P-Element-Induced Recombination in Drosophila Melanogaster: Hybrid Element Insertion

It has previously been shown that the combination of two deleted P elements in trans, one containing the left functional end and the second element the right functional end, can lead to high levels of male recombination. This finding strongly suggests that P-element ends from different chromosomes can become associated, followed by ``pseudo-excision.'''' We show that two different processes are involved in resolving the pseudo-excision event: (1) the excised P-element ends continue to function as a single unit (Hybrid Element) and insert at a nearby site in the chromosome or into the element itself [Hybrid Element Insertion (HEI)] and (2) free ends that do not contain P elements repair and rejoin [(Hybrid Excision and Repair (HER)]. Both types of resolution can lead to recombination, and this paper concentrates on the HEI class. One type of HEI event predicts the exact reverse complementary duplication of an 8-bp target site, and we have confirmed the existence of such a structure in six independently derived recombinant chromosomes. There is also a high tendency for insertion events to occur within a few bases of the original 8-bp target site, including six apparent cases of insertion into the exact site.     

Evidence of P-element-induced sister-chromatid exchange in a ring-X chromosome in Drosophila, with implication for a high rate of formation of hybrid elements

Activation of a single incomplete P element induces recombination at a rate of approximately 0.5-1% in the male germline of Drosophila. Male recombination rises by an order of magnitude to approximately 20% if homologous P elements are involved. The high rate of recombination suggests the possibility that sister-chromatid exchange (SCE) might be elevated to a similar extent, since homologous P elements must always be present in sister chromatids. This possibility was tested by recombining a single P element onto a ring-X chromosome and using sex-ratio distortion to measure the loss of the ring-X due to SCE in the male germline. The results confirmed a rate of loss comparable to that expected with homologous elements, although the rate of loss was variable. Both SCE and recombination results are consistent with the "hybrid element insertion" model, in which the left and right ends from different elements associate, providing that insertion occurs preferentially in the vicinity of a P-element end. For autosomes, hybrid element formation may thus occur at a much higher rate than the 0.5-1% implied by single element recombination, with only a small minority of hybrid element excision events being resolved by recombination.     

P-Element-Induced Male Recombination Can Be Produced in Drosophila Melanogaster by Combining End-Deficient Elements in Trans

Male recombination, not normally present in Drosophila melanogaster, can be produced at high rates when target P elements at homologous sites are combined in the presence of transposase protein. We have produced a set of elements by in situ deletion of a particular insertion and have found elements that have deletions stretching into either end. Elements were tested in pairs to see whether they complement each other in their ability to induce recombination. The combination of elements that are deficient for the same end produces very little recombination, but the combination of a right-end and a left-end element can generate recombination values higher than given by two complete P[CaSpeR] elements at homologous sites. This strongly suggests that ``hybrid' P elements, containing ends from two different elements, can be recognized by transposase protein. We have also examined genotypes containing a normal and an end-deficient element and found that they yield reasonably high levels of recombination. We interpret the resultant gametes from such genotypes as showing that the majority of events in this genotype derive from the association of complementary ends from the same element, whereas the complementary ends from elements in trans associate in only a minority of cases.     

High-frequency P element loss in Drosophila is homolog dependent

P transposable elements in Drosophila melanogaster can undergo precise loss at a rate exceeding 13% per generation. The process is similar to gene conversion in its requirement for a homolog that is wild type at the insertion site and in its reduced frequency when pairing between the homologs is inhibited. However, it differs from classical gene conversion by its high frequency, its requirement for P transposase, its unidirectionality, and its occurrence in somatic and premeiotic cells. Our results suggest a model of P element transposition in which jumps occur by a "cut-and-paste" mechanism but are followed by double-strand gap repair to restore the P element at the donor site. The results also suggest a technique for site-directed mutagenesis in Drosophila.     

P-Element-Induced Male Recombination and Gene Conversion in Drosophila

A P-element insertion flanked by 13 restriction fragment length polymorphism (RFLP) marker sites was used to examine male recombination and gene conversion at an autosomal site. The great majority of crossovers on chromosome arm 2R occurred within the 4-kb region containing the P element and RFLP sites. Of the 128 recombinants analyzed, approximately two-thirds carried duplications or deletions flanking the P element. These rearrangements are described in more detail in the accompanying report. In a parallel experiment, we examined 91 gene conversion tracts resulting from excision of the same autosomal P element. We found the average tract length was 1463 bp, which is essentially the same as found previously at the white locus. The distribution of conversion tract endpoints was indistinguishable from the distribution of crossover points among the nonrearranged male recombinants. Most recombination events can be explained by the ``hybrid element insertion' model, but, for those lacking a duplication or deletion, a second step involving double-strand gap repair must be postulated to explain the distribution of crossover points.     

