首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 78 毫秒
1.
2.
3.
Therapeutic monoclonal antibodies (mAbs) are currently being approved for marketing in Europe and the United States, as well as other countries, on a regular basis. As more mAbs become available to physicians and patients, keeping track of the number, types, production cell lines, antigenic targets, and dates and locations of approvals has become challenging. Data are presented here for 34 mAbs that were approved in either Europe or the United States (US) as of March 2012, and nimotuzumab, which is marketed outside Europe and the US. Of the 34 mAbs, 28 (abciximab, rituximab, basiliximab, palivizumab, infliximab, trastuzumab, alemtuzumab, adalimumab, tositumomab-I131, cetuximab, ibrituximab tiuxetan, omalizumab, bevacizumab, natalizumab, ranibizumab, panitumumab, eculizumab, certolizumab pegol, golimumab, canakinumab, catumaxomab, ustekinumab, tocilizumab, ofatumumab, denosumab, belimumab, ipilimumab, brentuximab) are currently marketed in Europe or the US. Data for six therapeutic mAbs (muromonab-CD3, nebacumab, edrecolomab, daclizumab, gemtuzumab ozogamicin, efalizumab) that were approved but have been withdrawn or discontinued from marketing in Europe or the US are also included.Of the 28 mAbs currently marketed in the European Union or the US, 26 are marketed in Europe and 27 are marketed in the US, with 25 marketed in both regions (1 Of the 28 mAbs that are marketed in one or the other region, 43% (12/28) are produced in Chinese hamster ovary (CHO) cells, 25% (7/28) are produced in SP2/0 cells,2 18% (5/28) are produced in NS0 cells,3 and 7% (2/28) are produced in hybridomas. The remaining two products (ranibizumab, certolizumab pegol) are antigen-binding fragments (Fab) that are produced in E. coli. Humanized and human mAbs comprise 36% (10/28) and 32% (9/28) of the total, respectively, while 21% (6/28) are chimeric and 11% (3/28) are murine. Most (75%; 21/28) are canonical full-length mAbs. Of the 7 non-canonical mAbs, three (abciximab, ranibizumab, certolizumab pegol) are Fab, with one of these (certolizumab pegol) pegylated; two (tositumomab-I131, ibrituximab tiuxetan) are radiolabeled when administered to patients; one (brentuximab vedotin) is an antibody-drug conjugate (ADC); and one is bispecific (catumaxomab). Although 16 marketed mAbs target unique antigens, CD20 and tumor necrosis factor are each targeted by 4 mAbs, and epidermal growth factor receptor (EGFR) and vascular endothelial growth factor are each targeted by 2 mAbs. If approved, pertuzumab, which is undergoing regulatory review in Europe and the US as a treatment for breast cancer, would be one of 2 mAbs that target human epidermal growth factor receptor 2 on the market.Table 1. Therapeutic monoclonal antibodies marketed or in review in the European Union or United States
International non-proprietary name (Trade name)Manufacturing cell lineTypeTargetFirst EU (US) approval year
Abciximab (Reopro®)
Sp2/0
Chimeric IgG1κ Fab
GPIIb/IIIa
1995# (1994)
Rituximab (MabThera®, Rituxan®)
CHO
Chimeric IgG1κ
CD20
1998 (1997)
Basiliximab (Simulect®)
Sp2/0
Chimeric IgG1κ
IL2R
1998 (1998)
Palivizumab (Synagis®)
NS0
Humanized IgG1κ
RSV
1999 (1998)
Infliximab (Remicade®)
Sp2/0
Chimeric IgG1κ
TNF
1999 (1998)
Trastuzumab (Herceptin®)
CHO
Humanized IgG1κ
HER2
2000 (1998)
Alemtuzumab (MabCampath, Campath-1H®)
CHO
Humanized IgG1κ
CD52
2001 (2001)
Adalimumab (Humira®)
CHO
Human IgG1κ
TNF
2003 (2002)
Tositumomab-I131 (Bexxar®)
Hybridoma
Murine IgG2aλ
CD20
NA (2003)
Cetuximab (Erbitux®)
Sp2/0
Chimeric IgG1κ
EGFR
2004 (2004)
Ibritumomab tiuxetan (Zevalin®)
CHO
Murine IgG1κ
CD20
2004 (2002)
Omalizumab (Xolair®)
CHO
Humanized IgG1κ
IgE
2005 (2003)
Bevacizumab (Avastin®)
CHO
Humanized IgG1κ
VEGF
2005 (2004)
Natalizumab (Tysabri®)
NS0
Humanized IgG4κ
α4-integrin
2006 (2004)
Ranibizumab (Lucentis®)
E. coli
Humanized IgG1κ Fab
VEGF
2007 (2006)
Panitumumab (Vectibix®)
CHO
Human IgG2κ
EGFR
2007 (2006)
Eculizumab (Soliris®)
NS0
Humanized IgG2/4κ
C5
2007 (2007)
Certolizumab pegol (Cimzia®)
E. coli
Humanized IgG1κ Fab, pegylated
TNF
2009 (2008)
Golimumab (Simponi®)
Sp2/0
Human IgG1κ
TNF
2009 (2009)
Canakinumab (Ilaris®)
Sp2/0
Human IgG1κ
IL1b
2009 (2009)
Catumaxomab (Removab®)
Hybrid
hybridoma
Rat IgG2b/mouse IgG2a bispecific
EpCAM/CD3
2009 (NA)
Ustekinumab (Stelara®)
Sp2/0
Human IgG1κ
IL12/23
2009 (2009)
Tocilizumab (RoActemra, Actemra®)
CHO
Humanized IgG1κ
IL6R
2009 (2010)
Ofatumumab (Arzerra®)
NS0
Human IgG1κ
CD20
2010 (2009)
Denosumab (Prolia®)
CHO
Human IgG2λ
RANK-L
2010 (2010)
Belimumab (Benlysta®)
NS0
Human IgG1κ
BLyS
2011 (2011)
Raxibacumab (Pending)
NS0**
Human IgG1κ
B. anthrasis PA
NA (In review)
Ipilimumab (Yervoy®)
CHO
Human IgG1κ
CTLA-4
2011 (2011)
Brentuximab vedotin (Adcentris®)
CHO
Chimeric IgG1κ; conjugated to monomethyl auristatin E
CD30
In review (2011)
Pertuzumab (Pending)CHOHumanized IgG1κHER2In review (in review)
Open in a separate window*As of March 10, 2012. #Country-specific approval; approved under concertation procedure **Product manufactured for Phase 1 study in humans. Abbreviations: BLyS, B lymphocyte stimulator; C5, complement 5; CD, cluster of differentiation; CHO, Chinese hamster ovary; CTLA-4, cytotoxic T lymphocyte antigen 4; EGFR, epidermal growth factor receptor; EpCAM, epithelial cell adhesion molecule; Fab, antigen-binding fragment; GP glycoprotein; IL, interleukin; NA, not approved; PA, protective antigen; RANK-L, receptor activator of NFκb ligand; RSV, respiratory syncytial virus; TNF, tumor necrosis factor; VEGF, vascular endothelial growth factor. Sources: European Medicines Agency public assessment reports, United States Food and Drug Administration (drugs@fda), the international ImMunoGeneTics information system® (www.imgt.org/mAb-DB/index).In addition to the 28 mAbs currently marketed, six mAbs were approved in at least one country of Europe or in the US, but were subsequently withdrawn or discontinued from marketing for various reasons (4,5 Nebacumab (Centoxin®), a human IgM, was approved in The Netherlands, Britain, Germany and France during 1991 as a treatment for Gram-negative sepsis,6 but the product was subsequently withdrawn for safety, efficacy and commercial reasons.7 The murine anti-epithelial cell adhesion molecule (EpCAM) edrecolomab (Panorex®) was approved in Germany in 1995 as an adjuvant treatment for colon cancer, but subsequently withdrawn because of the product’s lack of efficacy.8 Daclizumab was first approved in 1997 for prophylaxis of acute organ rejection in patients receiving renal transplants, but the product was voluntarily withdrawn from the market in Europe effective January 1, 20099 and discontinued for the US market because of the availability of alternative therapy and the diminished market demand.10 The first ADC to be approved, gemtuzumab ozogamicin was marketed in the US for a decade before being voluntarily withdrawn in 2010. The product was approved under the accelerated approval mechanism as a treatment for acute myeloid leukemia (AML), but was withdrawn when a confirmatory clinical trial and post-approval use did not show evidence of clinical benefit in AML patients.11 Efalizumab (Raptiva®) was approved in the US and Europe in 2003 and 2004, respectively, as a treatment for adults with moderate to severe plaque psoriasis, but the product was voluntarily withdrawn from both markets in 2009 because of the risk of side effects, including progressive multifocal leukoencephalopathy.12,13Table 2. Therapeutic monoclonal antibodies withdrawn or discontinued from marketing in the European Union or United States
International proprietary name (Trade name)Manufacturing
cell line
TypeTargetFirst EU (US) approval year
Muromonab-CD3 (Orthoclone OKT3®)
Hybridoma
Murine IgG2a
CD3
1986* (1986)
Nebacumab (Centoxin®)
Hybridoma
Human IgM
Endotoxin
1991*(NA)
Edrecolomab (Panorex®)
Hybridoma
Murine IgG2a
EpCAM
1995*(NA)
Daclizumab (Zenapax®)
NS0
Humanized IgG1κ
IL2R
1999 (1997)
Gemtuzumab ozogamicin (Mylotarg®)
NS0
Humanized IgG4κ
CD33
NA (2000)
Efalizumab (Raptiva®)CHOHumanized IgG1κCD11a2004 (2003)
Open in a separate windowNote: Information current as of March 10, 2012. *European country-specific approval. Abbreviations: CD, cluster of differentiation; CHO, Chinese hamster ovary; EpCAM, epithelial cell adhesion molecule; IL, interleukin; NA, not approved. Sources: European Medicines Agency public assessment reports, United States Food and Drug Administration (drugs@fda), the international ImMunoGeneTics information system® (www.imgt.org/mAb-DB/index).The European Union and the US are not necessarily the first or only markets for therapeutic mAbs (14 Mogamulizumab is a defucosylated humanized anti-CC chemokine receptor 4 (CCR4) antibody developed by Kyowa Hakko Kirin Co Ltd.15 The mAb is undergoing regulatory review in Japan as a treatment for adult T-cell leukemia-lymphoma and peripheral T-cell lymphoma.Table 3. Therapeutic monoclonal antibodies marketed or in review outside the European Union or United States
International proprietary name (Trade name)Manufacturing
cell line
TypeTargetFirst approval year
Nimotuzumab (TheraCIM®, BIOMAB-EGFR®)
NS0
Humanized IgG1κ
EGFR
1999
Mogamulizumab[Not found]Humanized IgG1κCCR4In review in Japan
Open in a separate windowNote: Information current as of March 10, 2012. Abbreviations: CCR, chemokine receptor; EGFR, epidermal growth factor receptor.The 35 marketed mAbs, most of which are canonical full-length IgG1, paved the way for the next generation of antibody-based therapeutics such as ADCs, bispecific antibodies, engineered antibodies, and antibody fragments or domains. The commercial pipeline includes ~350 mAbs now being evaluated in clinical studies around the world as treatments for many indications, including cancer, immunological disorders and infectious diseases.16 The compendium of marketed therapeutic antibodies may thus be substantially larger in the future.  相似文献   

