The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Interference among defective interfering particles of vesicular stomatitis virus

Three defective interfering (DI) particles of vesicular stomatitis virus (VSV), all derived from the same parental standard San Juan strain (Indiana serotype), were used in various combinations to infect cells together with the parental virus. The replication of their RNA genomes in the presence of other competing genomes was described by the hierarchical sequence: DI 0.52 particles greater than DI 0.45 particles less than or equal to DI-T particles greater than standard VSV. The advantage of one DI particle over another was not due simply to multiplicity effects nor to the irreversible occupation of limited cellular sites. Interference, however, did correlate with a change in the ratio of plus and minus RNA templates that accumulated intracellularly and with the presence of new sequences at the 3' end of the DI genomes. DI 0.52 particles contained significantly more nucleotides at the 3' end that were complementary to those at the 5' end of its RNA than did DI-T or DI 0.45 particles. The first 45 nucleotides at the 3' ends of all of the DI RNAs were identical. VSV and its DI particles can be separated into three classes, depending on their terminal RNA sequences. These sequences suggest two mechanisms, one based on the affinity of polymerase binding and the other on the affinity of N-protein binding, that may account for interference by DI particles against standard VSV and among DI particles themselves.     

Utilization of homotypic and heterotypic proteins of vesicular stomatitis virus by defective interfering particle genomes for RNA replication and virion assembly: implications for the mechanism of homologous viral interference

Defective interfering (DI) particles of Indiana serotype of vesicular stomatitis virus (VSV(Ind)) are capable of interfering with the replication of both homotypic VSV(Ind) and heterotypic New Jersey serotype (VSV(NJ)) standard virus. In contrast, DI particles from VSV(NJ) do not interfere with the replication of VSV(Ind) standard virus but do interfere with VSV(NJ) replication. The differences in the interfering activities of VSV(Ind) DI particles and VSV(NJ) DI particles against heterotypic standard virus were investigated. We examined the utilization of homotypic and heterotypic VSV proteins by DI particle genomic RNAs for replication and maturation into infectious DI particles. Here we show that the RNA-nucleocapsid protein (N) complex of one serotype does not utilize the polymerase complex (P and L) of the other serotype for RNA synthesis, while DI particle genomic RNAs of both serotypes can utilize the N, P, and L proteins of either serotype without serotypic restriction but with differing efficiencies as long as all three proteins are derived from the same serotype. The genomic RNAs of VSV(Ind) DI particles assembled and matured into DI particles by using either homotypic or heterotypic viral proteins. In contrast, VSV(NJ) DI particles could assemble only with homotypic VSV(NJ) viral proteins, although the genomic RNAs of VSV(NJ) DI particles could be replicated by using heterotypic VSV(Ind) N, P, and L proteins. Thus, we concluded that both efficient RNA replication and assembly of DI particles are required for the heterotypic interference by VSV DI particles.     

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).     

A specific internal RNA polymerase recognition site of VSV RNA is involved in the generation of DI particles.

The 3′ terminal sequences of four different DI particle RNAs ranging in size from 10S to 30S have been determined directly using rapid RNA sequencing methods or deduced, in the case of the fourth DI RNA, from the complementary sequence of a small RNA transcribed from this part of the genome (Schubert et al., 1978). One DI particle (DI 011) contains covalently linked genomic and antigenomic RNA. The 5′ end of this RNA is identical to that of VSV RNA, as determined by annealing for at least 1 kb, as well as to the other DI particle RNAs used in this study. The 3′ ends of the other three DI particle RNAs are exact copies of the common 5′ terminal sequence for 48 nucleotides in two cases and 45 nucleotides in the third. Beyond these complementary regions the sequences are different for each DI RNA. The fact that these regions differ in length by only three nucleotides, despite the wide differences in the overall size of the DI particle RNAs, indicates that if these DIs were formed by the copy-back mechanisms similar to those proposed by Leppert, Kort and Kolakofsky (1977) and Huang (1977), a specific recognition site for the RNA polymerase must be involved in copying the 5′ terminus. We determined the 5′ terminal sequence from position 43–48 at the end of the complementary region and found it to be 5′-GGUCUU-3′. This hexamer is also part of other highly conserved terminal RNA polymerase initiation sites (Keene et al., 1978; Keene, Schubert and Lazzarini, 1979) and may be a specific internal RNA polymerase recognition site. We conclude that this sequence is one of the elements involved in the genesis of DI particle chromosomes containing short complementary sequences at their termini. The ability of the polymerase to resume synthesis at or near a specific recognition site is discussed.     