The insertion element IS1 is a natural constituent of coliphage P1 DNA.

The presence of one copy of the insertion element IS1 in P1 DNA at map unit 20 of the physical genome map is revealed by restriction enzyme cleavage patterns and electron microscopy. This IS1 element is cleaved once by the restriction endonuclease PstI and extends about 500 to 600 base pairs to the left and 200 to 300 base pairs to the right of the unique PstI cleavage site of P1 DNA. Two P1Cm derivatives, P1Cm246 and P1Cm89, carrying a chloramphenicol resistance determinant contain DNA insertions with two terminal directly repeated IS1 elements. Insertion of such IS1-mediated transposition elements may occur at the IS1 site in the P1 genome or at other sites. The significance of IS1 as a natural constitutent of P1 DNA is discussed.     

Protected P-Element Termini Suggest a Role for Inverted-Repeat-Binding Protein in Transposase-Induced Gap Repair in Drosophila Melanogaster

P-element transposition is thought to occur by a cut-and-paste mechanism that generates a double-strand break at the donor site, the repair of which can lead to internally deleted elements. We have generated a series of both phenotypically stronger and weaker allelic derivatives of vg(21), a vestigial mutant caused by a P-element insertion in the 5' region of the gene. Virtually all of the new alleles arose by internal deletion of the parental element in vg(21), and we have characterized a number of these internally deleted P elements. Depending upon the selection scheme used, we see a very different spectrum of amount and source of P-element sequences in the resultant derivatives. Strikingly, most of the breakpoints occur within the inverted-repeats such that the last 15-17 bp of the termini are retained. This sequence is known to bind the inverted-repeat-binding protein (IRBP). We propose that the IRBP may act to preserve the P-element ends when transposition produces a double-strand gap. This allows the terminus to serve as a template upon which DNA synthesis can act to repair the gap. Filler sequences found at the breakpoints of the internally deleted P elements resemble short stretches, often in tandem arrays, of these terminal sequences. The structure of the filler sequences suggests replication slippage may occur during the process of gap repair.     

Insertion and excision of Bacteroides conjugative chromosomal elements.

Many strains of Bacteroides harbor large chromosomal elements that can transfer themselves from the chromosome of the donor to the chromosome of the recipient. Most of them carry a tetracycline resistance (Tcr) gene and have thus been designated Tcr elements. In the present study, we have used transverse alternating field electrophoresis to show that all but one of the Tcr elements screened were approximately 70 to 80 kbp in size. The exception (Tcr Emr 12256) was 150 to 200 kbp in size and may be a hybrid element. All of the Tcr elements inserted in more than one site, but insertion was not random. The Tcr elements sometimes cotransfer unlinked chromosomal segments, or nonreplicating Bacteroides units (NBUs). Transverse alternating field electrophoresis analysis showed that insertion of NBUs was not random and that the NBUs did not insert near the Tcr element. Although attempts to clone one or both ends of a Tcr element have not been successful, ends of a cryptic element (XBU4422) were cloned previously and shown to be homologous to the ends of Tcr elements. We have obtained DNA sequences of junction regions between XBU4422 and its target from several different insertions. Comparison of junction sequences with target sequences showed that no target site duplication occurred during insertion and that XBU4422 carried 4 to 5 bp of adjacent chromosomal DNA when it excised from the chromosome and inserted in a plasmid. We identified a short region of sequence similarity between one of the ends of XBU4422 and its target site that may be important for insertion. This sequence contained an 8-bp segment that was identical to the recombinational hot spot sequence on Tn21. XBU4422 could exise itself from plasmids into which it inserted. In most cases, the excision left a single additional A behind in the target site, but precise excision was seen in one case.     

Insertion element IS102 resides in plasmid pSC101.

In vivo recombination was found to occur between plasmid pHS1, a temperature-sensitive replication mutant of pSC101 carrying tetracycline resistance, and plasmid ColE1 after selection for tetracycline resistance at the restrictive temperature, 42 degrees C. Extensive analysis of the physical structures of three of these recombinant plasmids, using restriction endonucleases and the electron microscope heteroduplex method, revealed that the plasmid pHS1 was integrated into different sites on ColE1. The recombinant plasmids contained a duplication of a unique 1-kilobase (kb) sequence of pHS1 in a direct orientation at the junctions between the two parental plasmid sequences. This was confirmed by comparing the nucleotide sequence of the recombinants and their parental plasmids. Nucleotide sequence analysis further revealed that nine nucleotides at the site of recombination of ColE1 were duplicated at the junction of each of the 1-kb sequences. The formation of recombinants was independent of RecA function. Based on our previous finding that a plasmid containing a deoxyribonucleic acid insertion (IS) element can recombine with a second plasmid to generate a duplication of the IS element, we conclude that the 1-kb sequence is an insertion sequence, which we named IS102. For convenience, we have also denoted the IS102 sequence as eta theta to assign the orientation of the sequence. Eighteen nucleotides at one end (eta end) were found to be repeated in an inverted orientation at the other end (theta end) of IS102. The nucleotide sequence of the eta end of the sequence was found to be identical to the sequence at the ends of the transposon Tn903, which is responsible for transposition of the kanamycin resistance gene.     

