共查询到20条相似文献,搜索用时 15 毫秒
1.
Transglutaminases catalyze the formation of Nε-(γ-glutamyl) isodipeptide crosslinks between proteins. These enzymes are thought to participate in a number of diseases, including neurological disease and cancer. A method associating liquid chromatography and multiple stage mass spectrometry has been developed for the simultaneous quantitation of [Nε-(γ-glutamyl) lysine] isodipeptide and lysine on an ion trap mass spectrometer. Highly specific detection has been achieved in MS3 mode. The method includes a derivatization step consisting of butylation of carboxylic groups and acetylation of amide groups, a liquid-liquid extraction, and a 19-min separation on a 100 × 2.1-mm Beta-basic C18 column with an acetonitrile gradient elution. 13C6-15N2 isotopes of the isodipeptide and the lysine serve as internal standards. The assay was linear in the range of 50 pmol/ml to 75 nmol/ml for the isodipeptide and the range of 10 nmol/ml to 3.5 μmol/ml for the lysine, with correlation coefficients greater than 0.99 for both ions. Intra- and inter-day coefficients of variation ranged from 3.5 to 15.9%. The method was successfully applied to human biological samples known to be crosslinked by transglutaminase such as cornified envelopes of epidermis, fibrin, and normal and Huntington disease brain. 相似文献
2.
Jono T Nagai R Lin X Ahmed N Thornalley PJ Takeya M Horiuchi S 《Journal of biochemistry》2004,136(3):351-358
The levels of plasma 3-deoxyglucosone (3-DG) increase under hyperglycemic conditions and are associated with the pathogenesis of diabetic complications because of the high reactivity of 3-DG with proteins to form advanced glycation end products (AGE). To investigate potential markers for 3-DG-mediated protein modification in vitro and in vivo, we compared the yield of several 3-DG-derived AGE structures by immunochemical analysis and HPLC and measured their localization in human atherosclerotic lesions. When BSA was incubated with 3-DG at 37 degrees C for up to 4 wk, the amounts of N(epsilon)-(carboxymethyl)lysine (CML) and 3-DG-imidazolone steeply increased with incubation time, whereas the levels of pyrraline and pentosidine increased slightly by day 28. In contrast, significant amounts of pyrraline and pentosidine were also observed when BSA was incubated with 3-DG at 60 degrees C to enhance AGE-formation. In atherosclerotic lesions, CML and 3-DG-imidazolone were found intracellularly in the cytoplasm of most foam cells and extracellularly in the atheromatous core. A weak-positive immunoreaction with pyrraline was found in the extracellular matrix and a few foam cells in aortic intima with atherosclerotic lesions. Our results provide the first evidence that CML and 3-DG-imidazolone are major AGE structures in 3-DG-modified proteins, and that 3-DG-imidazolone provides a better marker for protein modification by 3-DG than pyrraline. 相似文献
3.
Immunological strategies for the detection of N(epsilon)-(carboxymethyl)lysine (CML), one of the major antigenic structures of advanced glycation end products (AGE), are widely applied to demonstrate the contribution of CML to the pathogeneses of diabetic complications and atherosclerosis. Recent studies have indicated that methylglyoxal (MG), which is generated intracellularly through the Embden-Meyerhof and polyol pathways, reacts with proteins to form MG-derived AGE structures such as N(epsilon)-(carboxyethyl)lysine (CEL). In order to accurately measure the CML contents of the proteins by means of an immunochemical method, we prepared CML-specific antibodies since conventionally prepared polyclonal anti-CML antibody and monoclonal anti-CML antibody (6D12) cross-reacted with CEL. To prepare polyclonal CML-specific antibody, CML-keyhole limpet hemocyanin (CML-KLH) were immunized with rabbit and CEL-reactive antibody was removed by CEL-conjugated affinity chromatography. Monoclonal antibody specific for CML (CMS-10) was obtained by immunization with CML-KLH, followed by successive screening according to CML-bovine serum albumin (CML-BSA)-positive but CEL-BSA-negative criteria. Both polyclonal CML-specific antibody and CMS-10 significantly reacted with CML-proteins but not with CEL-proteins. It is likely therefore that these antibodies can recognize the difference of one methyl group between CML and CEL. Moreover, CMS-10 significantly reacted with BSA modified with several aldehydes and its reactivity was highly correlated with the CML content, which was determined by high performance liquid chromatography, whereas 6D12 showed a low correlation. These results indicate that CMS-10 can be used to determine the CML contents of modified proteins in a more specific way. 相似文献
4.
