DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA

In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite.     

Identification of a tRNA isopentenyltransferase gene from Arabidopsis thaliana

The tRNA of most organisms contain modified adenines called cytokinins. Situated next to the anticodon, they have been shown to influence translational fidelity and efficiency. The enzyme that synthesizes cytokinins on pre-tRNA, tRNA isopentenyltransferase (EC 2.5.1.8), has been studied in micro-organisms like Escherichia coli and Saccharomyces cerevisiae, and the corresponding genes have been cloned. We here report the first cloning and functional characterization of a homologous gene from a plant, Arabidopsis thaliana. Expression in S. cerevisiae showed that the gene can complement the anti-suppressor phenotype of a mutant that lacks MOD5, the intrinsic tRNA isopentenyltransferase gene. This was accompanied by the reintroduction of isopentenyladenosine in the tRNA. The Arabidopsis gene is constitutively expressed in seedling tissues.     

Crystal structure of archaeal tRNA(m(1)G37)methyltransferase aTrm5

Methylation of the N1 atom of guanosine at position 37 in tRNA, the position 3'-adjacent to the anticodon, generates the modified nucleoside m(1)G37. In archaea and eukaryotes, m(1)G37 synthesis is catalyzed by tRNA(m(1)G37)methyltransferase (archaeal or eukaryotic Trm5, a/eTrm5). Here we report the crystal structure of archaeal Trm5 (aTrm5) from Methanocaldococcus jannaschii (formerly known as Methanococcus jannaschii) in complex with the methyl donor analogue at 2.2 A resolution. The crystal structure revealed that the entire protein is composed of three structural domains, D1, D2, and D3. In the a/eTrm5 primary structures, D2 and D3 are highly conserved, while D1 is not conserved. The D3 structure is the Rossmann fold, which is the hallmark of the canonical class-I methyltransferases. The a/eTrm5-defining domain, D2, exhibits structural similarity to some class-I methyltransferases. In contrast, a DALI search with the D1 structure yielded no structural homologues. In the crystal structure, D3 contacts both D1 and D2. The residues involved in the D1:D3 interactions are not conserved, while those participating in the D2:D3 interactions are well conserved. D1 and D2 do not contact each other, and the linker between them is disordered. aTrm5 fragments corresponding to the D1 and D2-D3 regions were prepared in a soluble form. The NMR analysis of the D1 fragment revealed that D1 is well folded by itself, and it did not interact with either the D2-D3 fragment or the tRNA. The NMR analysis of the D2-D3 fragment revealed that it is well folded, independently of D1, and that it interacts with tRNA. Furthermore, the D2-D3 fragment was as active as the full-length enzyme for tRNA methylation. The positive charges on the surface of D2-D3 may be involved in tRNA binding. Therefore, these findings suggest that the interaction between D1 and D3 is not persistent, and that the D2-D3 region plays the major role in tRNA methylation.     

tRNA structure from a graph and quantum theoretical perspective

One of the objectives of theoretical biochemistry is to find a suitable representation of molecules allowing us to encode what we know about their structures, interactions and reactivity. Particularly, tRNA structure is involved in some processes like aminoacylation and genetic code translation, and for this reason these molecules represent a biochemical object of the utmost importance requiring characterization. We propose here two fundamental aspects for characterizing and modeling them. The first takes into consideration the connectivity patterns, i.e. the set of linkages between atoms or molecular fragments (a key tool for this purpose is the use of graph theory), and the second one requires the knowledge of some properties related to the interactions taking place within the molecule, at least in an approximate way, and perhaps of its reactivity in certain means. We used quantum mechanics to achieve this goal; specifically, we have used partial charges as a manifestation of the reply to structural changes. These charges were appropriately modified to be used as weighted factors for elements constituting the molecular graph. This new graph-tRNA context allow us to detect some structure-function relationships.     

Overexpression of initiator methionine tRNA leads to global reprogramming of tRNA expression and increased proliferation in human epithelial cells

Transfer RNAs (tRNAs) are typically considered housekeeping products with little regulatory function. However, several studies over the past 10 years have linked tRNA misregulation to cancer. We have previously reported that tRNA levels are significantly elevated in breast cancer and multiple myeloma cells. To further investigate the cellular and physiological effects of tRNA overexpression, we overexpressed tRNA_i^Met in two human breast epithelial cell lines. We then determined tRNA abundance changes and performed phenotypic characterization. Overexpression of tRNA_i^Met significantly altered the global tRNA expression profile and resulted in increased cell metabolic activity and cell proliferation. Our results extend the relevance of tRNA overexpression in human cells and underscore the complexity of cellular regulation of tRNA expression.     