Replication of vesicular stomatitis virus defective interfering particle RNA in vitro: transition from synthesis of defective interfering leader RNA to synthesis of full-length defective interfering RNA.

The replication of the RNA of vesicular stomatitis virus (VSV) defective interfering (DI) particles was established in a defined cell-free system. The transition from synthesis of only the DI-leader RNA to replication of the full-length DI RNA was effected in the system by newly synthesized VSV proteins and occurred in the absence of VSV helper virus. Both positive- and negative-polarity full-length DI RNA were synthesized. Furthermore, the products of RNA replication associated with newly synthesized viral proteins to form complexes that were indistinguishable from authentic DI particle nucleocapsids on the basis of buoyant density and resistance to ribonuclease digestion. The DI-leader RNA did not form ribonuclease-resistant structures. We conclude that this in vitro system successfully executes many of the reactions of VSV DI particle replication and assembly.     

Comparison of the Ribonucleic Acid Polymerases of Two Rhabdoviruses, Kern Canyon Virus and Vesicular Stomatitis Virus

A ribonucleic acid (RNA)-dependent RNA polymerase has been demonstrated in Kern Canyon virus (KCV) particles. The RNA product of the KCV polymerase hybridizes to KCV viral RNA. The properties of this viral enzyme have been characterized and compared with those of vesicular stomatitis virus (VSV). RNA polymerases from both viruses require similar conditions of temperature, pH, and detergent and magnesium concentrations for maximal synthesis of RNA. The RNA polymerase contained in the virion of KCV was more dependent on the presence of a sulfhydryl agent than was the VSV enzyme. Under optimal conditions, the specific activity of the VSV polymerase is about twenty-five times as great as that of KCV.     

Inhibition of pseudorabies virus replication by vesicular stomatitis virus. II Activity of defective interfering particles.

Purified defective interfering (DI) particles of vesicular stomatitis virus (VSV) inhibit the replication of a heterologous virus, pseudorabies virus (PSR), in hamster (BHK-21) and rabbit (RC-60) cell lines. In contrast to infectious B particles of VSV, UV irradiation of DI particles does not reduce their ability to inhibit PSR replication. However, UV irradiation progressively reduces the ability of DI particles to cause homologous interference with B particle replication. Pretreatment with interferon does not affect the ability of DI particles to inhibit PSR replication in a rabbit cell line (RC-60) in which RNA, but not DNA, viruses are sensitive to the action of interferon. Under similar conditions of interferon pretreatment, the inhibition of PSR by B particles is blocked. These data suggest that de novo VSV RNA or protein synthesis is not required for the inhibition of PSR replication by DI particles. DI particles that inhibit PSR replication also inhibit host RNA and protein synthesis in BHK-21 and RC-60 cells. Based on the results described and data in the literature, it is proposed that the same component of VSV B and DI particles is responsible for most, if not all, of the inhibitory activities of VSV, except homologous interference.     

Defective interfering virus particles modulate virulence.