4.
5.
6.
Vertebrate genomic assemblies were analyzed for endogenous sequences related to any known viruses with single-stranded DNA genomes. Numerous high-confidence examples related to the Circoviridae and two genera in the family Parvoviridae, the parvoviruses and dependoviruses, were found and were broadly distributed among 31 of the 49 vertebrate species tested. Our analyses indicate that the ages of both virus families may exceed 40 to 50 million years. Shared features of the replication strategies of these viruses may explain the high incidence of the integrations.It has long been appreciated that retroviruses can contribute significantly to the genetic makeup of host organisms. Genes related to certain other viruses with single-stranded RNA genomes, formerly considered to be most unlikely candidates for such contribution, have recently been detected throughout the vertebrate phylogenetic tree (1, 6, 13). Here, we report that viruses with single-stranded DNA (ssDNA) genomes have also contributed to the genetic makeup of many organisms, stretching back as far as the Paleocene period and possibly the late Cretaceous period of evolution.Determining the evolutionary ages of viruses can be problematic, as their mutation rates may be high and their replication may be rapid but also sporadic. To establish a lower age limit for currently circulating ssDNA viruses, we analyzed 49 published vertebrate genomic assemblies for the presence of sequences derived from the NCBI RefSeq database of 2,382 proteins from known viruses in this category, representing a total of 23 classified genera from 7 virus families. Our survey uncovered numerous high-confidence examples of endogenous sequences related to the Circoviridae and to two genera in the family Parvoviridae: the parvoviruses and dependoviruses (Fig. (Fig.11).Open in a separate windowFIG. 1.Phylogenetic tree of vertebrate organisms and history of ssDNA virus integrations. Times of integration of ancestral dependoviruses (yellow icosahedrons), parvoviruses (blue icosahedrons), and circoviruses (triangles) are approximate.The Dependovirus and Parvovirus genomes are typically 4 to 6 kb in length, include 2 major open reading frames (encoding replicase proteins [Rep and NS1, respectively] and capsid proteins [Cap and VP1, respectively]), and have characteristic hairpin structures at both ends (Fig. (Fig.2).2). For replication, these viruses depend on host enzymes that are recruited by the viral replicase proteins to the hairpin regions, where self-primed viral DNA synthesis is initiated (2). Circovirus genomes are typically ∼2-kb circles. DNA of the type species, porcine circovirus 1 (PCV-1), contains a stem-loop structure within the origin of replication (Fig. (Fig.2),2), and the largest open reading frame includes sequences that are homologous to the Parvovirus replicase open reading frame (9, 11). The circoviruses also depend on host enzymes for replication, and DNA synthesis is self-primed from a 3′-OH end formed by endonucleolytic cleavage of the stem-loop structure (4). The frequency of Dependovirus infection is estimated to be as high as 90% within an individual''s lifetime. None of the dependoviruses have been associated with human disease, but related viruses in the family Parvoviridae (e.g., erythrovirus B19 and possibly human bocavirus) are pathogenic for humans, and members of both the Parvoviridae and the Circoviridae can cause a variety of animal diseases (2, 4).Open in a separate windowFIG. 2.Schematics illustrating the structure and organization of Parvoviridae and Circoviridae genomes and origins of several of the longest-integrated ancestral viral sequences found in vertebrates. Integrations were aligned to the Dependovirus adeno-associated virus 2 (AAV2), the Parvovirus minute virus of mice (MVM), and the Circovirus porcine circovirus 1 (PCV-1). The inverted terminal repeat (ITR) sequences in the Dependovirus and Parvovirus genomes are depicted on an expanded scale. A linear representation of the circular genome of PCV-1 is shown with the 10-bp stem-loop structure on an expanded scale. Horizontal lines beneath the maps indicate the lengths of similar sequences that could be identified by BLAST. The numbers indicate the locations of amino acids in the viral proteins where the sequence similarities in the endogenous insertions start and end. The actual ancestral virus-derived integrated sequences may extend beyond the indicated regions.With some ancestral endogenous sequences that we identified, phylogenetic comparisons can be used to estimate age. For example, as a Dependovirus-like sequence is present at the same location in the genomes of mice and rats, the ancestral virus must have existed before their divergence, more than 20 million years ago. Some Circovirus- and Dependovirus-related integrations also predate the split between dog and panda, about 42 million years ago. However, in most other cases, we rely on an indirect method for estimating age (1). As genomic sequences evolve, they accumulate new stop codons and insertion/deletion-induced frameshifts. The rates of these events can be tied directly to the rates of neutral sequence drift and, therefore, the time of evolution. To apply this method, we first performed a BLAST search of vertebrate genomes for all known ssDNA virus proteins (BLAST options, -p tblastn -M BLOSUM62 -e 1e−4). Candidate sequences were then recorded, along with 5 kb of flanking regions, and then again aligned against the database of ssDNA viruses to find the most complete alignment (BLAST options, -t blastx -F F -w 15 -t 1500 -Z 150 -G 13 -E 1 -e 1e−2). Detected alignments were then compared with a neutral model of genome evolution, as described in the supplemental material, and the numbers of stop codons and frameshifts were converted into the expected genomic drift undergone by the sequences. The age of integration was then estimated from the known phylogeny of vertebrates (7, 10). Using these methods, we discovered that as many as 110 ssDNA virus-related sequences have been integrated into the 49 vertebrate genomes considered, during a time period ranging from the present to over 40 to 60 million years ago (Table (Table1;1; see also Tables S1 to S3 in the supplemental material).

TABLE 1.