Evolution of tRNA recognition systems and tRNA gene sequences

The aminoacylation of tRNAs by the aminoacyl-tRNA synthetases recapitulates the genetic code by dictating the association between amino acids and tRNA anticodons. The sequences of tRNAs were analyzed to investigate the nature of primordial recognition systems and to make inferences about the evolution of tRNA gene sequences and the evolution of the genetic code. Evidence is presented that primordial synthetases recognized acceptor stem nucleotides prior to the establishment of the three major phylogenetic lineages. However, acceptor stem sequences probably did not achieve a level of sequence diversity sufficient to faithfully specify the anticodon assignments of all 20 amino acids. This putative bottleneck in the evolution of the genetic code may have been alleviated by the advent of anticodon recognition. A phylogenetic analysis of tRNA gene sequences from the deep Archaea revealed groups that are united by sequence motifs which are located within a region of the tRNA that is involved in determining its tertiary structure. An association between the third anticodon nucleotide (N36) and these sequence motifs suggests that a tRNA-like structure existed close to the time that amino acid-anticodon assignments were being established. The sequence analysis also revealed that tRNA genes may evolve by anticodon mutations that recruit tRNAs from one isoaccepting group to another. Thus tRNA gene evolution may not always be monophyletic with respect to each isoaccepting group.Based on a presentation made at a workshop— Aminoacyl-tRNA Synthetases and the Evolution of the Genetic Code—held at Berkeley, CA, July 17–20, 1994 Correspondence to: M.E. Saks     

Classical molecular dynamics simulation of seryl tRNA synthetase and threonyl tRNA synthetase bound with tRNA and aminoacyl adenylate

Lacunae of understanding exist concerning the active site organization during the charging step of the aminoacylation reaction. We present here a molecular dynamics simulation study of the dynamics of the active site organization during charging step of subclass IIa dimeric SerRS from Thermus thermophilus (^ttSerRS) bound with ^tttRNA^Ser and dimeric ThrRS from Escherichia coli (^ecThrRS) bound with ^ectRNA^Thr. The interactions between the catalytically important loops and tRNA contribute to the change in dynamics of tRNA in free and bound states, respectively. These interactions help in the development of catalytically effective organization of the active site. The A76 end of the ^tttRNA^Ser exhibits fast dynamics in free State, which is significantly slowed down within the active site bound with adenylate. The loops change their conformation via multimodal dynamics (a slow diffusive mode of nanosecond time scale and fast librational mode of dynamics in picosecond time scale). The active site residues of the motif 2 loop approach the proximal bases of tRNA and adenylate by slow diffusive motion (in nanosecond time scale) and make conformational changes of the respective side chains via ultrafast librational motion to develop precise hydrogen bond geometry. Presence of bound Mg²⁺ ions around tRNA and dynamically slow bound water are other common features of both aaRSs. The presence of dynamically rigid Zinc ion coordination sphere and bipartite mode of recognition of ^ectRNA^Thr are observed.     

RNase E cleavage in the 5' leader of a tRNA precursor

In this study, we have used various tRNA(Tyr)Su3 precursor (pSu3) derivatives that are processed less efficiently by RNase P to investigate if the 5' leader is a target for RNase E. We present data that suggest that RNase E cleaves the 5' leader of pSu3 both in vivo and in vitro. The site of cleavage in the 5' leader corresponds to the cleavage site for a previously identified endonuclease activity referred to as RNase P2/O. Thus, our findings suggest that RNase P2/O and RNase E activities are of the same origin. These data are in keeping with the suggestion that the structure of the 5' leader influences tRNA expression by affecting tRNA processing and indicate the involvement of RNase E in the regulation of cellular tRNA levels.     

