of Na⁺ increased. In poly U, poly (A + U), and poly (A + 2U) at low ΔH′ v.H. > 0, about + 2 kcal/“mole.” In poly A, also at low salt, ΔH′ v.H. ≈ ?4 kcal/“mol” for the initial binding of Mg⁺⁺, and increases to +2 kcal/“mol” at saturation. This enthalpic variation probably accounts for the anticooperativity in the binding of Mg⁺⁺ not ascribable to the displacement of Na⁺⁺.     

Thermodynamic examination of the pyrophosphate sensor helix in the thiamine pyrophosphate riboswitch

Riboswitches are functional mRNA that control gene expression. Thiamine pyrophosphate (TPP) binds to thi-box riboswitch RNA and allosterically inhibits genes that code for proteins involved in the biosynthesis and transport of thiamine. Thiamine binding to the pyrimidine sensor helix and pyrophosphate binding to the pyrophosphate sensor helix cause changes in RNA conformation that regulate gene expression. Here we examine the thermodynamic properties of the internal loop of the pyrophosphate binding domain by comparing the wild-type construct (RNA WT) with six modified 2 × 2 bulged RNA and one 2 × 2 bulged DNA. The wild-type construct retains five conserved bases of the pyrophosphate sensor domain, two of which are in the 2 × 2 bulge (C65 and G66). The RNA WT construct was among the most stable (ΔG°₃₇ = −7.7 kcal/mol) in 1 M KCl at pH 7.5. Breaking the A•G mismatch of the bulge decreases the stability of the construct ∼0.5–1 kcal/mol, but does not affect magnesium binding to the RNA WT. Guanine at position 48 is important for RNA–Mg²⁺ interactions of the TPP-binding riboswitch at pH 7.5. In the presence of 9.5 mM magnesium at pH 5.5, the bulged RNA constructs gained an average of 1.1 kcal/mol relative to 1 M salt. Formation of a single A+•C mismatch base pair contributes about 0.5 kcal/mol at pH 5.5, whereas two tandem A+•C mismatch base pairs together contribute about 2 kcal/mol.     

Volume changes accompanying the complex formation of polyadenylic and polyuridylic acids

The complex formation of polyadenylic acid (poly A) and polyuridylic acid (poly U) in 0.1M NaCl solution containing 0.01M sodium cacodylate was followed by dilatometric measurements at various mixing ratios of poly A and poly U. The volume changes, ΔV, accompanying the formation of poly A. poly U and poly A.2poly U were + l.5 and + 2.5 ml per mole of the nucleotide residue, respectively. This increase in volume was probably due to the increased counterion binding when the single-stranded polynucleotides were converted into the double- and triple-stranded helices, since depletion of charged species from the solvent proper would lessen the effect of electrostriction, thus resulting in a positive ΔV. The conversion of a single-stranded poly A to a double-stranded helix in acidic solution led to a ΔV of + 3.8 ml per mole of the nucleotide residue. This increase in volume was attributed to the charge neutralization as a result of protonation of the adenine bases.