Telomeric recombination induced by dysfunctional telomeres

Telomere maintenance is essential for cellular immortality, and most cancer cells maintain their telomeres through the enzyme telomerase. Telomeres and telomerase represent promising anticancer targets. However, 15% of cancer cells maintain their telomeres through alternative recombination-based mechanisms, and previous analyses showed that recombination-based telomere maintenance can be activated after telomerase inhibition. We determined whether telomeric recombination can also be promoted by telomere dysfunction. We report for the first time that telomeric recombination can be induced in human telomerase-positive cancer cells with dysfunctional telomeres.     

Emerging functions of BRCA2 in DNA recombination

Mutations in the breast cancer susceptibility protein BRCA2 cause inherited susceptibility to breast, ovarian and other cancers. There is now compelling experimental evidence that a major biological function of BRCA2 is the maintenance of chromosome structure stability in dividing cells by regulation of steps in recombination between homologous DNA strands. Recent experimental findings shape the current models for BRCA2 function, and structural and biochemical advances shed new light on the interactions between BRCA2, the RAD51 recombinase and single-stranded DNA during DNA recombination.     

Double-stranded DNA breaks and gene functions in recombination and meiosis

Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.     

Chromosomal recombination and breakage associated with instability in mouse centrometric satellite DNA

A mouse L cell line containing the centromeric insertion of herpes thymidine kinase genes (tk) was previously shown to undergo a high frequency of DNA rearrangement at the site of tk insertion. Analysis of TK- revertants had demonstrated that DNA rearrangements were usually associated with DNA deletion and were always mediated by intrachromosomal recombinations. In this study, we further analyzed several TK+ subclones to examine the mode of DNA rearrangements in the absence of negative selection pressure. In two clones, LC2-3F and LC2-3E17, rearrangements were accompanied by DNA amplification and were mediated by intrachromosomal recombination. In subclone LC2-3E17-19, we further detected perturbations in the pattern of centromeric heterochromatization. This was associated with chromosome instability, as evidenced by chromosome breakage at the centromere. The analysis of three other sibling clones, LC2-3, LC2-6 and LC2-15, further suggests that reciprocal recombination events may play a role in such centromeric rearrangements. These results suggest that DNA rearrangements in the centromere may be mediated by a number of different mechanisms, and generally do not affect chromosome stability except when accompanied by changes in the pattern of heterochromatization.     

DNA recombination protein-dependent mechanism of homoplasmy and its proposed functions

Homoplasmy is a basic genetic state of mitochondria, in which all of the hundreds to thousands of mitochondrial (mt)DNA copies within a cell or an individual have the same nucleotide-sequence. It was recently found that "vegetative segregation" to generate homoplasmic cells is an active process under genetic control. In the yeast Saccharomyces cerevisiae, the Mhr1 protein which catalyzes a key reaction in mtDNA homologous recombination, plays a pivotal role in vegetative segregation. Conversely, within the nuclear genome, homologous DNA recombination causes genetic diversity. Considering these contradictory roles of this key reaction in DNA recombination, possible functions of homoplasmy are discussed.     

Telomeric DNA in chromosomes of five opisthorchid species

The analysis of telomere repeat distribution in chromosomes of five opisthorchid species (Opisthorchis felineus (Rivolta, 1884), Opisthorchis viverrini (Poirier, 1886), Metorchis xanthosomus (Creplin, 1846), Metorchis bilis (Braun, 1890), Clonorchis sinensis (Cobbold, 1875)) was performed with fluorescent in situ hybridization (FISH) of labeled (TTAGGG)n DNA-probe and PNA telomere probe on mitotic and meiotic chromosomes of these species. It was shown that chromosome telomeres of all studied species contain large clusters of (TTAGGG)n telomeric repeats. Interstitial clusters of the (TTAGGG)n repeats have not been revealed in the chromosomes of any studied species even when FISH of PNA telomere probe on pachytene chromosomes was performed. Furthermore interstitial clusters of the (TTAGGG)n repeats have not been detected in the chromosomes of O. viverrini, one of chromosomes of this species is the result of a fusion of two ancestral opisthorchid chromosomes.     

BRCA1 functions independently of homologous recombination in DNA interstrand crosslink repair

Brca1 is required for DNA repair by homologous recombination (HR) and normal embryonic development. Here we report that deletion of the DNA damage response factor 53BP1 overcomes embryonic lethality in Brca1-nullizygous mice and rescues HR deficiency, as measured by hypersensitivity to polyADP-ribose polymerase (PARP) inhibition. However, Brca1,53BP1 double-deficient cells are hypersensitive to DNA interstrand crosslinks (ICLs), indicating that BRCA1 has an additional role in DNA crosslink repair that is distinct from HR. Disruption of the nonhomologous end-joining (NHEJ) factor, Ku, promotes DNA repair in Brca1-deficient cells; however deletion of either Ku or 53BP1 exacerbates genomic instability in cells lacking FANCD2, a mediator of the Fanconi anemia pathway for ICL repair. BRCA1 therefore has two separate roles in ICL repair that can be modulated by manipulating NHEJ, whereas FANCD2 provides a key activity that cannot be bypassed by ablation of 53BP1 or Ku.     