Selected endogenous sequences in vertebrate genomes related to single-stranded DNA viruses
Virus group and vertebrate speciesInitial genomic search using TBLASTN
Best sequence homology identified using BLASTX
Predicted nucleotide drift (%)Integration labelAge (million yr) or timing of integration based on sequence aging
Chromosomal or scaffold locationProteinBLAST E value/% sequence identityMost similar virusaProteinCoordinatesNo. of stop codons/frameshifts
Circoviruses
    CatScaffold_62068Rep6E−05/37Canary circovirusRep4-2833/7 in 268 aab14.2fcECLG-182
Scaffold_24038Rep6E−06/51Columbid circovirusRep44-3174/5 in 231 aac15.2fcECLG-287
    DogChr5dRep7E−16/46Raven circovirusRep16-2636/5 in 250 aa17.6cfECLG-198
Chr22Rep1E−14/43Beak and feather disease virusRep7-2642/1 in 261 aac4.5cfECLG-254
    OpossumChr3Rep4E−46/44Finch circovirusRep2-2910/2 in 282 aa2.3mdECLG12
Cap6-360/0 in 30 aa
Dependoviruses
    DogChrXRep6E−05/55AAV5Rep239-4453/4 in 200 aa14.0cfEDLG-178
    DolphinGeneScaffold1475Rep8E−39/39Avian AAV DA1Rep79-4863/4 in 379 aac6.6ttEDLG-255
Cap4E−61/47Cap1-7384/7 in 678 aac
    ElephantScaffold_4Rep0/55AAV5Rep3-5890/0 in 579 aa0.0laEDLGRecent
    HyraxGeneScaffold5020Cap3E−34/53AAV3Cap485-7350/5 in 256 aa7.0pcEDLG-129
Scaffold_19252Rep9E−72/47Bovine AAVRep2-3488/4 in 348 aa14.3pcEDLG-260
    MegabatScaffold_5601Rep2E−13/31AAV2Rep315-4791/5 in 175 aa13.1pvEDLG-376
    MicrobatGeneScaffold2026Rep1E−117/50AAV2Rep1-6172/5 in 612 aa5.8mlEDLG-127
Cap9E−33/51Cap1-7312/9 in 509 aac
Scaffold_146492Cap6E−32/42AAV2Cap479-7320/3 in 252 aa4.2mlEDLG-219
    MouseChr1Rep2E−06/34AAV2Rep4-2063/5 in 191 aa17.1mmEDLG-139
Chr3Rep2E−24/31AAV5Rep71-47812/7 in 389 aa16.5mmEDLG-237
Cap2E−22/45Cap22-72412/10 in 649aac
Chr8Rep1E−08/46AAV2Rep314-4733/3 in 147 aa13.8mmEDLG-331
Cap1-1371/2 in 114 aa
    PandaScaffold2359Rep2E−06/37Bovine AAVRep238-4262/3 in 186 aa10.4amEDLG-159
    PikaScaffold_9941Rep4E−14/28AAV5Rep126-4152/2 in 282 aa5.4opEDLG14
    PlatypusChr2Rep9E−10/35Bovine AAVRep297-4374/3 in 138 aa17.1oaEDLG-179
Cap272-4191/2 in 150 aac
Contig12430Rep2E−09/47Bovine AAVRep353-4503/1 in 123 aa12.0oaEDLG-255
Cap2E−05/32Cap253-3672/1 in 116 aa
    RabbitChr10Rep3E−97/39AAV2Rep1-6193/9 in 613 aa9.3ocEDLG43
Cap5E−50/45Cap1-72310/9 in 675 aa
    RatChr13Rep2E−09/33AAV2Rep4-1752/4 in 177 aa13.3rnEDLG-128
Chr2Rep4E−18/40AAV5Rep1-46112/12 in 454 aa22.7rnEDLG-251
Chr19Rep2E−07/33AAV5Rep329-4642/4 in 136 aa16.1rnEDLG-335
Cap31-1332/1 in 93 aa
    TarsierScaffold_178326Rep4E−14/23AAV5Rep96-4652/3 in 356 aa5.3tsEDLG23
Parvoviruses
    Guinea pigScaffold_188Rep3E−24/46Porcine parvovirusRep313-5675/3 in 250 aa12.3cpEPLG-140
Cap1E−16/36Cap10-68911/12 in 672 aa
Scaffold_27Rep1E−50/39Canine parvovirusRep11-6401/4 in 616 aa5.3cpEPLG-217
Cap1E−38/39Porcine parvovirusCap3-7192/14 in 700 aa
    TenrecScaffold_260946Rep2E−20/38LuIII virusRep406-5984/4 in 190 aa19.0etEPLG-260
Cap11-63916/15 in 595 aa
    RatChr5Rep6E−10/56Canine parvovirusRep1-2820/0 in 312 aa0.6rnEPLGRecent
Cap0/62Cap637-6670/2 in 760 aa
Rep0/631-751
    OpossumChr3Rep2E−39/33LuIII virusRep7-57011/3 in 502 aa10.9mdEPLG-256
Cap7E−8/33Cap11-72914/7 in 704 aa
Chr6Rep6E−58/44Porcine parvovirusRep16-5633/7 in 534 aac4.6mdEPLG-324
Cap6E−60/38Cap10-7152/5 in 707 aac
    WallabyScaffold_108040Rep4E−74/62Canine parvovirusRep341-6450/0 in 287 aa1.3meEPLG-37
Cap8E−37/32Cap35-7380/4 in 687 aa
Scaffold_72496Rep2E−61/42Porcine parvovirusRep23-5674/3 in 531 aa5.7meEPLG-630
Cap2E−31/38Cap10-5326/4 in 514 aa
Scaffold_88340Rep7E−37/55Mouse parvovirus 1Rep344-5660/3 in 223 aa6.7meEPLG-1636
Cap7E−22/33Cap11-7136/9 in 700 aa
Open in a separate windowaSome ambiguity in choosing the most similar virus is possible. We generally used the alignment with the lowest E value in the BLAST results. However, one or two points in the exponent of an E value were sometimes sacrificed to achieve a longer sequence alignment.baa, amino acids.cThese sequences have long insertions compared to the present-day viruses. In all cases tested, these insertions originated from short interspersed elements (SINEs). These insertions were excluded from the counts of stop codons and frameshifts and the estimation of integration age.dChr, chromosome.It is important to recognize that there is an intrinsic limit on how far back in time we can reach to identify ancient endogenous viral sequences. First, the sequences must be identified with confidence by BLAST or similar programs. This requirement places a lower limit on sequence identity at about 20 to 30% of amino acids, or about 75% of nucleotides (nucleotides evolve nearly 2.5 times slower than the amino acid sequence they encode). Second, the related, present-day virus must have evolved at a rate that is not much higher than that of the endogenous sequences. The viruses for which ancestral endogenous sequences were identified in this study exhibit sequence drift similar to that associated with mammalian genomes. Setting this rate at 0.14% per million years of evolution (8), we arrive at 90 million years as the theoretical limit for the oldest sequences that can be identified using our methods. This limit drops to less than 35 million years for endogenous viral sequences in rodents and even lower for sequences related to viruses that evolve faster than mammalian genomes.The most widespread integrations found in our survey are derived from the dependoviruses. These include nearly complete genomes related to adeno-associated virus (AAV) in microbat, wallaby, dolphin, rabbit, mouse, and baboon (Fig. (Fig.2).2). We did not detect inverted terminal repeats in several integrations tested, even though repeats are common in the present-day dependoviruses. This result could be explained by sequence decay or the absence of such structures in the ancestral viruses. However, we do see sequences that resemble degraded hairpin structures to which Dependovirus Rep proteins bind, with an example from microbat integration mlEDLG-1 shown in Fig. Fig.3.3. The second most widespread endogenous sequences are related to the parvoviruses. They are found in 6 of 49 vertebrate species considered, with nearly complete genomes in rat, opossum, wallaby, and guinea pig (Fig. (Fig.22).Open in a separate windowFIG. 3.Hairpin structure of the inverted terminal repeat of adeno-associated virus 2 (left) and a candidate degraded hairpin structure located close to the 5′ end of the mlEDLG-1 integration in microbats (right). Structures and mountain plots were generated using default parameters of the RNAfold program (5), with nucleotide coloring representing base-pairing probabilities: blue is below average, green is average, and red is above average. Mountain plots represent hairpin structures based on minimum free energy (mfe) calculations and partition function (pf) calculations, as well as the centroid structure (5). Height is expressed in numbers of nucleotides; position represents nucleotide.The Dependovirus AAV2 has strong bias for integration into human chromosome 19 during infection, driven by a host sequence that is recognized by the viral Rep protein(s). Rep mediates the formation of a synapse between viral and cellular sequences, and the cellular sequences are nicked to serve as an origin of viral replication (14). The related integrations in mice and rats, located in the same chromosomal locations, might be explained by such a mechanism. However, the extent of endogenous sequence decay and the frequency of stop codons indicate that these integrations occurred some 30 to 35 million years ago, implying that they are derived from a single event in a rodent ancestor rather than two independent integration events at the same location. Similarly, integrations EDLG-1 in dog and panda lie in chromosomal regions that can be readily aligned (based on University of California—Santa Cruz [UCSC] genome assemblies) and show sequence decay consistent with the age of the common ancestor, about 42 million years. Endogenous sequences related to the family Parvoviridae can thus be traced to over 40 million years back in time, and viral proteins related to this family have remained over 40% conserved.Sequences related to circoviruses were detected in five vertebrate species (Table (Table11 and Table S1 in the supplemental material). At least one of these sequences, the endogenous sequence in opossum, likely represents a recent integration. Several integrations in dog, cat, and panda, on the other hand, appear to date from at least 42 million years ago, which is the last time when pandas and dogs shared a common ancestor. We see evidence for this age in data from sequence degradation (Table (Table1),1), phylogenetic analyses of endogenous Circovirus-like genomes (see Fig. S2 in the supplemental material), and genomic synteny where integration ECLG-3 is surrounded by genes MTA3 and ARID5A in both dog and panda and integration ECLG-2 lies 35 to 43 kb downstream of gene UPF3A. In fact, Circovirus integrations may even precede the split between dogs and cats, about 55 million years ago, although the preliminary assembly and short genomic contigs for cats make synteny analysis impossible.The most common Circovirus-related sequences detected in vertebrate genomes are derived from the rep gene. We speculate that, like those of the Parvoviridae, the ancestral Circoviridae sequences might have been copied using a primer sequence in the host DNA that resembled the viral origin and was therefore recognized by the virus Rep protein. Higher incidence of rep gene identifications may represent higher conservation of this gene with time, or alternatively, possession of these sequences may impart some selective advantage to the host species. The largest Circovirus-related integration detected, in the opossum, comprises a short fragment of what may have been the cap gene immediately adjacent to and in the opposite orientation from the rep gene. This organization is similar to that of the present day Circovirus genome in which these genes share a promoter in the hairpin regions but are translated in opposite directions (Fig. (Fig.22).In summary, our results indicate that sequences derived from ancestral members of the families Parvoviridae and Circoviridae were integrated into their host''s genomes over the past 50 million years of evolution. Features of their replication strategies suggest mechanisms by which such integrations may have occurred. It is possible that some of the endogenous viral sequences could offer a selective advantage to the virus or the host. We note that rep open reading frame-derived proteins from some members of these families kill tumor cells selectively (3, 12). The genomic “fossils” we have discovered provide a unique glimpse into virus evolution but can give us only a lower estimate of the actual ages of these families. However, numerous recent integrations suggest that their germ line transfer has been continuing into present times.   相似文献   

7.
8.
Short-chain alcohol dehydrogenase, encoded by the gene Tsib_0319 from the hyperthermophilic archaeon Thermococcus sibiricus, was expressed in Escherichia coli, purified and characterized as an NADPH-dependent enantioselective oxidoreductase with broad substrate specificity. The enzyme exhibits extremely high thermophilicity, thermostability, and tolerance to organic solvents and salts.Alcohol dehydrogenases (ADHs; EC 1.1.1.1.) catalyze the interconversion of alcohols to their corresponding aldehydes or ketones by using different redox-mediating cofactors. NAD(P)-dependent ADHs, due to their broad substrate specificity and enantioselectivity, have attracted particular attention as catalysts in industrial processes (5). However, mesophilic ADHs are unstable at high temperatures, sensitive to organic solvents, and often lose activity during immobilization. In this relation, there is a considerable interest in ADHs from extremophilic microorganisms; among them, Archaea are of great interest. The representatives of all groups of NAD(P)-dependent ADHs have been detected in genomes of Archaea (11, 12); however, only a few enzymes have been characterized, and the great majority of them belong to medium-chain (3, 4, 14, 16, 19) or long-chain iron-activated ADHs (1, 8, 9). Up to now, a single short-chain archaeal ADH from Pyrococcus furiosus (10, 18) and only one archaeal aldo-keto reductase also from P. furiosus (11) have been characterized.Thermococcus sibiricus is a hyperthermophilic anaerobic archaeon isolated from a high-temperature oil reservoir capable of growth on complex organic substrates (15). The complete genome sequence of T. sibiricus has been recently determined and annotated (13). Several ADHs are encoded by the T. sibiricus genome, including three short-chain ADHs (Tsib_0319, Tsib_0703, and Tsib_1998) (13). In this report, we describe the cloning and expression of the Tsib_0319 gene from T. sibiricus and the purification and the biochemical characterization of its product, the thermostable short-chain ADH (TsAdh319).The Tsib_0319 gene encodes a protein with a size of 234 amino acids and the calculated molecular mass of 26.2 kDa. TsAdh319 has an 85% degree of sequence identity with short-chain ADH from P. furiosus (AdhA; PF_0074) (18). Besides AdhA, close homologs of TsAdh319 were found among different bacterial ADHs, but not archaeal ADHs. The gene flanked by the XhoI and BamHI sites was PCR amplified using two primers (sense primer, 5′-GTTCTCGAGATGAAGGTTGCTGTGATAACAGGG-3′, and antisense primer, 5′-GCTGGATCCTCAGTATTCTGGTCTCTGGTAGACGG-3′) and cloned into the pET-15b vector. TsAdh319 was overexpressed, with an N-terminal His6 tag in Escherichia coli Rosetta-gami (DE3) and purified to homogeneity by metallochelating chromatography (Hi-Trap chelating HP column; GE Healthcare) followed by gel filtration on Superdex 200 10/300 GL column (GE Healthcare) equilibrated in 50 mM Tris-HCl (pH 7.5) with 200 mM NaCl. The homogeneity and the correspondence to the calculated molecular mass of 28.7 kDa were verified by SDS-PAGE (7). The molecular mass of native TsAdh319 was 56 to 60 kDa, which confirmed the dimeric structure in solution.The standard ADH activity measurement was made spectrophotometrically at the optimal pH by following either the reduction of NADP (in 50 mM Gly-NaOH buffer; pH 10.5) or the oxidation of NADPH (in 0.1 M sodium phosphate buffer; pH 7.5) at 340 nm at 60°C. The enzyme exhibited a strong preference for NADP(H) and broad substrate specificity (Table (Table1).1). The highest oxidation rates were found with pentoses d-arabinose (2.0 U mg−1) and d-xylose (2.46 U mg−1), and the highest reduction rates were found with dimethylglyoxal (5.9 U mg−1) and pyruvaldehyde (2.2 U mg−1). The enzyme did not reduce sugars which were good substrates for the oxidation reaction. The kinetic parameters of TsAdh319 determined for the preferred substrates are shown in Table Table2.2. The enantioselectivity of the enzyme was estimated by measuring the conversion rates of 2-butanol enantiomers. TsAdh319 showed an evident preference, >2-fold, for (S)-2-butanol over (RS)-2-butanol. The enzyme stereoselectivity is confirmed by the preferred oxidation of d-arabinose over l-arabinose (Table (Table1).1). The fact that TsAdh319 is metal independent was supported by the absence of a significant effect of TsAdh319 preincubation with 10 mM Me2+ for 30 min before measuring the activity in the presence of 1 mM Me2+ or EDTA (Table (Table3).3). TsAdh319 also exhibited a halophilic property, so the enzyme activity increased in the presence of NaCl and KCl and the activation was maintained even at concentration of 4 M and 3 M, respectively (Table (Table33).

