A consensus sequence for cleavage by vertebrate DNA topoisomerase II.

Topoisomerase II, purified from chicken erythrocytes, was reacted with a large number of different DNA fragments and cleavages were catalogued in the presence and absence of drugs that stabilize the cleavage intermediate. Cleavages were sequenced to derive a consensus for topoisomerase II that predicts catalytic sites. The consensus is: (sequence; see text) where N is any base and cleavage occurs at the indicated mark between -1 and +1. The consensus accurately predicts topoisomerase II sites in vitro. This consensus is not closely related to the Drosophila consensus sequence, but the two enzymes show some similarities in site recognition. Topoisomerase II purified from human placenta cleaves DNA sites that are essentially identical to the chicken enzyme, suggesting that vertebrate type II enzymes share a common catalytic sequence. Both viral and tissue specific enhancers contain sites sharing strong homology to the consensus and endogenous topoisomerase II recognizes some of these sites in vivo.     

Association between the p170 form of human topoisomerase II and progeny viral DNA in cells infected with herpes simplex virus type 1.

Endogenous host topoisomerase II acts upon herpes simplex virus type 1 (HSV-1) DNA in infected cells (S.N. Ebert, S.S. Shtrom, and M.T. Muller, J. Virol. 56:4059-4066, 1990), and cleavage is directed exclusively at progeny viral DNA while parental DNA is resistant. To evaluate the possibility that HSV-1 induces topoisomerase II activity which could account for the preferential cleavage of progeny viral DNA, we assessed topoisomerase II cleavage activity on cellular and viral DNA substrates before and after the initiation of viral DNA replication. We show that cleavage of a host gene in mock-infected cells was similar to that observed in HSV-1-infected cells, regardless of whether viral DNA replication had occurred. In addition, quantitative measurements revealed comparable amounts of topoisomerase II activity in infected and mock-infected cells; thus, HSV-1 neither induces nor encodes its own type II topoisomerase and cleavages in vivo are due to a preexisting host topoisomerase. Human cells contain two isozymes of topoisomerase II (p170 and p180), encoded by separate genes. Through the use of isozyme-specific antibodies, we demonstrate that only p170 was found to be cross-linked to HSV-1 DNA even though both forms were present at nearly constant levels in HSV-1-infected cells. Immunofluorescence revealed that by 6 h postinfection, p170 becomes redistributed and localized to sites of active viral DNA synthesis. The data suggest that p170 gains preferential access to replicated viral DNA molecules, which explains why topoisomerase II activity is concentrated on progeny DNA.     

Inactivation of topoisomerase I or II may lead to recombination or to aberrant replication termination on both SV40 and yeast 2 μm DNA

Topoisomerase I is believed to be sufficient for early replication of circular viral genomes such as those of SV40 and of yeast plasmids. Topoisomerase II is required for the decatenation of the daughter genomes and probably also for fork elongation during the later stages of SV40 replication. Using the neutral-neutral two-dimensional gel system, we have followed the progression of replication of both SV40 and the yeast 2μm plasmid under various conditions of topoisomerase inhibition. During SV40 replication, inhibition of topoisomerase II by VP16, VM26 or hypertonic shock (but not by merbarone), and inhibition of topoisomerase I by camptothecin all led to the accumulation of aberrant DNA structures containing two almost completely replicated genomes. These aberrant structures resembled either recombination intermediates or late Cairns structures in which the site of replication termination had shifted and now mapped to a continuum of sites throughout the genome. Replication of the 2 μm plasmid in a topoisomerase II- but not a topoisomerase I-deficient yeast gave rise to very similar structures. The data suggest that inactivation of topoisomerase I or II either stimulates recombination or, by differentially affecting replication fork progression, leads to aberrant replication termination. Edited by: J. Huberman     

Eukaryotic topoisomerase II preferentially cleaves alternating purine-pyrimidine repeats.

Alternating purine-pyrimidine sequences (RY repeats) demonstrate considerable homology to the consensus sequence for vertebrate topoisomerase II (Spitzner and Muller (1988) Nucleic Acids Res. 16: 1533-1556). This is shown below and positions that can match are underscored. RYRYRYRYRYRYRYRYRY = alternating purine-pyrimidine 18 bp RNYNNCNNGYNGKTNYNY = topoisomerase II consensus sequence (R is purine, Y is pyrimidine, K is G or T.) Topoisomerase II cleavage reactions were performed (in the absence of inhibitors) on a plasmid containing a 54 base RY repeat and the single strong cleavage site mapped to the RY repeat. Analysis of this DNA on sequencing gels showed that the enzyme cleaved a number of sites, all within the 54 base pair RY repeat. Topoisomerase II also made clustered cleavages within other RY repeats that were examined. Quantitative analysis of homology to the consensus sequence, as measured by the match of a site to a matrix of base proportions from the consensus data base (the matrix mean), showed that both the locations and the frequencies of cleavage sites within RY repeats were proportional to homology scores. However, topoisomerase II cleaved RY repeats preferentially in comparison to non-RY sites with similar homology scores. The activity of the enzyme at RY repeats appears to be proportional to the length of the repeat; additionally, GT, AC and AT repeats were better substrates for cleavage than GC repeats.     