Telomeric DNA Mediates De Novo PML Body Formation

The cell nucleus harbors a variety of different bodies that vary in number, composition, and size. Although these bodies coordinate important nuclear processes, little is known about how they are formed. Among the most intensively studied bodies in recent years is the PML body. These bodies have been implicated in gene regulation and other cellular processes and are disrupted in cells from patients suffering from acute promyelocytic leukemia. Using live cell imaging microscopy and immunofluorescence, we show in several cell types that PML bodies are formed at telomeric DNA during interphase. Recent studies revealed that both SUMO modification sites and SUMO interaction motifs in the promyelocytic leukemia (PML) protein are required for PML body formation. We show that SMC5, a component of the SUMO ligase MMS21-containing SMC5/6 complex, localizes temporarily at telomeric DNA during PML body formation, suggesting a possible role for SUMO in the formation of PML bodies at telomeric DNA. Our data identify a novel role of telomeric DNA during PML body formation.     

Distinct domain functions regulating de novo DNA synthesis of thermostable DNA primase from hyperthermophile Pyrococcus horikoshii

DNA primases are essential components of the DNA replication apparatus in every organism. Reported here are the biochemical characteristics of a thermostable DNA primase from the thermophilic archaeon Pyrococcus horikoshii, which formed the oligomeric unit L(1)S(1) and synthesized long DNA primers 10 times more effectively than RNA primers. The N-terminal (25KL) and C-terminal halves (20KL) of the large subunit (L) play distinct roles in regulating de novo DNA synthesis of the small catalytic subunit (S). The 25KL domain has a dual function. One function is to depress the large affinity of the intrasubunit domain 20KL for the template DNA until complex (L(1)S(1) unit) formation. The other function is to tether the L subunit tightly to the S subunit, probably to promote effective interaction between the intrasubunit domain 20KL and the active center of the S subunit. The 20KL domain is a central factor to enhance the de novo DNA synthesis activity of the catalytic S subunit since the total affinity of the L(1)S(1) unit is mainly derived from the affinity of 20KL, which is elevated more than 10 times by the heterodimer formation, presumably due to the cancellation of the inhibitory activity of 25KL through tight binding to the S subunit.     

Telomeric and interstitial telomeric-like DNA sequences in Orthoptera genomes.

A (TTAGG)n-specific telomeric DNA probe was hybridized to 11 orthopteroid insect genomes by fluorescence in situ hybridization. Nine different genera, mainly distributed within two evolutionary branches with male chromosome numbers 2n = 23 and 2n = 17 were included in the analysis. Telomere sequences yielded positive signals in every telomere and there was a considerable number of interstitial telomeric-like sequences, mainly located at the distal end of some, but not all, subterminal chromosome regions. One of the species, Pyrgomorpha conica, showed massive hybridization signals associated with constitutive heterochromatin. The results are discussed along two lines: (i) the chromosomal evolutionary trends within this group of insects and (ii) the putative role that ITs may play in a genome when they are considered telomere-derived, but not telomere-functional, DNA sequences.     

Novel and diverse functions of the DNA mismatch repair family in mammalian meiosis and recombination

The mismatch repair (MMR) family is a highly conserved group of proteins that function in genome stabilization and mutation avoidance. Their role has been particularly well studied in the context of DNA repair following replication errors, and disruption of these processes results in characteristic microsatellite instability, repair defects and, in mammals, susceptibility to cancer. An additional role in meiotic recombination has been described for several family members, as revealed by extensive studies in yeast. More recently, the role of the mammalian MMR family in meiotic progression has been elucidated by the phenotypic analysis of mice harboring targeted mutations in the genes encoding several MMR family members. This review will discuss the phenotypes of the various mutant mouse lines and, drawing from our knowledge of MMR function in yeast meiosis and in somatic cell repair, will attempt to elucidate the significance of MMR activity in mouse germ cells. These studies highlight the importance of comparative analysis of MMR orthologs across species, and also underscore distinct sexually dimorphic characteristics of mammalian recombination and meiosis.     