5.
Calcium induction of transglutaminase and the formation of epsilon(gamma-glutamyl) lysine cross-links in cultured mouse epidermal cells 总被引:4,自引:0,他引:4
H Hennings P Steinert M M Buxman 《Biochemical and biophysical research communications》1981,102(2):739-745
A lysine tRNA (anticodon U1UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm1Am2GCUUAGAGCm2GUUAACCU-t6AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCAOH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U127 (probably 5-methoxycarbonylmethyluridine) and t6A30 (N-[N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U1 in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t6A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon. 相似文献
6.
Schalkwijk CG Baidoshvili A Stehouwer CD van Hinsbergh VW Niessen HW 《Biochimica et biophysica acta》2004,1636(2-3):82-89
Heart failure is a condition closely linked to diabetes. Hyperglycaemia amplifies the generation of a major advanced glycation end product Nepsilon-(carboxymethyl)lysine (CML), which has been associated with the development of vascular and inflammatory complications. An increased accumulation of CML in hearts of diabetic patients may be one of the mechanisms related to the high risk of heart failure. Therefore, we investigated the localization of CML in diabetic hearts. To investigate the presence and accumulation of CML in tissues, a monoclonal anti-CML antibody was generated and characterised. With this novel monoclonal antibody against CML, the localization of CML was investigated by immunohistochemistry, in heart tissue of controls (n = 9) and heart tissue of diabetic patients (n = 8) without signs of inflammation or infarction. In addition, in the same subjects we studied the presence of CML in renal and lung tissues. CML staining was approximately sixfold higher in hearts from diabetic patients as compared to control hearts (2.0 +/- 0.3 and 0.3 +/- 0.2 A.U., respectively, P < 0.01). CML deposition was localized in the small intramyocardial arteries in endothelial cells and smooth muscle cells, but not in cardiomyocytes. These arteries did not show morphological abnormalities. The intensity of staining between arteries at the epicardial, midcardial and endocardial side did not vary significantly within patients. In renal tissues, CML staining was most prominent in tubules and in atherosclerotic vessels, without differences in intensity between controls and diabetic patients. In non-infected lungs, no CML was detected. In conclusion, CML adducts are abundantly present in small intramyocardial arteries in the heart tissue of diabetic patients. The accumulation of CML in diabetic hearts may contribute to the increased risk of heart failure in hyperglycaemia. 相似文献
7.
Svistounov DN Berg TJ McCourt PA Zykova SN Elvevold KH Nagai R Horiuchi S Smedsrod BH 《Biochemical and biophysical research communications》2003,309(4):786-791
Advanced glycation end products (AGEs) are known to be associated with a number of pathological conditions, such as diabetes mellitus, Alzheimer's disease, uremia, as well as with normal aging. This study was undertaken to investigate whether Nepsilon-(carboxymethyl)lysine (CML), a major structure among numerous AGEs, engenders hepatic AGE clearance. For this purpose uptake of BSA substituted with heterogeneous AGEs or with CML only was monitored in vivo and in cultured hepatic scavenger cells. Here, we show that following intravenous administration of 125I-AGE-BSA and 125I-CML-BSA, blood radioactivity was reduced by 50% after 50s and >100 min, respectively. Recoveries from the circulation at 6 min after injection were: 5% for AGE-BSA, 95% for CML-BSA. More than 80% of the injected AGE-BSA was recovered from the liver. AGE-BSA, but not CML-BSA, was avidly endocytosed by cultured liver scavenger cells. Our results suggest that CML does not engender AGE-BSA clearance. Macromolecules substituted with CML only may escape elimination and cause pathological effects. 相似文献
8.