TABLE 1.

Substrate specificity of TsAdh319
SubstrateaRelative activity (%)
Oxidation reactionb
    Methanol0
    2-Methoxyethanol0
    Ethanol36
    1-Butanol80
    2-Propanol100
    (RS)-(±)-2-Butanol86
    (S)-(+)-2-Butanol196
    2-Pentanol67
    1-Phenylmethanol180
    1.3-Butanediol91
    Ethyleneglycol0
    Glycerol16
    d-Arabinose*200
    l-Arabinose*17
    d-Xylose*246
    d-Ribose*35
    d-Glucose*146
    d-Mannose*48
    d-Galactose*0
    Cellobiose*71
Reduction reactionc
    Pyruvaldehyde100
    Dimethylglyoxal270
    Glyoxylic acid36
    Acetone0
    Cyclopentanone0
    Cyclohexanone4
    3-Methyl-2-pentanone*13
    d-Arabinose*0
    d-Xylose*0
    d-Glucose*0
    Cellobiose*0
Open in a separate windowaSubstrates were present in 250 mM or 50 mM (*) concentrations.bRelative rates, measured under standard conditions, were calculated by defining the activity for 2-propanol as 100%, which corresponds to 1.0 U mg−1. Data are averages from triplicate experiments.cRelative rates, measured under standard conditions, were calculated by defining the activity for pyruvaldehyde as 100%, which corresponds to 2.2 U mg−1. Data are averages from triplicate experiments.

TABLE 2.

Apparent Km and Vmax values for TsAdh319
Coenzyme or substrateApparent Km (mM)Vmax (U mg−1)kcat (s−1)
NADPa0.022 ± 0.0020.94 ± 0.020.45 ± 0.01
NADPHb0.020 ± 0.0033.16 ± 0.111.51 ± 0.05
2-Propanol168 ± 291.10 ± 0.090.53 ± 0.04
d-Xylose54.4 ± 7.41.47 ± 0.090.70 ± 0.04
Pyruvaldehyde17.75 ± 3.384.26 ± 0.402.04 ± 0.19
Open in a separate windowaActivity was measured under standard conditions with 2-propanol. Data are averages from triplicate experiments.bActivity was measured under standard conditions with pyruvaldehyde. Data are averages from triplicate experiments.

TABLE 3.

Effect of various ions and EDTA on TsAdh319a
CompoundConcn (mM)Relative activity (%)
None0100
NaCl400206
600227
4,000230
KCl600147
2,000200
3,000194
MgCl21078
CoCl210105
NiSO410100
ZnSO41079
FeSO41074
EDTA1100
580
Open in a separate windowaThe activity was measured under standard conditions with 2-propanol; relative rates were calculated by defining the activity without salts as 100%, which corresponds to 0.9 U mg−1. Data are averages from duplicate experiments.The most essential distinctions of TsAdh319 are the thermophilicity and high thermostability of the enzyme. The optimum temperature for the 2-propanol oxidation catalyzed by TsAdh319 was not achieved. The initial reaction rate of oxidation increased up to 100°C (Fig. (Fig.1).1). The Arrhenius plot is a straight line, typical of a single rate-limited thermally activated process, but there is no obvious transition point due to the temperature-dependent conformational changes of the protein molecule. The activation energy for the oxidation of 2-propanol was estimated at 84.0 ± 5.8 kJ·mol−1. The thermostability of TsAdh319 was calculated from residual TsAdh319 activity after preincubation of 0.4 mg/ml enzyme solution in 50 mM Tris-HCl buffer (pH 7.5) containing 200 mM NaCl at 70, 80, 90, or 100°C. The preincubation at 70°C or 80°C for 1.5 h did not cause a decrease in the TsAdh319 activity, but provoked slight activation. The residual TsAdh319 activities began to decrease after 2 h of preincubation at 70°C or 80°C and were 10% and 15% down from the control, respectively. The determined half-life values of TsAdh319 were 2 h at 90°C and 1 h at 100°C.Open in a separate windowFIG. 1.Temperature dependence of the initial rate of the 2-propanol reduction by TsAdh319. The reaction was initiated by enzyme addition to a prewarmed 2-propanol-NADP mixture. The inset shows the Arrhenius plot of the same data.Protein thermostability often correlates with such important biotechnological properties as increased solvent tolerance (2). We tested the influence of organic solvents at a high concentration (50% [vol/vol]) on TsAdh319 by using either preincubation of the enzyme at a concentration of 0.2 mg/ml with solvents for 4 h at 55°C or solvent addition into the reaction mixture to distinguish the effect of solvent on the protein stability and on the enzyme activity. TsAdh319 showed significant solvent tolerance in both cases (Table (Table4),4), and the effects of solvents could be modulated by salts, acting apparently as molecular lyoprotectants (17). Furthermore, TsAdh319 maintained 57% of its activity in 25% (vol/vol) 2-propanol, which could be used as the cosubstrate in cofactor regeneration (6).

TABLE 4.

Influence of various solvents on TsAdh319 activitya
SolventRelative activity (%)bRelative activity (%)c
Buffer without NaClBuffer with 600 mM NaCl
None100100100
DMSOd98040
DMFAe1011341
Methanol98259
Acetonitrile9500
Ethyl acetate470*33*
Chloroform10579*81*
n-Hexane10560*118*
n-Decane3691*107*
Open in a separate windowaThe activity measured at the standard condition with 2-propanol as a substrate. Data are averages from triplicate experiments.bPreincubation for 4 h at 55°C in the presence of 50% (vol/vol) of solvent prior the activity assay.cWithout preincubation, solvent addition to the reaction mixture up to 50% (vol/vol) or using the buffer saturated by a solvent (*).dDMSO, dimethyl sulfoxide.eDMFA, dimethylformamide.From all the aforesaid we may suppose TsAdh319 or its improved variant to be interesting both for the investigation of structural features of protein tolerance and for biotechnological applications.  相似文献   

9.
10.
Hepatitis C virus (HCV)-specific CD8+ T cells in persistent HCV infection are low in frequency and paradoxically show a phenotype associated with controlled infections, expressing the memory marker CD127. We addressed to what extent this phenotype is dependent on the presence of cognate antigen. We analyzed virus-specific responses in acute and chronic HCV infections and sequenced autologous virus. We show that CD127 expression is associated with decreased antigenic stimulation after either viral clearance or viral variation. Our data indicate that most CD8 T-cell responses in chronic HCV infection do not target the circulating virus and that the appearance of HCV-specific CD127+ T cells is driven by viral variation.Hepatitis C virus (HCV) persists in the majority of acutely infected individuals, potentially leading to chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma. The cellular immune response has been shown to play a significant role in viral control and protection from liver disease. Phenotypic and functional studies of virus-specific T cells have attempted to define the determinants of a successful versus an unsuccessful T-cell response in viral infections (10). So far these studies have failed to identify consistent distinguishing features between a T-cell response that results in self-limiting versus chronic HCV infection; similarly, the impact of viral persistence on HCV-specific memory T-cell formation is poorly understood.Interleukin-7 (IL-7) receptor alpha chain (CD127) is a key molecule associated with the maintenance of memory T-cell populations. Expression of CD127 on CD8 T cells is typically only observed when the respective antigen is controlled and in the presence of significant CD4+ T-cell help (9). Accordingly, cells specific for persistent viruses (e.g., HIV, cytomegalovirus [CMV], and Epstein-Barr virus [EBV]) have been shown to express low levels of CD127 (6, 12, 14) and to be dependent on antigen restimulation for their maintenance. In contrast, T cells specific for acute resolving virus infections, such as influenza virus, respiratory syncytial virus (RSV), hepatitis B virus (HBV), and vaccinia virus typically acquire expression of CD127 rapidly with the control of viremia (5, 12, 14). Results for HCV have been inconclusive. The expected increase in CD127 levels in acute resolving but not acute persisting infection has been found, while a substantial proportion of cells with high CD127 expression have been observed in long-established chronic infection (2). We tried to reconcile these observations by studying both subjects with acute and chronic HCV infection and identified the presence of antigen as the determinant of CD127 expression.Using HLA-peptide multimers we analyzed CD8+ HCV-specific T-cell responses and CD127 expression levels in acute and chronic HCV infection. We assessed a cohort of 18 chronically infected subjects as well as 9 individuals with previously resolved infection. In addition, we longitudinally studied 9 acutely infected subjects (5 individuals who resolved infection spontaneously and 4 individuals who remain chronically infected) (Tables (Tables11 and and2).2). Informed consent in writing was obtained from each patient, and the study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki, as reflected in a priori approval from the local institutional review boards. HLA-multimeric complexes were obtained commercially from Proimmune (Oxford, United Kingdom) and Beckman Coulter (CA). The staining and analysis procedure was as described previously (10). Peripheral blood mononuclear cells (PBMCs) were stained with the following antibodies: CD3 from Caltag; CD8, CD27, CCR7, CD127, and CD38 from BD Pharmingen; and PD-1 (kindly provided by Gordon Freeman). Primer sets were designed for different genotypes based on alignments of all available sequences from the public HCV database (http://hcvpub.ibcp.fr). Sequence analysis was performed as previously described (8).