To determine whether defective interfering (DI) particles modulate virulence by initiating a cyclic pattern of virus growth in vivo, adult mice were infected with vesicular stomatitis virus (VSV), both with and without DI particles. A total of 184 mice divided into groups were inoculated intranasally. A majority of mice inoculated only with standard VSV developed paralysis, most of them between days 7 and 9. The addition of DI particles altered the development of paralysis in several ways. When there was significant protection, a few still became paralyzed on days 7 and 9. When overall mortality was unaffected or even slightly increased, the majority of mice became paralyzed between days 7 and 9 as well. Protection could not be predicted based on a single ratio of standard VSV to DI particles or on the absolute amount of DI particles inoculated. Infectious virus recovered from mouse brains at the time of paralysis and incipient death showed considerable variation, although the titer in a majority of the animals was between 10(5) and 10(7) PFU/ml. When the brains of these paralyzed mice were examined for hybridizable VSV RNA, the detection of standard VSV RNA correlated well with infectivity. The amount of DI RNA in the coinfected mice was more variable and independent of the amount of 40S RNA, although DI RNA was usually found when standard RNA was present. Survivors examined between days 14 and 21 did not contain infectious virus or any detectable viral RNA in their brains. Because these results were consistent with the hypothesis of viral cycling in vivo, rather than a gradual accumulation of total infectious virus, mice were coinfected with 10(8) PFU of standard VSV and 10(5) PFU equivalents of DI particles and sacrificed daily thereafter, irrespective of whether they developed paralysis. Infectivity measurements indicated a reproducible cycling pattern of VSV in the mouse brains with a periodicity of about 5 days. This cycling and the detection of DI RNA in brains several days after intranasal inoculation suggest that there is a dynamic continuous interaction between standard VSV and its DI particle beyond the initial site of replication as the virus population spreads into the host animal. Such cycling of virus production before the full development of specific immune responses from the host may have important implications for viral diagnostics and disease transmission.     

Inhibition of adenovirus DNA replication by vesicular stomatitis virus leader RNA.

Vesicular stomatitis virus (VSV) leader RNA and a synthetic oligodeoxynucleotide of the same sequence were found to inhibit the replication of adenovirus DNA in vitro. In contrast, the small RNA transcribed by the VSV defective interfering particle DI-011 did not prevent adenovirus DNA replication. The inhibition produced by leader RNA was at the level of preterminal protein (pTP)-dCMP complex formation, the initiation step of adenovirus DNA replication. Initiation requires the adenovirus pTP-adenovirus DNA polymerase complex (pTP-Adpol), the adenovirus DNA-binding protein, and nuclear factor I. Specific replication in the presence of leader RNA was restored when the concentration of adenovirus-infected or uninfected nuclear extract was increased or by the addition of purified pTP-Adpol or HeLa cell DNA polymerase alpha-primase to inhibited replication reactions. Furthermore, the activities of both purified DNA polymerases could be inhibited by the leader sequence. These results suggest that VSV leader RNA is the viral agent responsible for inhibition of adenovirus and possibly cellular DNA replication during VSV infection.     

High-frequency leader sequence switching during coronavirus defective interfering RNA replication.

A system was developed that exploited defective interfering (DI) RNAs of coronavirus to study the role of free leader RNA in RNA replication. A cDNA copy of mouse hepatitis virus DI RNA was placed downstream of the T7 RNA polymerase promoter to generate DI RNAs capable of extremely efficient replication in the presence of a helper virus. We demonstrated that, in the DI RNA-transfected cells, the leader sequence of these DI RNAs was switched to that of the helper virus during one round of replication. This high-frequency leader sequence exchange was not observed if a nine-nucleotide stretch of sequence (UUUAUAAAC) at the junction between the leader and the remaining DI sequence was deleted. This observation suggests that a free leader RNA generated from the genomic RNA of mouse hepatitis virus may participate in the replication of DI RNA.     

Vesicular stomatitis virus defective interfering particles can contain extensive genomic sequence rearrangements and base substitutions

We sequenced the 5' and 3' RNA termini of 16 defective interfering (DI) particles of vesicular stomatitis virus (VSV) isolated at intervals from persistent infections and from a series of undiluted lytic passages. All DI RNAs exhibited complementary termini, but sequences internal to these termini were extensively rearranged in a variety of ways. Despite extensive rearrangement, these internal sequences (in addition to the termini) apparently are important for DI particle interference properties. Some of these DI particles are derived from multiple intrastrand and interstrand recombination events, and the generation of each can be explained by current replicase error models. During viral evolution in persistent and acute infections, DI particles with specific termini base substitutions are selected. One DI particle exhibits a remarkable clustering of specific A----G (and complementary U----C) substitutions, apparently as a result of repetitive misincorporations by an error-prone viral polymerase complex.