Three days after biopsy wounds were made in the dorsal skin of rats the animals were killed and explants of wounded and unwounded skin were incubated for 7 h with either [3H]glutamine or [3H]lysine. Both incubated and fresh control explants were then dissected into three layers which were homogenized, extracted, digested and then assayed for epsilon (gamma-glutamyl)lysine. The concentration of epsilon(gamma-glutamyl)lysine was greater in all three wounded layers than in the corresponding unwounded layers. The concentration in the wounded middle (dermal) layer and in the unwounded middle layer of younger rats was greater than in the unwounded outer (keratinized) layer, which has previously been shown to contain epsilon(gamma-glutamyl)lysine crosslinks. The incorporation of label from both [3H]glutamine and [3H]lysine into buffer-insoluble protein of the middle and inner (muscle) layers was much greater in the wounded explants than in the unwounded. Except for [3H]lysine in the inner layer there was also an increase in the fraction of incorporated label which was converted to epsilon(gamma-glutamyl)lysine. These results show that increased protein biosynthesis during repair in the wounded explants is associated with increased formation of epsilon(gamma-glutamyl)lysine. In addition, they indicate that the crosslink is involved in some process in the middle and inner layers which is distinct from its known function in keratinization of the epidermis. 相似文献
9.
Free radical-catalyzed peroxidation of docosahexaenoic acid (DHA, C22:6/omega-3) generates various lipid peroxidation products that covalently modify biomolecules such as proteins. Under a free radical-generating system, DHA significantly modified lysine residues in bovine serum albumin. Upon incubation of oxidized DHA with an amino-compound pyridoxamine or a lysine-containing peptide, N-propanoyl and N-succinyl adducts were determined to be the major modification products. The hydroperoxide levels in the oxidized DHA closely reflected the formation of the N(epsilon)-(succinyl)lysine (SUL) upon reaction with the peptide, indicating that the hydroperoxides of DHA represent a potential pathway for the formation of SUL. To detect the DHA-derived protein modification in vivo, we developed a monoclonal antibody (mAb2B12) specific to SUL and found that the antibody specifically reacts with the SUL moiety. The formation of SUL was then immunochemically demonstrated in the liver of mice fed with DHA followed by intraperitoneal injection of carbon tetrachloride (CCl(4)), a hepatic lipid peroxidation model. Immunoreactive materials with mAb2B12 were observed in the DHA + CCl(4) group, but were not significant in the control, DHA-alone, and CCl(4)-alone groups. These data suggest that the formation of DHA-derived adducts such as SUL may be implicated in the oxidative damage observed in DHA-enriched tissues. 相似文献
10.
We describe the isolation and molecular characterization of a novel glucose-lysine dimer crosslink 1,3-bis-(5-amino-5-carboxypentyl)-4-(1′,2′,3′,4′-tetrahydroxybutyl)-3H-imidazolium salt, named GLUCOLD. GLUCOLD was easily formed from the Amadori product (fructose–lysine). However, when BSA
was incubated with 100 mM glucose for 25 days, the levels of the lysine-lysine glucose crosslinks GLUCOLD and CROSSLINE were
only 21 and <1 pmol/mg, respectively, compared to 611 pmol/mg protein for the lysine-arginine GLUCOSEPANE crosslink, in spite
of more than 20 potential lysine-lysine crosslinking sites in the protein. Mechanistic investigation revealed that metal-free
phosphate ions catalyzed formation of fructose–lysine and all three crosslinks from amino acids, while cationic MOPS buffer
had an opposite effect. This together with the rapid formation of N
6-1,4-dideoxy-5,6-dioxoglucosone derivatives by dicarbonyl trapping agents, such as 1,2-diaminobenzene or γ-guanidinobutyric
acid, strongly suggests that enolization of the Amadori product and trapping of the 5,6-dioxo derivative by arginine residues
constitutes the major pathway for glucose-mediated crosslinking in proteins. 相似文献
11.
Park H Park ES Lee HS Yun HY Kwon NS Baek KJ 《Biochemical and biophysical research communications》2001,284(2):496-500
Galpha(h) (transglutaminase II) is a bifunctional enzyme possessing transglutaminase and GTPase activities. To better understand the factors affecting these two functions of Galpha(h), we have examined the characteristics of purified Galpha(h) from membrane and cytosol. GTP binding activity of mouse heart Galpha(h) was higher in membrane than that from cytosol. Furthermore, phospholipase C-delta1 (PLC-delta1) activity and coimmunoprecipitation of Galpha(h)-coupled PLC-delta1 in the alpha(1)-adrenoceptor-Galpha(h)-PLC-delta1 complex preparations were increased by phenylephrine in the presence of membranous Galpha(h). On the other hand, transglutaminase activity of cytosolic Galpha(h) was higher than that from membrane Galpha(h). These results demonstrate that bifunctions of Galpha(h) are regulated by its localization that can reflect the cellular functions of Galpha(h). 相似文献
12.