TABLE 1.

Patient information and autologous sequence analysis for patients with chronic and resolved HCV infection
CodeGenotypeStatusEpitope(s) targetedSequencea
02-031bChronicA1 NS3 1436-1444P: ATDALMTGY
A: no sequence
00-261bChronicA1 NS3 1436-1444P: ATDALMTGY
A: no sequence
99-242aChronicA2 NS3 1073-1083P: CINGVCWTV
No recognitionA: S-S--L---
A2 NS3 1406-1415P: KLVALGINAV
No recognitionA: A-RGM-L---
A2 NS5B 2594-2602P: ALYDVVTKL
A: no sequence
1111aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
A2 NS5 2594-2602P: ALYDVVTKL
A: ---------
00X3aChronicA2 NS5 2594-2602P: ALYDVVTKL
No recognitionA: -----IQ--
O3Qb1aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
03Sb1aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
02A1aChronicA1 NS3 1436-1444P: ATDALMTGY
A: no sequence
01N1aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
03H1aChronicA2 NS3 1073-1083P: CINGVCWTV
Full recognitionA: ----A----
01-391aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
03-45b1aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
06P3aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
GS127-11aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
GS127-61aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
GS127-81bChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
GS127-161aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
GS127-201aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
04D4ResolvedA2 NS5 1987-1996P: VLSDFKTWKL
01-49b1ResolvedA2 NS5 1987-1996P: VLSDFKTWKL
A2 NS3 1406-1415P: KLVALGINAV
01-311ResolvedA1 NS3 1436-1444P: ATDALMTGY
B57 NS5 2629-2637P: KSKKTPMGF
04N1ResolvedA1 NS3 1436-1444P: ATDALMTGY
01E4ResolvedA2 NS5 1987-1996P: VLSDFKTWKL
98A1ResolvedA2 NS3 1073-1083P: CINGVCWTV
00-10c1ResolvedA24 NS4 1745-1754P: VIAPAVQTNW
O2Z1ResolvedA1 NS3 1436-1444P: ATDALMTGY
99-211ResolvedB7 CORE 41-49P: GPRLGVRAT
OOR1ResolvedB35 NS3 1359-1367P: HPNIEEVAL
Open in a separate windowaP, prototype; A, autologous. Identical residues are shown by dashes.bHIV coinfection.cHBV coinfection.

TABLE 2.

Patient information and autologous sequence analysis for patients with acute HCV infection
CodeGenotypeOutcomeEpitope targeted and time analyzedSequencea
5541aPersistingA2 NS3 1073-1083P: CINGVCWTV
wk 8A: ---------
wk 30A: ---------
03-321aPersistingB35 NS3 1359-1367P: HPNIEEVAL
wk 8A: ---------
No recognition (wk 36)A: S--------
04-111a (1st)Persisting (1st) Resolving (2nd)A2 NS5 2594-2602P: ALYDVVTKL
1b (2nd)A: no sequence
00231bPersistingA1 NS3 1436-1444P: ATDALMTGY
Diminished (wk 7)A: --------F
Diminished (wk 38)A: --------F
A2 NS3 1073-1083P: CINGVCWTV
wk 7A: ---------
wk 38A: ---------
A2 NS3 1406-1415P: KLVALGINAV
Full recognition (wk 7)A: --S-------
Full recognition (wk 38)A: --S-------
3201ResolvingA2 NS3 1273-1282P: GIDPNIRTGV
5991ResolvingA2 NS3 1073-1083P: CINGVCWTV
11441ResolvingA2 NS3 1073-1083P: CINGVCWTV
B35 NS3 1359-1367P: HPNIEEVAL
06L3aResolvingB7 CORE 41-49P: GPRLGVRAT
05Y1ResolvingA2 NS3 1073-1083P: CINGVCWTV
Open in a separate windowaP, prototype; A, autologous. Identical residues are shown by dashes.In established persistent infection, CD8+ T-cell responses against HCV are infrequently detected in blood using major histocompatibility complex (MHC) class I tetramers and are only observed in a small fraction of those sampled (10). We were able to examine the expression of CD127 on antigen-specific T cells in such a group of 18 individuals. We observed mostly high levels of CD127 expression (median, 66%) on these populations (Fig. (Fig.1a),1a), although expression was higher on HCV-specific T-cell populations from individuals with resolved infection (median, 97%; P = 0.0003) (Fig. 1a and c). Importantly, chronically infected individuals displayed CD127 expression levels over a much broader range than resolved individuals (9.5% to 100% versus 92 to 100%) (Fig. (Fig.1a1a).Open in a separate windowFIG. 1.Chronically infected individuals express a range of CD127 levels on HCV-specific T cells. (a) CD127 expression levels on HCV-specific T-cell populations in individuals with established chronic or resolved infection. While individuals with resolved infection (11 tetramer stains in 9 subjects) uniformly express high levels of CD127, chronically infected individuals (21 tetramer stains in 18 subjects) express a wide range of CD127 expression levels. (b) CD127 expression levels are seen to be highly dependent on sequence match with the autologous virus, based on analysis of 9 responses with diminished recognition of the autologous virus and 8 responses with intact epitopes. (c) CD127 expression levels on HCV-specific T-cell B7 CORE 41-49-specific T cells from individual 01-49 with resolved HCV infection (left-hand panel). Lower CD127 expression levels are observed on an EBV-specific T-cell population from the same individual (right-hand panel). APC-A, allophycocyanin-conjugated antibody. (d) Low CD127 levels are observed on A2 NS3 1073-1083 HCV-specific T cells from individual 111 with chronic HCV infection in whom sequencing revealed an intact autologous sequence.Given the relationship between CD127 expression and antigenic stimulation as well as the potential of HCV to escape the CD8 T-cell response through viral mutation, we sequenced the autologous circulating virus in subjects with chronic infection (Table (Table1).1). A perfect match between the optimal epitope sequence and the autologous virus was found for only 8 responses. These were the only T-cell populations with lower levels of CD127 expression (Fig. (Fig.1a,1a, b, and d). In contrast, HCV T-cell responses with CD127 expression levels comparable to those observed in resolved infection (>85%) were typically mismatched with the viral sequence, with some variants compatible with viral escape and others suggesting infection with a non-genotype 1 strain (10) (Fig. (Fig.1).1). Enzyme-linked immunospot (ELISPOT) assays using T-cell lines confirmed the complete abrogation of T-cell recognition and thus antigenic stimulation in cases of cross-genotype mismatch (10). Responses targeting the epitope A1-143D expressed somewhat lower levels of CD127 (between 70% and 85%). Viral escape (Y to F at position 9) in this epitope has been shown to be associated with significantly diminished but not fully abolished recognition (11a), and was found in all chronically infected subjects whose T cells targeted this epitope. Thus, expression of CD127 in the presence of viremia is closely associated with the capacity of the T cell to recognize the circulating virus.That a decrease in antigenic stimulation is indeed associated with the emergence of CD127-expressing CD8 T cells is further demonstrated in subject 111. This subject with chronic infection targeted fully conserved epitopes with T cells with low CD127 expression; with clearance of viremia under antiviral therapy, CD127-negative HCV-specific CD8 T cells were no longer detectable and were replaced by populations expressing CD127 (data not shown). Overall these data support the notion that CD127 expression on HCV-specific CD8+ T-cell populations is dependent on an absence of ongoing antigenic stimulation.To further evaluate the dynamic relationship between antigenic stimulation and CD127 expression, we also analyzed HCV-specific T-cell responses longitudinally during acute HCV infection (Fig. (Fig.2a).2a). CD127 expression was generally low or absent during the earliest time points. After resolution of infection, we see a contraction of the HCV-specific T-cell response together with a continuous increase in CD127 expression, until virtually all tetramer-positive cells express CD127 approximately 6 months after the onset of disease (Fig. (Fig.2a).2a). A similar increase in CD127 expression was not seen in one subject (no. 554) with untreated persisting infection that maintained a significant tetramer-positive T-cell population for an extended period of time (Fig. (Fig.2a).2a). Importantly, sequence analysis of the autologous virus demonstrated the conservation of this epitope throughout persistent infection (8). In contrast, subject 03-32 (with untreated persisting infection) developed a CD8 T-cell response targeting a B35-restricted epitope in NS3 from which the virus escaped (8). The T cells specific for this epitope acquired CD127 expression in a comparable manner to those controlling infection (Fig. (Fig.2a).2a). In other subjects with persisting infection, HCV-specific T-cells usually disappeared from blood before the time frame in which CD127 upregulation was observed in the other subjects.Open in a separate windowFIG. 2.CD127 expression levels during acute HCV infection. (a) CD127 expression levels on HCV-specific T cells during the acute phase of HCV infection (data shown for 5 individuals who resolve and two individuals who remain chronically infected). (b) HCV RNA viral load and CD127 expression levels on HCV-specific T cells (A2 NS3 1073-1083 and A1 NS3 1436-1444) for chronically infected individual 00-23. PEG-IFN-α, pegylated alpha interferon. (c) Fluorescence-activated cell sorter (FACS) plots showing longitudinal CD127 expression levels on HCV-specific T cells (A2 NS3 1073-1083 and A1 NS3 1436-1444) from individual 00-23.We also characterized the levels of CD127 expression on HCV-specific CD4+ T-cell populations with similar results: low levels were observed during the acute phase of infection and increased levels in individuals after infection was cleared (data not shown). CD127 expression on CD4 T cells could not be assessed in viral persistence since we failed to detect significant numbers of HCV-specific CD4+ T cells, in agreement with other reports.In our cohort of subjects with acute HCV infection, we had the opportunity to study the effect of reencounter with antigen on T cells with high CD127 expression in 3 subjects in whom HCV viremia returned after a period of viral control. Subject 00-23 experienced viral relapse after interferon treatment (11), while subjects 05-13 and 04-11 were reinfected with distinct viral isolates. In all subjects, reappearance of HCV antigen that corresponded to the HCV-specific T-cell population was associated with massive expansion of HCV-specific T-cell populations and a decrease in CD127 expression on these T cells (Fig. (Fig.22 and and3)3) (data not shown). In contrast, T-cell responses that did not recognize the current viral isolate did not respond with an expansion of the population or the downregulation of CD127. This was observed in 00-23, where the sequence of the A1-restricted epitope 143D was identical to the frequent escape mutation described above in chronically infected subjects associated with diminished T-cell recognition (Fig. (Fig.2b2b and and3a).3a). In 05-13, the viral isolate during the second episode of viremia contained a variant in one of the anchor residues of the epitope A2-61 (Fig. (Fig.2d).2d). These results show that CD127 expression on HCV-specific T cells follows the established principles observed in other viral infections.Open in a separate windowFIG. 3.Longitudinal phenotypic changes on HCV-specific T cells. (a) HCV RNA viral load and CD127 expression (%) levels on A2 NS5B 2594-2602 HCV-specific T cells for individual 04-11. This individual was administered antiviral therapy, which resulted in a sustained virological response. Following reinfection, the individual spontaneously cleared the virus. (b) Longitudinal frequency of A2 NS5B 2594-2602 HCV-specific T cells and PD-1 expression levels (mean fluorescent intensity [MFI]) for individual 04-11. (c) Longitudinal analysis of 04-11 reveals the progressive differentiation of HCV-specific A2 259F CD8+ T cells following repetitive antigenic stimulation. FACS plots show longitudinal CD127, CD27, CD57, and CCR7 expression levels on A2 NS5B 2594-2602 tetramer-positive cells from individual 04-11. PE-A, phycoerthrin-conjugated antibody.In addition to the changes in CD127 expression for T cells during reencounter with antigen, we detected comparable changes in other phenotypic markers shortly after exposure to viremia. First, we detected an increase in PD-1 and CD38 expression—both associated with recent T-cell activation. Additionally, we observed a loss of CD27 expression, a feature of repetitive antigenic stimulation (Fig. (Fig.3).3). The correlation of CD127 and CD27 expression further supports the notion that CD127 downregulation is a marker of continuous antigenic stimulation (1, 7).In conclusion we confirm that high CD127 expression levels are common for detectable HCV-specific CD8+ T-cell populations in chronic infection and find that this phenotype is based on the existence of viral sequence variants rather than on unique properties of HCV-specific T cells. This is further demonstrated by our data from acute HCV infection showing that viral escape as well as viral resolution is driving the upregulation of CD127. We also show that some, but not all, markers typically used to phenotypically describe virus-specific T cells show a similar dependence on cognate HCV antigen. Our data further highlight that sequencing of autologous virus is vital when interpreting data obtained in chronic HCV infection and raise the possibility that previous studies, focused on individuals with established chronic infection, may have been confounded by antigenic variation within epitopes or superinfection with different non-cross-reactive genotypes. Interestingly, it should be pointed out that this finding is supported by previous data from both the chimpanzee model of HCV and from human HBV infection (3, 13).Overall our data clearly demonstrate that the phenotype of HCV-specific CD8+ T cells is determined by the level of antigen-specific stimulation. The high number of CD127 positive virus-specific CD8+ T cells that is associated with the presence of viral escape mutations is a hallmark of chronic HCV infection that clearly separates HCV from other chronic viral infections (4, 14).  相似文献   