Restriction Enzyme-Resistant High Molecular Weight Telomeric DNA Fragments in Tobacco

Restriction endonuclease-resistant high-molecular-weight (HMW)DNA fragments were isolated from nuclear DNA fragments in tobacco.The size of the fragments produced by EcoRI, HindIII, AfaI,and HaeIII ranged from 20 kb to over 166 kb. The kinetics ofdigestion by Bal31 nuclease showed that most of the HMW fragmentsare chromosome ends. The consensus sequence for tobacco telomererepeats was determined to be CCCTAAA by genomic sequencing usingthe HMW fragments and by sequencing after cloning. Besides thetelomere sequence, 9 tandem repeats of a 45-bp sequence wereidentified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT)formed a stem structure. The front of the stem is composed ofa palindrome of the telomere repeats. This highly conservedunit is surrounded by less conserved internal sequences thatare around 10–11 bp in size and contain a TTTT stretch.The internal sequences resemble the 10–11 bp consensusfor the scaffold attachment regions found in yeast and drosophila.The characteristic 45-bp sequence was abundant on the ends ofchromosomes. The shortest distance between the repeats containingtelomeric stem and the telomere was less than 20 kb. This architectureof the tobacco chromosome end region resembles the end regionof yeast chromosomes in which autonomous replication sequencesare present frequently.     

Expansion of DNA repeats in Escherichia coli: effects of recombination and replication functions.

Duplication or expansion of directly repeated sequence elements is associated with a number of human genetic diseases. To study the mechanisms of repeat expansion, we have developed a plasmid assay in Escherichia coli. Our assay involves two simple repeats of 787 bp in length; expansion to three or more copies of the repeat can be selected by restoration of an intact tetracycline-resistance gene. Expansions occurred at relatively high rates, >10(-5), in the population. Both RecA-dependent recombination and RecA-independent slipped misalignments contributed to the observed expansion events. Mutations that impair DNA polymerase III (DnaE, DnaQ subunits) or the replication fork helicase, DnaB, stimulated both RecA-dependent and RecA-independent expansion events. In these respects, the properties of repeat expansion resemble repeat deletion and suggest that difficulties in DNA replication may trigger both classes of rearrangements. About 20% of the RecA-independent expansion events are accompanied by reciprocal sister-chromosome exchange, producing dimeric plasmids carrying one triplicated and one deleted locus. These products are explained by a model involving misaligned strands across the replication fork. This model predicts that the location of a replication stall site may govern the types of resulting rearrangements. The specific location of such a stall site can also, in theory, account for propensity towards expansion or deletion of repeat arrays. This may have relevance to trinucleotide repeat expansion in human genetic disease.     

What the papers say: Telomeric DNA binding proteins

The physical ends of eukaryotic chromosomes form a specialized nucleoprotein complex composed of DNA and DNA binding proteins. This nucleoprotein complex, termed the telomere, is essential for chromosome stability. In most organisms, the DNA portion of the nucleoprotein complex consists of simple tandem DNA repeats with one strand guanine rich. The protein portion of the complex is less well understood. The experiments presented in two recent papers^(1,2) represent different stages in the characterization of the telomeric DNA binding proteins. The first paper presents a structure-function study of the Oxytricha telomeric DNA binding proteins and the second paper shows the identification and initial characterization of a telomeric DNA binding activity from Xenopus laevis. These two reports provided valuable information in understanding the structure and function of telomeres.     

Telomeric profiles and telomerase activity in turkey satellite cell clones with different in vitro growth characteristics

The satellite cell population in postnatal skeletal muscle is heterogeneous because individual satellite cells isolated from a single muscle have differing abilities to proliferate under the same in vitro conditions. Telomeres are structures found at the ends of all eukaryotic chromosomes that are characterized by repetitive DNA sequences, and they are important in determining cellular proliferation potential. The relationship between satellite cell proliferative heterogeneity and telomeric DNA was examined by digesting genomic DNA from large-colony-forming and small-colony-forming turkey satellite cell clones with HinfI, separating the restriction fragments on an agarose gel, and hybridizing the gels with an oligonucleotide probe specific for telomeric DNA. Turkey satellite cells generated telomeric restriction fragments up to approximately 180 kB. The large-colony-forming satellite cell clones had a larger proportion (P<0.05) of total telomeric restriction fragments below 33 kB than the small-colony-forming satellite cell clones. However, telomerase expression was detected in cultures from large-colony-forming and small-colony-forming turkey satellite cells suggesting that the differences in telomeric restriction fragments may not be related to the differences in in vitro proliferative behavior and that telomerase may contribute to the high in vitro growth capacity of turkey satellite cells.     

Telomeric site position heterogeneity in macronuclear DNA of Paramecium primaurelia.

In Paramecium primaurelia, the macronuclear gene encoding the G surface protein is located near a telomere. In this study, multiple copies of this telomere have been isolated and the subtelomeric and telomeric regions of some of them have been sequenced. The telomeric sequences consist of tandem repeats of the hexanucleotides C4A2 or C3A3. We show that the location where these repeats are added, which we call the telomeric site, is variable within a 0.6-0.8-kb region. These results are discussed in relation with the formation of macronuclear DNA.