Increased activity of rat liver N2-guanine tRNA methyltransferase II in response to liver damage

Alterations in rat liver transfer RNA (tRNA) methyltransferase activities have been observed after liver damage by various chemicals or by partial hepatectomy. The qualitative and quantitative nature of these activity changes and the time course for their induction have been studied. Since homologous tRNAs are essentially fully modified in vivo, E. coli tRNAs were used as in vitro substrates for the rat liver enzymes in these studies. Each of the liver-damaging agents tested rapidly caused increases in activities of the enzyme(s) catalyzing methyl group transfer to tRNAs that have an unmodified guanine at position 26 from the 5′ end of the molecule. This group of tRNAs includes E. coli tRNA^Nfmet, tRNA^Ala₁, tRNA^Leu₁, or ^Leu₂, and tRNA^Ser₃ (Group 1). In each case N²-methylguanine and N²,N²-dimethylguanine represented 90% or more of the products of these in vitro methylations. The product and substrate specificity observed are characteristic of N²-guanine methyltransferase II ($\text{S-}\text{adenosyl}\text{-}\text{L}\text{-}\text{methionine:tRNA}$ (guanine-2)-methyltransferase, EC 2.1.1.32). In crude and partially purified preparations derived from livers of both control and treated animals this enzyme activity was not diminished significantly by exposure to 50°C for 10 min. The same liver-damaging agents induced little or no change in the activities of enzymes that catalyze methyl group transfer to various other E. coli tRNAs that do not have guanine at position 26 (Group 2). The results of mixing experiments appear to rule out the likelihood that the observed enzyme activity changes are due to stimulatory or inhibitory materials present in the enzyme preperations from control or treated animals. Thus, our experiments indicate that liver damage by each of several different methods, including surgery or administration of chemicals that are strong carcinogens, hepatotoxins, or cancer-promoting substances, all produce changes in liver tRNA methyltransferase activity that represent a selective increase in activity of N²-guanine tRNA methyltransferase II. It is proposed that the specificity of this change is not fortuitous, but is the manifestation of an as yet unidentified regulatory process.     

Analysis of genomic tRNA sets from Bacteria, Archaea, and Eukarya points to anticodon-codon hydrogen bonds as a major determinant of tRNA compositional variations

Analysis of 100 complete sets of the cytoplasmic elongator tRNA genes from Bacteria, Archaea, and Eukarya pointed to correspondences between types of anticodon and composition of the rest of the tRNA body. The number of the hydrogen bonds formed between the complementary nucleotides in the anticodon-codon duplex appeared as a major quantitative parameter determining covariations in all three domains of life. Our analysis has supported and advanced the "extended anticodon" concept that is based on the argument that the decoding performance of the anticodon is enhanced by selection of a matching anticodon stem-loop sequence, as reported by Yarus in 1982. In addition to the anticodon stem-loop, we have found covariations between the anticodon nucleotides and the composition of the distant regions of their respective tRNAs that include dihydrouridine (D) and thymidyl (T) stem-loops. The majority of the covariable tRNA positions were found at the regions with the increased dynamic potential--such as stem-loop and stem-stem junctions. The consistent occurrences of the covariations on the multigenomic level suggest that the number and pattern of the hydrogen bonds in the anticodon-codon duplex constitute a major factor in the course of translation that is reflected in the fine-tuning of the tRNA composition and structure.     

Crystal structure of Streptococcus pneumoniae Sp1610, a putative tRNA methyltransferase,in complex with S‐adenosyl‐L‐methionine

Streptococcus pneumoniae Sp1610, a Class‐I fold S‐adenosylmethionine (AdoMet)‐dependent methyltransferase, is a member of the COG2384 family in the Clusters of Orthologous Groups database, which catalyzes the methylation of N¹‐adenosine at position 22 of bacterial tRNA. We determined the crystal structure of Sp1610 in the ligand‐free and the AdoMet‐bound forms at resolutions of 2.0 and 3.0 Å, respectively. The protein is organized into two structural domains: the N‐terminal catalytic domain with a Class I AdoMet‐dependent methyltransferase fold, and the C‐terminal substrate recognition domain with a novel fold of four α‐helices. Observations of the electrostatic potential surface revealed that the concave surface located near the AdoMet binding pocket was predominantly positively charged, and thus this was predicted to be an RNA binding area. Based on the results of sequence alignment and structural analysis, the putative catalytic residues responsible for substrate recognition are also proposed.     

Altered expression of plant lysyl tRNA synthetase promotes tRNA misacylation and translational recoding of lysine

The Arabidopsis thaliana lysyl tRNA synthetase (AtKRS) structurally and functionally resembles the well-characterized prokaryotic class IIb KRS, including the propensity to aminoacylate tRNA(Lys) with suboptimal identity elements, as well as non-cognate tRNAs. Transient expression of AtKRS in carrot cells promotes aminoacylation of such tRNAs in vivo and translational recoding of lysine at nonsense codons. Stable expression of AtKRS in Zea mays causes translational recoding of lysine into zeins, significantly enriching the lysine content of grain.     