11.
12.
13.
14.
15.
16.
17.
18.
19.
A molecular diagnostic system using single nucleotide polymorphisms (SNPs) was developed to identify four Sclerotinia species: S. sclerotiorum (Lib.) de Bary, S. minor Jagger, S. trifoliorum Erikss., and the undescribed species Sclerotinia species 1. DNAs of samples are hybridized with each of five 15-bp oligonucleotide probes containing an SNP site midsequence unique to each species. For additional verification, hybridizations were performed using diagnostic single nucleotide substitutions at a 17-bp sequence of the calmodulin locus. The accuracy of these procedures was compared to that of a restriction fragment length polymorphism (RFLP) method based on Southern hybridizations of EcoRI-digested genomic DNA probed with the ribosomal DNA-containing plasmid probe pMF2, previously shown to differentiate S. sclerotiorum, S. minor, and S. trifoliorum. The efficiency of the SNP-based assay as a diagnostic test was evaluated in a blind screening of 48 Sclerotinia isolates from agricultural and wild hosts. One isolate of Botrytis cinerea was used as a negative control. The SNP-based assay accurately identified 96% of Sclerotinia isolates and could be performed faster than RFLP profiling using pMF2. This method shows promise for accurate, high-throughput species identification.Sclerotinia is distinguished morphologically from other genera in the Sclerotiniaceae (Ascomycota, Pezizomycotina, Leotiomycetes) by the production of tuberoid sclerotia that do not incorporate host tissue, by the production of microconidia that function as spermatia but not as a disseminative asexual state, and by the development of a layer of textura globulosa composing the outer tissue of apothecia (8). Two hundred forty-six species of Sclerotinia have been reported, most distinguished morphotaxonomically (Index Fungorum [www.indexfungorum.org]). These include the four species of agricultural importance now recognized plus many that are imperfectly known, seldom collected, or apparently endemic to relatively small geographic areas (2, 5, 6, 7, 8, 9, 17).The main species of phythopathological interest in the genus Sclerotinia are S. sclerotiorum (Lib.) de Bary, S. minor Jagger, S. trifoliorum Erikss., and the undescribed species Sclerotinia species 1. Sclerotinia species 1 is an important cause of disease in vegetables in Alaska (16) and has been found in association with wild Taraxacum sp., Caltha palustris, and Aconitum septentrionalis in Norway (7). It is morphologically indistinguishable from S. sclerotiorum, but it was shown to be a distinct species based on distinctive polymorphisms in sequences from internal transcribed spacer 2 (ITS2) of the nuclear ribosomal repeat (7). The other three species have been delimited using morphological, cytological, biochemical, and molecular characters (3, 8, 9, 10, 12, 15). Interestingly, given that the ITS is sufficiently polymorphic in many fungal genera to resolve species, in Sclerotinia, only species 1 and S. trifoliorum are distinguished by characteristic ITS sequence polymorphisms; S. sclerotiorum and S. minor cannot be distinguished based on ITS sequence (2, 7).Sclerotinia sclerotiorum is a necrotrophic pathogen with a broad host range (1). S. minor has a more restricted host range but causes disease in a variety of important crops such as lettuce, peanut, and sunflower crops (11). S. trifoliorum has a much narrower host range, limited to the Fabaceae (3, 8, 9). Sclerotial and ascospore characteristics also serve to differentiate among the three species. Sclerotinia minor has small sclerotia that develop throughout the colony in vitro and aggregate to form crusts on the host, while the sclerotia of S. sclerotiorum and S. trifoliorum are large and form at the colony periphery in vitro, remaining separate on the host (8, 9). The failure of an isolate to produce sclerotia or apothecia in vitro is not unusual, especially after serial cultivation (8). The presence of dimorphic, tetranucleate ascospores characterizes S. trifoliorum, while S. sclerotiorum and S. minor both have uniformly sized ascospores that are binucleate and tetranucleate, respectively (9, 14).With the apparent exception of Sclerotinia species 1, morphological characteristics are sufficient to delimit Sclerotinia species given that workers have all manifestations of the life cycle in hand. In cultures freshly isolated from infected plants, investigators usually have mycelia and sclerotia but not apothecia. Restriction fragment length polymorphisms (RFLPs) in ribosomal DNA (rDNA) are diagnostic for Sclerotinia species (3, 10), but the assay requires cloned probes (usually accessed from other laboratories) hybridized to Southern blots from vertical gels, an impractical procedure for large samples. We have analyzed sequence data from previous phylogenetic studies (2) and have identified diagnostic variation for the rapid identification of the four Sclerotinia species. The single nucleotide polymorphism (SNP) assay that we report here is amenable to a high throughput of samples and requires only PCR amplification with a standard set of primers and oligonucleotide hybridizations to Southern blots in a dot format.The SNP assay was performed using two independent sets of species-specific oligonucleotide probes, all with SNP sites shown to differentiate the four Sclerotinia species (Fig. (Fig.1).1). A panel of 49 anonymously coded isolates (Table (Table1)1) was screened using these species-specific SNP probes, as outlined in Fig. Fig.1.1. The assay was validated by comparison to Southern hybridizations of EcoRI-digested genomic DNA hybridized with pMF2, a plasmid probe containing the portion of the rDNA repeat with the 18S, 5.8S, and 26S rRNA cistrons of Neurospora crassa (4, 10).Open in a separate windowFIG. 1.Protocol for the SNP-based identification of Sclerotinia species, with diagnostic SNP sites underlined and in boldface type for each hybridization probe.

TABLE 1.