Single-strand DNA cleavages by eukaryotic topoisomerase II

A new purification method for eukaryotic type II DNA topoisomerase (EC 5.99.1.3) is described, and the avian enzyme has been purified and characterized. An analysis of the cleavage reaction has revealed that topoisomerase II can be trapped as a DNA-enzyme covalent complex containing DNA with double-stranded and single-stranded breaks. The data indicate that DNA cleavage by topoisomerase II proceeds by two asymmetric single-stranded cleavage and resealing steps on opposite strands (separated by 4 bp) with independent probabilities of being trapped upon addition of a protein denaturant. Single-strand cleavages were directly demonstrated at both strong and weak topoisomerase II sites. Thus, a match to the vertebrate topoisomerase II consensus sequence (sequence; see text) (N is any base, and cleavage occurs between -1 and +1) [Spitzner, J.R., & Muller, M.T. (1988) Nucleic Acids Res. 16, 5533-5556)] does not predict whether a cleavage site will be single stranded or double stranded; however, sites cleaved by topoisomerase II that contain two conserved consensus bases (G residue at +2 and T at +4) generally yield double-strand cleavage whereas recognition sites lacking these two consensus elements yield single-strand cleavages. Finally, single-strand cleavages with topoisomerase II do not appear to be an artifact caused by damaged enzyme molecules since topoisomerase II in freshly prepared, crude extracts also shows the property of single-strand cleavages.     

Temporal association of the herpes simplex virus genome with histone proteins during a lytic infection

Previous work has determined that there are nucleosomes on the herpes simplex virus (HSV) genome during a lytic infection but that they are not arranged in an equally spaced array like in cellular DNA. However, like in cellular DNA, the promoter regions of several viral genes have been shown to be associated with nucleosomes containing modified histone proteins that are generally found associated with actively transcribed genes. Furthermore, it has been found that the association of modified histones with the HSV genome can be detected at the earliest times postinfection (1 h postinfection) and increases up to 3 h postinfection. However from 3 h to 6 h postinfection (the late phase of the replication cycle), the association decreases. In this study we have examined histone association with promoter regions of all kinetic classes of genes. This was done over the time course of an infection in Sy5y cells using sucrose gradient sedimentation, bromodeoxyuridine labeling, chromatin immunoprecipitation assays, Western blot analysis, trypsin and DNase digestion, and quantitative real-time PCR. Because no histones were detected inside HSV type 1 capsids, the viral genome probably starts to associate with histones after being transported from infecting virions into the host nucleus. Promoter regions of all gene classes (immediate early, early, and late) bind with histone proteins at the start of viral gene expression. However, after viral DNA replication initiates, histones appear not to associate with newly synthesized viral genomes.     

Human cytomegalovirus induces expression of cellular topoisomerase II.

Previous work from our laboratory has suggested that topoisomerase II is required for replication of human cytomegalovirus (HCMV). In assays of confluent human embryonic lung cells infected with HCMV, topoisomerase II inhibitors exhibited an irreversible inhibition of viral DNA replication. However, Northern (RNA blot) and Western (immunoblot) analyses of confluent uninfected human embryonic lung cells detected very low levels of cellular topoisomerase II RNA and protein. Quantitation of human topoisomerase II RNA and protein levels at various times after HCMV infection revealed that HCMV induces increased intracellular levels of both topoisomerase II RNA and protein. Such accumulation began at early times of infection, continued through late in infection, and was not reduced by inhibition of viral DNA synthesis. This is the first report of such induction by a viral infection. Topoisomerase II was also detected in isolated HCMV virions.     