DNA rearrangements associated with a transposable element in yeast

The his4-912 mutation results from insertion of a 6200 bp transposable element into the his4 gene of yeast. In order to clone the his4-912 mutation, the plasmid pBR322 was integrated into the his4 gene by means of yeast transformation, and then the vector sequences and the his4-912 insertion element were excised as a single restriction fragment. This his 4-912 insertion element is homologous to Ty1, a family of repetitive yeast DNA sequences. His+ revertants derived from the his4-912 mutant carry a number of chromosomal aberrations including deletions, translocations, a transposition and an inversion. The majority of His+ revertants result from deletions which have both endpoints within the element and which leave behind only 300 bp of the insertion element. Other derivatives of the his4-912 mutant carry deletions which have one endpoint in the insertion element and one endpoint in the his4 coding sequence. In two His+ revertants carrying reciprocal translocations, the chromosome III translocation breakpoints occur within the his4-912 insertion element. A His+ revertant carrying an inversion of most of the left arm of chromosome III may be an intermediate in transposition of the his4-912 insertion element to a new site on chromosome III.     

The Bacteroides mobilizable transposon Tn4555 integrates by a site-specific recombination mechanism similar to that of the gram-positive bacterial element Tn916.

The Bacteroides mobilizable transposon Tn4555 is a 12.2-kb molecule that encodes resistance to cefoxitin. Conjugal transposition is hypothesized to occur via a circular intermediate and is stimulated by coresident tetracycline resistance elements and low levels of tetracycline. In this work, the ends of the transposon were identified and found to consist of 12-bp imperfect inverted repeats, with an extra base at one end. In the circular form, the ends were separated by a 6-bp "coupling sequence" which was associated with either the left or the right transposon terminus when the transposon was inserted into the chromosome. Tn4555 does not duplicate its target site upon insertion. Using a conjugation-based transposition assay, we showed that the coupling sequence originated from 6 bases of genomic DNA flanking either side of the transposon prior to excision. Tn4555 preferentially transposed into a 589-bp genomic locus containing a 207-bp direct repeat. Integration occurred before or after the repeated sequence, with one integration site between the two repeats. These observations are consistent with a transposition model based on site-specific recombination. In the bacteriophage lambda model for site-specific recombination, the bacteriophage recombines with the Escherichia coli chromosome via a 7-bp "crossover" region. We propose that the coupling sequence of Tn4555 is analogous in function to the crossover region of lambda but that unlike the situation in lambda, recombination occurs between regions of nonhomologous DNA. This ability to recombine into divergent target sites is also a feature of the gram-positive bacterial transposon Tn916.     

A ''hot-spot'' for Ty transposition on the left arm of yeast chromosome III.

The small ring derivative of Saccharomyces cerevisiae chromosome III, which was formed by a cross-over between HML on the left arm and HMR on the right arm, contains three Ty elements. The class II element Ty 1-17 lies immediately centromere-distal to LEU2 on the left arm while two class I elements are tandemly arranged distal to PGK on the right arm. We have sequenced the regions of chromosome III surrounding Ty 1-17 and have defined a region where a number of transposition events have occurred. This region is flanked by the 5' ends of two tRNA genes, tRNA3Glu on the centromere distal side and tRNA3Leu immediately in front of LEU2. Close to the tRNA3Glu gene there is a region containing degenerate delta sequences organised in opposite orientations. Immediately distal to Ty 1-17 there are two complete solo delta elements, one inserted into the other. The sequence indicates that these two delta sequences were inserted into chromosome II by separate transposition events. A model is presented to explain how this structure arose and the role of solo delta elements in transposon propagation and maintenance is discussed.     