Isolates and hybridization results for all SNP-based oligonucleotide probesf
Collector''s isolateAnonymous codePrescreened presumed species identityOriginHostSpecies-specific SNP
IGS50CAL448 S.trifolCAL124CAL448 S.minorRAS148CAL446 S.sp1CAL19ACAL19BCAL448 S.sclero
LMK1849Botrytis cinereaOntario, CanadaAllium cepa
FA2-13Sclerotinia minorNorth CarolinaArachis hypogaea++
W15Sclerotinia minorNorth CarolinaCyperus esculentus++
W1030Sclerotinia minorNorth CarolinaOenothra laciniata++
PF1-138Sclerotinia minorNorth CarolinaArachis hypogaea++
PF18-49714Sclerotinia minorOklahomaArachis hypogaea++
PF17-48246Sclerotinia minorOklahomaArachis hypogaea++
PF19-51948Sclerotinia minorOklahomaArachis hypogaea++
LF-2720Sclerotinia minorUnited StatesLactuca sativa++
AR12811Sclerotinia sclerotiorumArgentinaArachis hypogaea++
AR128216Sclerotinia sclerotiorumArgentinaArachis hypogaea++
LMK2116Sclerotinia sclerotiorumCanadaBrassica napus++
LMK5725Sclerotinia sclerotiorumNorwayRanunculus ficaria++
LMK75415Sclerotinia sclerotiorumNorwayRanunculus ficaria++
UR1939Sclerotinia sclerotiorumUruguayLactuca sativa++
UR4789Sclerotinia sclerotiorumUruguayLactuca sativa++
CA90132Sclerotinia sclerotiorumCaliforniaLactuca sativa++
CA99540Sclerotinia sclerotiorumCaliforniaLactuca sativa++
CA104441Sclerotinia sclerotiorumCaliforniaLactuca sativa++
1980a34Sclerotinia sclerotiorumNebraskaPhaseolus vulgaris++
Ss00113Sclerotinia sclerotiorumNew YorkbGlycine max++
Ssp00531Sclerotinia sclerotiorumNew YorkGlycine max++
H02-V2833Sclerotinia species 1AlaskacUnknown vegetable crop++
H01-V1426Sclerotinia species 1AlaskaUnknown vegetable crop++
LMK74521Sclerotinia species 1NorwayTaraxacum sp.++
02-2611Sclerotinia trifoliorumFinlanddTrifolium pratense+
06-1429Sclerotinia trifoliorumFinlandTrifolium pratense++
2022Sclerotinia trifoliorumFinlandTrifolium pratense++
2-L945Sclerotinia trifoliorumFinlandTrifolium pratense++
3-A524Sclerotinia trifoliorumFinlandTrifolium pratense
5-L912Sclerotinia trifoliorumFinlandTrifolium pratense++
K14Sclerotinia trifoliorumFinlandTrifolium pratense++
K237Sclerotinia trifoliorumFinlandTrifolium pratense++
L-11223Sclerotinia trifoliorumFinlandTrifolium pratense++
L-11944Sclerotinia trifoliorumFinlandTrifolium pratense++
LMK3619Sclerotinia trifoliorumTasmaniaTrifolium repens++
Ssp00118Sclerotinia trifoliorumNew YorkLotus corniculatus++
Ssp00210Sclerotinia trifoliorumNew YorkLotus corniculatus++
Ssp00328Sclerotinia trifoliorumNew YorkLotus corniculatus++
Ssp00436Sclerotinia trifoliorumNew YorkLotus corniculatus++
LMK4743Sclerotinia trifoliorumVirginiaMedicago sativa++
MBRS-127UnknownAustraliaeBrassica spp.++
MBRS-27UnknownAustraliaBrassica spp.++
MBRS-342UnknownAustraliaBrassica spp.++
MBRS-522UnknownAustraliaBrassica spp.++
WW-135UnknownAustraliaBrassica spp.++
WW-28UnknownAustraliaBrassica spp.++
WW-317UnknownAustraliaBrassica spp.++
WW-447UnknownAustraliaBrassica spp.++
Open in a separate windowaThe annotated genome for S. sclerotiorum strain 1980 (ATCC 18683) is publicly available through the Broad Institute, Cambridge, MA (http://www.broad.mit.edu/annotation/genome/sclerotinia_sclerotiorum/Home.html).bAll isolates from New York were provided by Gary C. Bergstrom, Cornell University, Ithaca, NY. Isolates Ss001 and Ssp005 were submitted as S. sclerotiorum, and Ssp001 through Ssp004 were submitted as S. trifoliorum.cAll isolates from Alaska, submitted as Sclerotinia species 1, were provided by Lori Winton, USDA-ARS Subarctic Agricultural Research Unit, University of Alaska, Fairbanks.dAll isolates from Finland, submitted as S. trifoliorum, were provided by Tapani Yli-Mattila, University of Turku, Turku, Finland.eAll isolates from Australia, presumed to be S. sclerotiorum but requiring species confirmation, were provided by Martin Barbetti, DAF Plant Protection Branch, South Perth, Australia.fThe probes that are diagnostic for S. minor, S. sclerotiorum, S. trifoliorum, and Sclerotinia species 1 are listed, with a “+” indicating a positive hybridization for the probe and a “−” indicating no hybridization of the probe.  相似文献   

20.
A 30-probe assay was developed for simultaneous classification of Listeria monocytogenes isolates by lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (EC) type (ECI, ECIa, ECII, and ECIII). The assay was designed to facilitate rapid strain characterization and the integration of subtype data into risk-based inspection programs.Listeria monocytogenes is a facultative intracellular pathogen that can cause serious invasive illness (listeriosis) in humans and other animals. L. monocytogenes is responsible for over 25% of food-borne-disease-related deaths attributable to known pathogens and is a leading cause of food recalls due to microbial adulteration (12, 21). However, not all L. monocytogenes subtypes contribute equally to human illness, and substantial differences in the ecologies and virulence attributes of different L. monocytogenes subtypes have been identified (9, 13, 14, 23, 24, 33, 35, 36). Among the four major evolutionary lineages of L. monocytogenes, only lineages I and II are commonly isolated from contaminated food and human listeriosis patients (19, 27, 29, 33). Lineage I strains are overrepresented among human listeriosis isolates, particularly those associated with epidemic outbreaks, whereas lineage II strains are overrepresented in foods and the environment (13, 14, 24). Lineage III strains account for approximately 1% of human listeriosis cases but are common among animal listeriosis isolates and appear to be a host-adapted group that is poorly adapted to food-processing environments (6, 34-36). The ecological and virulence attributes of lineage IV are poorly understood, as this lineage is rare and was only recently described based on a small number of strains (19, 26, 29, 33).L. monocytogenes is differentiated into 13 serotypes; however, four major serogroups (4b, 1/2b, 1/2a, and 1/2c) from within lineages I and II account for more than 98% of human and food isolates (16, 31). Serogroups refer to evolutionary complexes typified by a predominant serotype but which include very rare serotypes that represent minor evolutionary variants (7, 9, 33). Phylogenetic analyses have indicated that rare serotypes may have evolved recently, or even multiple times, from one of the major serotypes (9), and numerous molecular methods fail to discriminate minor serotypes as independent groups (1, 4, 7, 9, 18, 22, 33, 38, 39). Serotyping is one of the most common methods for L. monocytogenes subtyping, and serogroup classifications are a useful component of strain characterization because ecotype divisions appear largely congruent with serogroup distinctions (16, 34). Serogroup 4b strains are of particular public health concern because contamination with these strains appears to increase the probability that a ready-to-eat (RTE) food will be implicated in listeriosis (16, 28). Serogroup 4b strains account for approximately 40% of sporadic listeriosis and also are responsible for the majority of listeriosis outbreaks despite being relatively rare contaminants of food products (9, 13, 17, 30, 34). In addition, serogroup 4b strains are associated with more severe clinical presentations and higher mortality rates than other serogroups (11, 16, 20, 31, 34). Serogroups 1/2a and 1/2b are overrepresented among food isolates but also contribute significantly to human listeriosis, whereas serogroup 1/2c rarely causes human illness and may pose a lower risk of listeriosis for humans (16). Serogroup-specific differences in association with human listeriosis are consistent with the prevalence of virulence-attenuating mutations in inlA within these serogroups (32, 34); however, a number of additional factors likely contribute to these differences.Four previously described epidemic clones (ECs; ECI, ECIa, ECII, and ECIII) of L. monocytogenes have been implicated in numerous listeriosis outbreaks and have contributed significantly to sporadic illness (15, 34). ECI, ECIa, and ECII are distinct groups within serogroup 4b that were each responsible for repeated outbreaks of listeriosis in the United States and Europe. ECIII is a lineage II clone of serotype 1/2a that persisted in the same processing facility for more than a decade prior to causing a multistate outbreak linked to contaminated turkey (15, 25). While there has been speculation that epidemic clones possess unique adaptations that explain their frequent involvement in listeriosis outbreaks (9, 34, 37), it is not clear that epidemic clones are more virulent than other strains with the same serotype. However, contamination of RTE food with EC strains would be cause for increased concern due to the previous involvement of these clones in major outbreaks of listeriosis (16).As a result of the L. monocytogenes subtype-specific differences in ecology, virulence, and association with human illness, molecular subtyping technologies have the potential to inform assessments of relative risk and to improve risk-based inspection programs. The objective of the present study was to develop a single assay for rapid and accurate classification of L. monocytogenes isolates by lineage, major serogroup, and epidemic clone in order to facilitate strain characterization and the integration of subtype data into inspection programs that are based on assessment of relative risk.A database of more than 5.3 Mb of comparative DNA sequences from 238 L. monocytogenes isolates (9, 33-35) was scanned for single nucleotide polymorphisms that could be used to differentiate lineages, major serogroups, and epidemic clones via a targeted multilocus genotyping (TMLGT) approach. The acronym TMLGT is used to distinguish this approach from previously published multilocus genotyping (MLGT) assays that were lineage specific and designed for haplotype discrimination (9, 33). To provide for simultaneous interrogation of the selected polymorphisms via TMLGT, six genomic regions (Table (Table1)1) were coamplified in a multiplex PCR. While the previous MLGT assays were based on three lineage-specific multiplexes and required prior identification of lineage identity, TMLGT was designed to target variation across all of the lineages simultaneously and is based on a unique set of amplicons. PCR was performed in 50-μl volumes with 1× High Fidelity PCR buffer (Invitrogen Life Technologies), 2 mM MgSO4, 100 μM deoxynucleoside triphosphate (dNTP), 300 nM primer, 1.5 U Platinum Taq high-fidelity DNA polymerase (Invitrogen Life Technologies), and 100 ng of genomic DNA. PCR consisted of an initial denaturation of 90 s at 96°C, followed by 40 cycles of 30 s at 94°C, 30 s at 50°C, and 90 s at 68°C. Amplification products were purified using Montage PCR cleanup filter plates (Millipore) and served as a template for allele-specific primer extension (ASPE) reactions utilizing subtype-specific probes.

TABLE 1.

Primers used in multiplex amplification for the TMLGT assay
AmpliconPositionaGene(s)PrimerSequence (5′-3′)b
INLa455381-456505inlAinl2-a1GTCCTTGATAGTCTACTG
inl2-a2ACCAAATTAGTAATCTAGCAC
INLb457726-458752inlBinl-f1dGAATTRTTTAGYCAAGAATGT
inlb-rCTACCGGRACTTTATAGTAYG
LMO325116-326096lmo0298-lmo0300lmo-a1AAGGCTTACAAGATGGCT
lmo1a-1rAAATAATAYGTGATACCGAC
VGCa205366-206622plcA, hlyplca-fCTCATCGTATCRTGTGTACC
hly-rTCTGGAAGGTCKTGTAGGTTC
VGCb208447-209465mplra_mpl-fGTGGAYAGAACTCATAAAGG
ra_mpl-rACTCCCTCCTYGTGATASGCT
VGCc209728-211239actAvgc1a-2fTTCMATRCCAGCAGAACG
vgc1a-2rGCAGACCTAATAGCAATGTTG
Open in a separate windowaCorresponding nucleotide positions in the complete genome sequence of L. monocytogenes strain EGD-e (GenBank accession number NC_003210).bSee IUPAC codes for definition of degenerate bases.ASPE was performed in multiplex reactions including 30 probes, with each lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (ECI, ECIa, ECII, and ECIII) targeted by two different probes (Table (Table2).2). In addition, positive-control probes were included to confirm the presence of each amplicon in the multiplex PCR. As serogroups and epidemic clones are nested within a particular lineage, probes for these groups were designed to be specific within the appropriate lineage and values for these probes were evaluated only for isolates of the appropriate lineage. For example, serogroup 1/2a probes were evaluated only for isolates that were positive for lineage II probes. ASPE probes were designed with a unique 5′ sequence tag specific to individual sets of xMAP fluorescent polystyrene microspheres (Luminex Corporation) used to sort extension products. Extension and hybridization reactions were performed as described previously (9) except microspheres were twice pelleted by centrifugation (4 min at 2,250 × g) and resuspended in 75 μl 1× TM buffer prior to being pelleted and resuspended in 100 μl 1× TM buffer containing 2 μg/ml streptavidin-R-phycoerythrin (Invitrogen Life Technologies). Samples were incubated for 15 min at 37°C prior to detecting the microsphere complexes with a Luminex 100 flow cytometer (Luminex Corporation). The median fluorescence intensity (MFI) from biotinylated extension products attached to 100 microspheres was measured for each probe. The average MFI from three template-free control samples was also determined and subtracted from the raw MFI of each sample to account for background fluorescence. Probe performance was initially evaluated via the index of discrimination (ID) as described by Ducey et al. (9), and probes with ID values less than 2.0 were redesigned.