Application of a degenerate consensus sequence to quantify recognition sites by vertebrate DNA topoisomerase II

A consensus sequence has been derived for vertebrate topoisomerase II cleavage of DNA (Spitzner, J. R. and Muller, M. T. (1988) Nucleic Acid. Res. 16, 5533-5556). An independent sample of 65 topoisomerase II sites (obtained in the absence of topoisomerase II inhibitors) was analyzed and found to match the consensus sequence as well as enzyme sites determined in the presence of the anti-tumor drug 4'-(9-acridinyl-amino)-methanesulfon-m-anisidide (m-AMSA). As originally described, conventional application of the consensus sequence afforded accuracy in the prediction of the locations but not the frequencies of topoisomerase II cleavages. In the present report, we describe a new method which quantitatively discriminates sites from nonsites, called the 'matrix mean' method (the mean match of a site to the matrix of base proportions from the original consensus sequence derivation). Furthermore, we derived a second method, called the 'unique score' model, which predicts frequency of topoisomerase II activity at a cleavage site. In the unique score method both DNA strands of a site are examined to determine the total number of the consensus positions that match on at least one strand of a potential site. From the new data base of 65 topoisomerase II sites, cleavages were scored for relative cleavage strength. Linear regression analysis showed a significant (p less than 0.01) correlation between the unique score and cleavage strength. The study was extended to show that the unique score model accurately and quantitatively predicts topoisomerase II sites either in the absence or presence of m-AMSA using the same consensus sequence.     

Mapping of sequence-specific chromatin proteins by a novel method: topoisomerase I on Tetrahymena ribosomal chromatin

DNA derived from the 5' spacers of the rRNA genes from Tetrahymena has unusual electrophoretic properties. These properties made it possible to devise a simple electrophoretic procedure for isolating specific rDNA spacer fragments from preparations of total nuclear DNA, enabling us to study DNA modifications at the level of unfractionated nuclei. We have employed the method to study the distribution of topoisomerase I binding sites on the r-chromatin (ribosomal chromatin) of Tetrahymena at the DNA sequence level. The presence of topoisomerase I in situ was detected by its ability to introduce single-strand cleavages into DNA. The positions of the cleavages were determined on DNA sequencing gels after isolation of the fragments. Topoisomerase I binding in r-chromatin is sequence specific and cleavage is confined to a 16 base-pair conserved sequence element previously determined to be a high-affinity binding site for topoisomerase I in vitro. The high degree of sequence specificity may be of important functional significance, as we find a similar sequence specificity with enzymes isolated from five evolutionarily distant species, indicating that preference for the 16 base-pair element is an intrinsic property of eukaryotic type I topoisomerases.     

Co-immunolocalization of topoisomerase II and chloroplast DNA in developing,dividing and mature wheat chloroplasts

This paper describes the first localization of immunofluorescence of topoisomerase II in developing chloroplasts. In order to investigate the relationship between topoisomerase II and chloroplast DNA (ctDNA) replication during chloroplast development the 7-day-old wheat leaf was used. Topoisomerase II was immunolabelled and fluorescein tagged and the ctDNA simultaneously stained with 4,6-diamidino-2-phenylindole (DAPI) in the same sections. Topoisomerase II was detected at every stage of chloroplast development and maximal levels of topoisomerase II were found in chloroplasts at the time of ctDNA replication. Topoisomerase II was localized around the plastid periphery, exactly mirroring the position of the ctDNA. After chloroplast division both topoisomerase II and ctDNA are seen to be restricted to small discrete areas within the plastid, but at different sites. These findings strongly suggest a role for topoisomerase II in ctDNA decatenation prior to chloroplast division.     

Eukaryotic topoisomerase II cleavage of parallel stranded DNA tetraplexes.

A guanine-rich single-stranded DNA from the human immunoglobulin switch region was shown by Sen and Gilbert [Nature, (1988) 334, 364-366] to be able to self-associate to form a stable four-stranded parallel DNA structure. Topoisomerase II did not cleave the single-stranded DNA molecule. Surprisingly, the enzyme did cleave the same DNA sequence when it was annealed into the four-stranded structure. The two cleavage sites observed were the same as those found when this DNA molecule was paired with a complementary molecule to create a normal B-DNA duplex. These cleavages were shown to be protein-linked and reversible by the addition of salt, suggesting a normal topoisomerase II reaction mechanism. In addition, an eight-stranded DNA molecule created by the association of a complementary oligonucleotide with the four-stranded structure was also cleaved by topoisomerase II despite being resistant to restriction endonuclease digestion. These results suggest that a single strand of DNA may possess the sequence information to direct topoisomerase II to a binding site, but the site must be base paired in a proper manner to do so. This demonstration of the ability of a four-stranded DNA molecule to be a substrate for an enzyme further suggests that these DNA structures may be present in cells.     