Improved separation of modified nucleosides from tRNA hydrolysates: the patterns of tRNA methylation in rat tissues

A sensitive and reproducible method for the isolation of minor nucleosides derived from tRNA is described. The nucleosides obtained from enzymatic digestion of tRNA are separated into several groups using a QAE Sephadex column and increasing concentrations of boric acid in a step-wise manner. The nucleosides in each group are separated by isocratic elution from a preparative Partisil 10-SCX column and high-performance liquid chromatography at ambient temperature. With this method we have determined the patterns of tRNA methylation in vitro with extracts from rat bone, liver, kidney and adrenal glands. Although different tissues appear to contain the same tRNA methyltransferases, the patterns of methylated nucleosides are different.     

Sequence-structure-function analysis of the bifunctional enzyme MnmC that catalyses the last two steps in the biosynthesis of hypermodified nucleoside mnm5s2U in tRNA

MnmC catalyses the last two steps in the biosynthesis of 5-methylaminomethyl-2-thiouridine (mnm(5)s(2)U) in tRNA. Previously, we reported that this bifunctional enzyme is encoded by the yfcK open reading frame in the Escherichia coli K12 genome. However, the mechanism of its activity, in particular the potential structural and functional dependence of the domains responsible for catalyzing the two modification reactions, remains unknown. With the aid of the protein fold-recognition method, we constructed a structural model of MnmC in complex with the ligands and target nucleosides and studied the role of individual amino acids and entire domains by site-directed and deletion mutagenesis, respectively. We found out that the N-terminal domain contains residues responsible for binding of the S-adenosylmethionine cofactor and catalyzing the methylation of nm(5)s(2)U to form mnm(5)s(2)U, while the C-terminal domain contains residues responsible for binding of the FAD cofactor. Further, point mutants with compromised activity of either domain can complement each other to restore a fully functional enzyme. Thus, in the conserved fusion protein MnmC, the individual domains retain independence as enzymes. Interestingly, the N-terminal domain is capable of independent folding, while the isolated C-terminal domain is incapable of folding on its own, a situation similar to the one reported recently for the rRNA modification enzyme RsmC.     

Crystal structure of human cytosolic aspartyl‐tRNA synthetase,a component of multi‐tRNA synthetase complex

Human cytosolic aspartyl‐tRNA synthetase (DRS) catalyzes the attachment of the amino acid aspartic acid to its cognate tRNA and it is a component of the multi‐tRNA synthetase complex (MSC) which has been known to be involved in unexpected signaling pathways. Here, we report the crystal structure of DRS at a resolution of 2.25 Å. DRS is a homodimer with a dimer interface of 3750.5 Ų which comprises 16.6% of the monomeric surface area. Our structure reveals the C‐terminal end of the N‐helix which is considered as a unique addition in DRS, and its conformation further supports the switching model of the N‐helix for the transfer of tRNA^Asp to elongation factor 1α. From our analyses of the crystal structure and post‐translational modification of DRS, we suggest that the phosphorylation of Ser146 provokes the separation of DRS from the MSC and provides the binding site for an interaction partner with unforeseen functions.Proteins 2013; 81:1840–1846. © 2013 Wiley Periodicals, Inc.     

Glycine and asparagme tRNA sequences from the archaebacteriuin,Methanobacterium thermoautotrophicum

Two tRNA sequences from Methanobacterium thermoautotrophium are reported. Both tRNA^Gly_GCC and tRNA_NUU^Asn, the first tRNA sequences from methanogens, were determined by partial hydrolyses (both chemical and enzymatic) and analyzed by gel electrophoresis. The two tRNAs contain the unusual T-loop modifications, Cm and m¹I, which are present in other archaebacterial tRNAs. Finally the presence of an unknown modification in the D-loop has been inferred by a large jump in the sequence ladder. These tRNAs are approximately equidistant from eubacterial or eukaryotic tRNAs.     

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCA-DAGCGCAψUUGUUUUGGNψFACAAAAUmsu7GUCACGGGTψCAAAUCCUGUCAUCCUUACCA_OH. It shows 93% homology with spinach chloroplast tRNA^Pro (UGG) and 72% homology with bean mitochondrial tRNA^Pro (UGG), the other two known plant organellar tRNAs^Pro.