Angelika Küng Thomas Pieper Rene Wissiack Erwin Rosenberg Bernhard K. Keppler 《Journal of biological inorganic chemistry》2001,6(3):292-299
High performance capillary electrophoresis (HPCE) as well as high performance liquid chromatography-mass spectrometry (HPLC-MS) have been applied to the separation, identification and quantification of the tumor-inhibiting ruthenium compounds HIm trans-[RuCl4(im)2] (im = imidazole) and HInd trans-[RuCl4(ind)2] (ind = indazole) and their hydrolysis products. The half-lives for the hydrolytic decomposition of the Ru(III) compounds were determined by monitoring the relative decrease of the original complex anion under different conditions by means of capillary electrophoresis. The decomposition follows pseudo-first-order kinetics. The rate constants in water at 25 degrees C are 1.102 +/- 0.091 x 10(-5) s-1 for HIm trans-[RuCl4(im)2] and 0.395 +/- 0.014 x 10(-5) s-1 for HInd trans-[RuCl4(ind)2]. About 8% of HIm trans-[RuCl4(im)2] but only about 2% of HInd trans-[RuCl4(ind)2] were hydrolyzed after 1 h at room temperature. Whereas the hydrolysis rate of the imidazole complex is independent of the pH value, the indazole complex hydrolyzes much faster at higher pH. The half-life of HInd trans-[RuCl4(ind)2] in phosphate buffer at pH 6.0 and 37 degrees C is 5.4 h, whereas it is less than 0.5 h at pH 7.4. In contrast to the imidazole complex, where no dependence on the buffer system was observed, hydrolysis of the indazole complex is even faster if a buffer containing hydrogen carbonate is used. The formation of [RuCl2(H2O)2(im)2]+ could be demonstrated by HPLC-MS measurements. In the case of the indazole complex, a release of the indazole ligands results in the formation of [RuCl4(H2O)2]-. 相似文献
13.
The interaction of [Ru(NH3)5Cl]2+ and [Ru(NH3)6]3+ complex ions with calf thymus DNA has been studied at various r values (r = [Mn+]/[DNA-P]). Electronic spectra of metal-DNA solutions have been recorded and compared to the spectra of metal, as well as of DNA, solutions. Melting curves have been taken for the determination of DNA melting temperature (Tm) in the presence of the above complex ions. The results showed a biphasic melting of the DNA strands for relatively high r values. The Tm for the first phase increased with increasing r values, indicating metal ion interaction with the phosphate moieties of the DNA. The appearance of a second-phase melting, in connection with electronic spectra, pH values, and conductivity measurements of metal ion solutions, is indicative of the initial complexes' transformation to [Ru(NH3)5OH]2+, which binds preferentially to double-stranded rather than single-stranded DNA, thus leading to a second melting curve at a higher temperature than the first one. 相似文献
14.
A Eastman 《Analytical biochemistry》1991,197(2):311-315
The anticancer drug cisplatin elicits its cytotoxicity through damaging DNA. A sensitive method for following this interaction involves the use of an analog cis-[3H]dichloro(ethylenediamine)platinum(II) (cis-[3H]DEP). Cells are incubated with this analog, the DNA is purified, the enzyme is digested, and the deoxyribonucleoside-bound adducts are separated by HPLC. Other radioactive peaks can be detected by HPLC. These have been identified as arising from contaminating RNA and from the incorporation of tritium into unmodified nucleosides. A rapid DNA purification procedure that overcomes the first problem is presented. The latter problem is overcome by incubation of cells in hypoxanthine, aminopterin, and thymidine (HAT medium). Direct quantitation of levels of DNA platination can be determined in a single HPLC run by comparing the radioactivity in a specific adduct peak to the absorbance of the unmodified deoxyribonucleosides. Modifications to the synthesis of cis-[3H]DEP, the enzyme digestion of DNA, and the HPLC methodology are also described. 相似文献
15.
16.