Nuclease protection by Drosophila DNA topoisomerase II. Enzyme/DNA contacts at the strong topoisomerase II cleavage sites

A DNA consensus sequence for topoisomerase II cleavage sites was derived previously based on a statistical analysis of the nucleotide sequences around 16 sites that can be efficiently cleaved by Drosophila topoisomerase II (Sander, M., and Hsieh, T. (1985) Nucleic Acids Res. 13, 1057-1072). A synthetic 21-mer DNA sequence containing this cleavage consensus sequence was cloned into a plasmid vector, and DNA topoisomerase II can cleave this sequence at the position predicted by the cleavage consensus sequence. DNase I footprint analysis showed that topoisomerase II can protect a region of approximately 25 nucleotides in both strands of the duplex DNA, with the cleavage site located near the center of the protected region. Similar correlation between the DNase I footprints and strong topoisomerase II cleavage sites has been observed in the intergenic region of the divergent HSP70 genes. This analysis therefore suggests that the strong DNA cleavage sites of Drosophila topoisomerase II likely correspond to specific DNA-binding sites of this enzyme. Furthermore, the extent of DNA contacts made by this enzyme suggests that eucaryotic topoisomerase II, in contrast to bacterial DNA bacterial DNA gyrase, cannot form a complex with extensive DNA wrapping around the enzyme. The absence of DNA wrapping is probably the mechanistic basis for the lack of DNA supercoiling action for eucaryotic topoisomerase II.     

Association of Arabidopsis topoisomerase IIA cleavage sites with functional genomic elements and T-DNA loci

Topoisomerase IIA (Topo IIA) is an essential ubiquitous enzyme involved in controlling DNA topology during multiple processes of genome function, and has been implicated in the generation of double-stranded breaks (DSB) in genomic DNA prior to DNA integration in plant genomes. Despite extensive characterization of type II topoisomerases from bacteria, viruses and animals, no studies on the specificity of plant Topo IIA-mediated DNA cleavage have been reported. We mapped and characterized Arabidopsis thaliana Topo IIA (AtTopoIIA) cleavage sites and demonstrated that they were cleaved in vivo. The consensus for the AtTopoIIA cleavage sites (ANNNRN downward arrowGTACNTNNNY) was significantly different from recognition sequences reported for Topo IIA from other organisms. The mapped cleavage sites were abundant in the Arabidopsis genome, exhibited a weak consensus, and were cleaved with relatively low efficiency. Use of the systematic evolution of ligands by exponential enrichment (SELEX) protocol identified a single, efficiently cleaved sequence TATATATATGTATATATATA that was over-represented in the genome. The mapped AtTopoIIA cleavage sites and the SELEX sites differed in their genomic distribution and associations with gene regulatory elements, matrix attachment regions, stress-induced DNA duplex destabilization sequences and T-DNA loci, suggesting different genome functions. Mapped AtTopoIIA sites but not SELEX sites were strongly associated with T-DNA integration sites, providing evidence for the involvement of AtTopoIIA-mediated DSB formation in T-DNA integration.     

Relationships between polydnavirus genomes and viral gene expression

Polydnavirus genomes and viral gene functions are atypical for viruses. Polydnaviruses are the only group of viruses with segmented DNA genomes and have an unusual obligate mutualistic association with parasitic Hymenoptera, in which the virus is required for survival of the wasp host and vice versa. The virus replicates asymptomatically in the wasp host but severely disrupts lepidopteran host physiology in the absence of viral DNA replication. It is not surprising then that viral gene expression is divergent in its two insect hosts and that differences in viral gene expression are linked to these divergent functions. Some viral genes are expressed only in the wasp host while other viral genes are expressed only in the lepidopteran host and are presumed to be involved in the disruption of host physiological systems. Our laboratory has described the expression and regulation of a family of viral genes implicated in suppressing the lepidopteran immune system, the cys-motif genes. In conjunction with these studies we have described the physical organization of additional viral gene segments. We have cloned, mapped and begun the sequence analysis of selected viral DNA segments. We have noted that some viral DNA segments are nested and that nested viral DNA segments encode the abundantly expressed, secreted cys-motif genes. Conversely, other viral segments are not nested, encode less abundantly expressed genes and may be targeted intra-cellularly. These results suggest that nesting of segments in polydnavirus genomes may be linked to the levels of gene expression. By extension, the unique, segmented organization of polydnavirus genomes may be associated, in part, with the requirement for divergent levels of viral gene expression in lepidopteran hosts in the absence of viral DNA replication.     

Does cruciform DNA provide a recognition signal for DNA-topoisomerase II?

Topoisomerase II displays higher affinity for supercoiled DNA compared to the same relaxed DNA. Moreover, cruciform structures are formed in topologically constrained DNA. Here we report that, using S1 nuclease experiments on supercoiled DNA, hairpin structures are located close to numerous topoisomerase II cleavage sites on the BPV I genome. Therefore, DNA secondary structure may play a role in the recognition mechanism of DNA by topoisomerase II.