Structure and function of 59-base element recombination sites associated with mobile gene cassettes

The integration of gene cassettes into integrons is effected by site-specific recombination catalysed by an integrase, IntI, encoded by the integron. The cassette-associated recombination sites, 59-base elements, are not highly conserved and vary in length from 57 to 141 bp. They can be identified by their location and the relationship of over 20 bp at their outer ends to consensus sequences that are imperfect inverted repeats of one another. The recombination cross-over occurs close to one end of the 59-base element, within a conserved core site with the consensus sequence GTTAGGC or GTTRRRY. By introducing single-base changes at each of these positions in the aadB 59-base element, bases that are critical for site activity were identified. The recombination cross-over was also localized to a unique position between the adjacent G and T residues. Changes introduced in the conserved AAC of the inverse core site (GCCTAAC or RYYYAAC) located at the opposite end of the 59-base element also reduced site activity but to a lesser extent. Sequences of rare recombinants revealed an alternative position for strand exchange and led to the conclusion that 59-base elements comprise two simple sites, analogous to those recognized by other integrases, with each simple site made up of a pair of inversely oriented IntI binding domains separated by a spacer of 7 or 8 bp. Re-examination of the sequences of all known 59-base elements revealed that this simple site configuration was present at both the left and right ends in all 59-base elements. The identity of bases in the spacer is not required for efficient recombination and the cross-over is located at one end of the spacer, suggesting that during IntI1-mediated recombination only one strand exchange occurs.     

The bacteriophage Mu transposase protein can form high-affinity protein-DNA complexes with the ends of transposable elements of the Tn 3 family

The 37 kb transposable bacteriophage Mu genome encodes a transposase protein which can recognize and bind to a consensus sequence repeated three times at each extremity of its genome. A subset of this consensus sequence (5'-PuCGAAA(A)-3') is found in the ends of many class II prokaryotic transposable elements. These elements, like phage Mu, cause 5 bp duplications at the site of element insertion, and transpose by a cointegrate mechanism. Using the band retardation assay, we have found that crude protein extracts containing overexpressed Mu transposase can form high-affinity protein-DNA complexes with Mu att R and the ends of the class II elements Tn 3 (right) and IS101. No significant protein-DNA complex formation was observed with DNA fragments containing the right end of the element IS102, or a non-specific pBR322 fragment of similar size. These results suggest that the Mu transposase protein can specifically recognize the ends of other class II transposable elements and that these elements may be evolutionarily related.     

Isolation and genetic analysis of double hyperunstable systems in Drosophila melanogaster]

Hyperunstable mutations were described previously at the yellow locus of Drosophila melanogaster. These mutations are related to the insertion of the complex sequence containing two deleted copies of the P element at the termini and central unique regions from different sites of the X chromosome. In this work, double hyperunstable mutations at loci yellow and scute were obtained. These events were shown to occur from the inversion induced by the P elements located at the loci yellow and scute.     

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.     

A genetic analysis of DNA sequence requirements for Dissociation state I activity in tobacco.

Our objective was to test whether the double Ds structure correlated with Dissociation state I activity (i.e., high frequency of chromosome breakage and low frequency of reversion) in maize exhibited similar properties in tobacco. A genetic assay was established to test double Ds and related structures for their ability to cause loss of the linked marker genes streptomycin phosphotransferase and beta-glucuronidase in transgenic tobacco. An engineered double Ds element and a simple Ds element showed behavior consistent with that of state I and state II Ds elements, respectively, as described for maize. DNA structural rearrangements accompanied marker gene loss. Dissection of the double Ds structure showed that a left end and a right end of Ds in direct orientation were sufficient for the instability observed. This result suggested that left and right ends of Ds in direct orientation can participate in aberrant transposition events, consistent with two different models for double Ds-induced chromosome breakage proposed previously. Both models predict that the inversion of a half Ds element accompanies the aberrant transposition event. Such an inversion was detected by polymerase chain reaction experiments in tobacco and maize only when Activator activity was present in the genome.     

Analysis of P element transposase protein-DNA interactions during the early stages of transposition

P elements are a family of transposable elements found in Drosophila that move by using a cut-and-paste mechanism and that encode a transposase protein that uses GTP as a cofactor for transposition. Here we used atomic force microscopy to visualize the initial interaction of transposase protein with P element DNA. The transposase first binds to one of the two P element ends, in the presence or absence of GTP, prior to synapsis. In the absence of GTP, these complexes remain stable but do not proceed to synapsis. In the presence of GTP or nonhydrolyzable GTP analogs, synapsis happens rapidly, whereas DNA cleavage is slow. Both atomic force microscopy and standard biochemical methods have been used to show that the P element transposase exists as a pre-formed tetramer that initially binds to either one of the two P element ends in the absence of GTP prior to synapsis. This initial single end binding may explain some of the aberrant P element-induced rearrangements observed in vivo, such as hybrid end insertion. The allosteric effect of GTP in promoting synapsis by P element transposase may be to orient a second site-specific DNA binding domain in the tetramer allowing recognition of a second high affinity transposase-binding site at the other transposon end.