A sensitive, reproducible high-performance liquid chromatographic method is reported for the determination of the epsilon (gamma-glutamyl)lysine isopeptide bond, which is usually formed by protein-crosslinking transglutaminases between polypeptide chains. The procedure is based on the separation and quantitation of epsilon (gamma-glutamyl)lysine isodipeptide following exhaustive proteolytic digestion of the crosslinked peptide. It involves preliminary separation steps on a cation exchanger resin and a silica HPLC column, precolumn derivatization with phenylisothiocyanate, and reversed-phase high-pressure liquid chromatographic separation on a C18 column. The derivatized isodipeptide gave a linear concentration-response relationship, with a detection limit of 10 pmol/mg of protein. The combination of the preliminary separation steps and the sensitive detection system permits the determination of the epsilon (gamma-glutamyl)lysine crosslink in complex biological systems including total tissue homogenates. 相似文献
17.
Epidermal-type transglutaminase (TGase 3) is devoid of GTPase activity, but its TGase activity is inhibited by GTP as in the case of tissue-type TGase (TGase 2). In addition, the inhibition was not affected by the presence of higher concentrations of Ca ion. These results indicate that GTP interacts with TGase 3 in a manner different from its action on TGase 2. 相似文献
18.
epsilon(gamma-Glutamyl)lysine isodipeptide, the end-product of proteolytic digestion of proteins cross-linked by transglutaminase, was detected in culture fluid of neonatal rat hepatocytes and plasma of adult rats. The concentration of the isodipeptide was significantly increased in both when high rate of apoptosis with phagocytosis of dying hepatocytes was produced either by epidermal growth factor in the culture or by lead nitrate-induced hyperplasia with subsequent involution in rats. Specific induction of tissue transglutaminase and the consequent formation of highly cross-linked protein envelopes in apoptotic cells have been previously demonstrated by us in both systems. 相似文献
19.
J Vignon I Chaudieu H Allaoua L Journod F Javoy-Agid Y Agid R Chicheportiche 《Life sciences》1989,45(26):2547-2555
The investigation of [3H] PCP and [3H] TCP binding properties to rat cerebrum and cerebellum resulted in the demonstration of multiple binding sites for the two drugs. In the two tissue preparations PCP had a lower affinity than TCP. In membranes from the cerebrum an equal number of high affinity binding sites were present for [3H] PCP and [3H] TCP. However, low affinity binding sites were two times more numerous for [3H] PCP than for [3H] TCP. In the cerebellum, the number of high and low affinity sites labeled by the two radioligands was identical, but the number of high affinity sites was about 7 fold lower than in the cerebrum. Taken together these results may indicate that in the cerebrum [3H] PCP labels other sites than NMDA/PCP receptor(s), maybe sigma receptors and/or the dopamine uptake complex. In human cerebral cortex samples [3H] TCP also bound to two different sites. The number of high and low affinity sites were 12 and 3 times, respectively, less abundant than in the rat cerebrum. Low affinity sites were of higher affinity (5 times) than corresponding sites in the rat brain. In the human cerebellum [3H] TCP binding parameters were identical to those measured in the same region in the rat. 相似文献
20.
Ikeuchi T Aoki T Yoshida T Takahashi K Hattori M 《Bioscience, biotechnology, and biochemistry》2008,72(5):1227-1234
Bovine beta-lactoglobulin (BLG) was conjugated with cationic saccharides to improve its functions. We used a polylysine-dextran conjugate (PL-Dex) as the cationic saccharide which had been prepared by the Maillard reaction. The molar ratio of PL:Dex was 1:1. The emulsifying property of PL in the acidic pH range was improved by conjugating with Dex. BLG and PL-Dex were conjugated by using microbial transglutaminase (MTGase), the effective conjugation being confirmed by SDS-PAGE. The molar ratio of BLG:PL-Dex was 1:1. Structural analyses by a fluorescence study, ELISA with monoclonal antibodies and measurement of the retinol-binding activity indicated that the conjugates had almost retained the native structure of BLG. The emulsifying property of BLG in the acidic pH range and in the presence of NaCl was improved by conjugating with PL-Dex. The immunogenicity of BLG was reduced by this conjugation, while the antigenicity of the BLG-PL-Dex conjugate was similar to that of BLG in BALB/c mice. 相似文献