TABLE 2.

TMLGT probes and probe performance data
ProbebTarget (n)cProbe sequencedIDeSensitivity (%)Specificity (%)
VGCb-21Lineage I (506)AATCCTTTCTTTAATCTCAAATCAgcggaagcttgggaagcggtc7.3100100
VGCa-94Lineage ICTTTCTATCTTTCTACTCAATAATcaacccgatgttcttcctgtc51.7100100
VGCc-8Lineage II (340)AATCCTTTTACATTCATTACTTACattagctgattcgctttcct14.1100100
INLb-51Lineage IITCATTTCAATCAATCATCAACAATagcgccaataaagctggc21.9100100
VGCb-19Lineage III (50)TCAATCAATTACTTACTCAAATACccgctattaaaatgtactcca31.0100100
VGCb-29Lineage IIIAATCTTACTACAAATCCTTTCTTTggtataccgctattaaaatgt45.1100100
LMO-17Lineage IV (10)CTTTAATCCTTTATCACTTTATCAgaaccaaacaatgttattggt11.8100100
VGCa-27Lineage IVCTTTTCAAATCAATACTCAACTTTttaacgacggtaacgtgccac58.3100100
INLb-84Serogroup 4b (213)TCAACTAACTAATCATCTATCAATggtaaaaatatgcgaatattg9.7100100
INLb-85Serogroup 4bATACTACATCATAATCAAACATCActcgtgaacaagctttcc5.5100100
INLb-16Serogroup 1/2b (293)AATCAATCTTCATTCAAATCATCAggtaaaaatatgcgtatctta11.7100100
INLb-100Serogroup 1/2bCTATCTTTAAACTACAAATCTAACgtgaataagctatcggtctat13.0100100
LMO-42Serogroup 1/2a (268)CTATCTTCATATTTCACTATAAACtggcgttgctgrctaagtttg6.6100100
VGCb-40Serogroup 1/2aCTTTCTACATTATTCACAACATTAaatcaagcsgctcatatgaag10.410098.6
LMO-9Serogroup 1/2c (72)TAATCTTCTATATCAACATCTTACtttactggtgaaatggcg13.5100100
VGCb-5Serogroup 1/2cCAATTCAAATCACAATAATCAATCaagattacgaatcgcttccac20.898.6100
LMO-10ECI (111)ATCATACATACATACAAATCTACAatgattaaaagtcagggaaag19.0100100
LMO-28ECICTACAAACAAACAAACATTATCAAaatcgaggcttacgaacgt23.7100100
VGCc-80ECIa (44)CTAACTAACAATAATCTAACTAACactacaacgaaaacagcgc10.7100100
VGCa-35ECIaCAATTTCATCATTCATTCATTTCAgttacttttatgtcgagt9.2100100
LMO-12ECII (35)TACACTTTCTTTCTTTCTTTCTTTataccgattatttggacggtt3.8100100
LMO-30ECIITTACCTTTATACCTTTCTTTTTACgacttgtagcagttgatttcaa7.5100100
VGCc-45ECIII (10)TCATTTCACAATTCAATTACTCAActcttatttgcttttgttggtc21.110099.4
INLa-3ECIIITACACTTTATCAAATCTTACAATCgagcttaatgaaaatcagcta17.010099.4
INLa-1INLa controlCTTTAATCTCAATCAATACAAATCagaagtggaagctgggaaNAaNANA
INLb-13INLb controlCAATAAACTATACTTCTTCACTAAtgcacctaaacctccgacNANANA
LMO-88LMO controlTTACTTCACTTTCTATTTACAATCccgtttccttatgccacaNANANA
VGCa-23VGCa controlTTCAATCATTCAAATCTCAACTTTcaagycctaagacgccaatcgNANANA
VGCb-25VGCb controlCTTTTCAATTACTTCAAATCTTCAgcatgcgttagttcatgrccaNANANA
VGCc-82VGCc controlTACATACACTAATAACATACTCATgactgcatgctagaatctaagNANANA
Open in a separate windowaNA, not applicable for positive amplicon control probes.bLuminex microsphere sets (Luminex Corporation) used for hybridization reactions are indicated following the hyphen.cn, number of isolates representing the target subtype among the 906 tested isolates.dThe 5′ sequence tag portions of extension probes are capitalized. See IUPAC codes for definitions of degenerate bases.eID, index of discrimination.Validation of the TMLGT assay was performed using 906 L. monocytogenes isolates for which the lineage, major serogroup, and epidemic clone type had been determined independently (see Table S1 in the supplemental material). A subset of 92 isolates, including at least five isolates from each lineage, serogroup, and epidemic clone type, was used to evaluate the discriminatory power of subtype-specific probes and the repeatability of the assay (see Table S1). Two independent runs of the 30-probe TMLGT assay produced identical results for these 92 isolates. In addition, genotypes matched expectations for all isolate/probe combinations, and the fluorescence intensities for positive genotypes (those targeted by a particular probe) were 3.8 to 58.3 (mean, 18.5) times as high as background values for isolates with negative genotypes (those not targeted by a particular probe) (Table (Table2).2). The performances of individual probes also were assessed in terms of sensitivity and specificity, where sensitivity is defined as the percentage of positive samples that produced positive results and specificity indicates the percentage of negative samples that produce negative results (5). Based on results from all 906 isolates analyzed by TMLGT, probe sensitivity was at least 98.6% and 23 of the 24 subtype-specific probes exhibited 100% sensitivity (Table (Table2).2). The specificities for all probes were also greater than 98.6%, and 21 of the 24 subtype-specific probes exhibited 100% specificity (Table (Table22).All but three of the 906 isolates in the validation panel were fully and accurately typed relative to lineage, serogroup, and epidemic clone by using the TMLGT assay (typeability, 99.9%; accuracy of isolate assignment, 99.8%). One of the lineage II isolates, NRRL B-33880, could not be assigned to a serogroup based on the TMLGT results because this isolate was positive for one of the serogroup 1/2a probes (VGCb-40) and one of the serogroup 1/2c probes (LMO-9). This isolate was previously identified as a member of serogroup 1/2c based on mapping lineage-specific MLGT data onto a multilocus phylogeny (34) but produced a serogroup 1/2a-specific banding pattern (data not shown) with the multiplex PCR assay described by Doumith et al. (7). Similar strains, including the common laboratory strain EGD-e, were found to have genomes that are more similar to serogroup 1/2c strains than to strains from the 1/2a serogroup (8, 33) and likely represent intermediates in the evolution of the 1/2c clade from 1/2a ancestors. There is a poor correlation between genomic and antigenic variation for such isolates (34), consistent with the ambiguous results produced by application of the TMLGT assay to NRRL B-33880. The two other problematic isolates, NRRL B-33555 and NRRL B-33559, were accurately identified based on TMLGT data as lineage II isolates from the 1/2a serogroup. However, these two isolates were positive for both ECIII-specific probes in the TMLGT assay but have lineage-specific MLGT haplotypes (Lm2.46), indicating that they are representatives of a sister group closely related to ECIII (33).In 2005, the Food Safety and Inspection Service (FSIS) implemented an approach to inspection that includes consideration of relative risk in order to determine L. monocytogenes sampling frequency among establishments that produce certain RTE products. This approach incorporates information on production volume, outgrowth potential in the product, steps taken to prevent postlethality contamination, and FSIS sampling history. However, L. monocytogenes subtype-specific variation in ecology and virulence indicates that information on the lineage, major serogroup, and epidemic clone identities of isolates could be used to inform assessments of relative risk and to improve inspection programs that are based on consideration of risk. Several PCR-based methods have been described for differentiation of various combinations of these subgroups (1-3, 5, 7, 10, 35, 37); however, these approaches have focused on a single subgroup or a smaller set of subgroups than is differentiated by TMLGT analysis. Although we previously developed a set of three MLGT assays that can be used to differentiate all of the major serogroups and epidemic clones of L. monocytogenes (9, 33, 34), those assays did not include probes for lineage discrimination and require identification of the lineage prior to application of one of three unique sets of probes. In addition, the MLGT assays were designed to maximize strain discrimination, as opposed to subgroup identification, and require the use of at least twice as many probes as is needed for TMLGT analysis. MLGT data analysis is also more complicated than analysis of TMLGT data, and serogroup or epidemic clone type identification via MLGT requires phylogenetic analyses to place novel haplotypes within an established phylogenetic framework.In the present study, we developed the first assay for simultaneous discrimination of the four lineages, the four major serogroups, and the four previously described epidemic clones of L. monocytogenes. The assay includes multiple markers for each of these subtype probes as well as control probes to ensure that negative probe data were not the result of amplification failure, providing a high degree of internal validation required for use in inspection programs that consider risk in making sampling decisions. In addition, the utility of the assay has been validated with a large and diverse panel of 906 isolates, including 567 isolates from FSIS surveillance of RTE products and processing facilities (see Table S1 in the supplemental material). Data produced by the TMLGT assay are amenable to high-throughput analysis, and a simple spreadsheet utility has been developed to semiautomate subtype identifications and to alert investigators to potentially conflicting probe data (available upon request). In addition to having a potential application in inspection programs, the TMLGT assay provides a rapid and accurate means of characterizing L. monocytogenes isolates from different environments, which would facilitate pathogen tracking and improve understanding of L. monocytogenes ecology.   相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号