Tertiary Motifs Revealed in Analyses of Higher-Order RNA Junctions

RNA junctions are secondary-structure elements formed when three or more helices come together. They are present in diverse RNA molecules with various fundamental functions in the cell. To better understand the intricate architecture of three-dimensional (3D) RNAs, we analyze currently solved 3D RNA junctions in terms of base-pair interactions and 3D configurations. First, we study base-pair interaction diagrams for solved RNA junctions with 5 to 10 helices and discuss common features. Second, we compare these higher-order junctions to those containing 3 or 4 helices and identify global motif patterns such as coaxial stacking and parallel and perpendicular helical configurations. These analyses show that higher-order junctions organize their helical components in parallel and helical configurations similar to lower-order junctions. Their sub-junctions also resemble local helical configurations found in three- and four-way junctions and are stabilized by similar long-range interaction preferences such as A-minor interactions. Furthermore, loop regions within junctions are high in adenine but low in cytosine, and in agreement with previous studies, we suggest that coaxial stacking between helices likely forms when the common single-stranded loop is small in size; however, other factors such as stacking interactions involving noncanonical base pairs and proteins can greatly determine or disrupt coaxial stacking. Finally, we introduce the ribo-base interactions: when combined with the along-groove packing motif, these ribo-base interactions form novel motifs involved in perpendicular helix-helix interactions. Overall, these analyses suggest recurrent tertiary motifs that stabilize junction architecture, pack helices, and help form helical configurations that occur as sub-elements of larger junction networks. The frequent occurrence of similar helical motifs suggest nature's finite and perhaps limited repertoire of RNA helical conformation preferences. More generally, studies of RNA junctions and tertiary building blocks can ultimately help in the difficult task of RNA 3D structure prediction.     

Promoting RNA helical stacking via A-minor junctions

RNA molecules take advantage of prevalent structural motifs to fold and assemble into well-defined 3D architectures. The A-minor junction is a class of RNA motifs that specifically controls coaxial stacking of helices in natural RNAs. A sensitive self-assembling supra-molecular system was used as an assay to compare several natural and previously unidentified A-minor junctions by native polyacrylamide gel electrophoresis and atomic force microscopy. This class of modular motifs follows a topological rule that can accommodate a variety of interchangeable A-minor interactions with distinct local structural motifs. Overall, two different types of A-minor junctions can be distinguished based on their functional self-assembling behavior: one group makes use of triloops or GNRA and GNRA-like loops assembling with helices, while the other takes advantage of more complex tertiary receptors specific for the loop to gain higher stability. This study demonstrates how different structural motifs of RNA can contribute to the formation of topologically equivalent helical stacks. It also exemplifies the need of classifying RNA motifs based on their tertiary structural features rather than secondary structural features. The A-minor junction rule can be used to facilitate tertiary structure prediction of RNAs and rational design of RNA parts for nanobiotechnology and synthetic biology.     

Use of RNA structure flexibility data in nanostructure modeling

In the emerging field of RNA-based nanotechnology there is a need for automation of the structure design process. Our goal is to develop computer methods for aiding in this process. Towards that end, we created the RNA junction database, which is a repository of RNA junctions, i.e. internal, multi-branch and kissing loops with emanating stem stubs, extracted from the larger RNA structures stored in the PDB database. These junctions can be used as building blocks for nanostructures. Two programs developed in our laboratory, NanoTiler and RNA2D3D, can combine such building blocks with idealized fragments of A-form helices to produce desired 3D nanostructures. Initially, the building blocks are treated as rigid objects and the resulting geometry is tested against the design objectives. Experimental data, however, shows that RNA accommodates its shape to the constraints of larger structural contexts. Therefore we are adding analysis of the flexibility of our building blocks to the full design process. Here we present an example of RNA-based nanostructure design, putting emphasis on the need to characterize the structural flexibility of the building blocks to induce ring closure in the automated exploration. We focus on the use of kissing loops (KL) in nanostructure design, since they have been shown to play an important role in RNA self-assembly. By using an experimentally proven system, the RNA tectosquare, we show that considering the flexibility of the KLs as well as distortions of helical regions may be necessary to achieve a realistic design.     

Interconversion between Parallel and Antiparallel Conformations of a 4H RNA junction in Domain 3 of Foot-and-Mouth Disease Virus IRES Captured by Dynamics Simulations

RNA junctions are common secondary structural elements present in a wide range of RNA species. They play crucial roles in directing the overall folding of RNA molecules as well as in a variety of biological functions. In particular, there has been great interest in the dynamics of RNA junctions, including conformational pathways of fully base-paired 4-way (4H) RNA junctions. In such constructs, all nucleotides participate in one of the four double-stranded stem regions, with no connecting loops. Dynamical aspects of these 4H RNAs are interesting because frequent interchanges between parallel and antiparallel conformations are thought to occur without binding of other factors. Gel electrophoresis and single-molecule fluorescence resonance energy transfer experiments have suggested two possible pathways: one involves a helical rearrangement via disruption of coaxial stacking, and the other occurs by a rotation between the helical axes of coaxially stacked conformers. Employing molecular dynamics simulations, we explore this conformational variability in a 4H junction derived from domain 3 of the foot-and-mouth disease virus internal ribosome entry site (IRES); this junction contains highly conserved motifs for RNA-RNA and RNA-protein interactions, important for IRES activity. Our simulations capture transitions of the 4H junction between parallel and antiparallel conformations. The interconversion is virtually barrier-free and occurs via a rotation between the axes of coaxially stacked helices with a transient perpendicular intermediate. We characterize this transition, with various interhelical orientations, by pseudodihedral angle and interhelical distance measures. The high flexibility of the junction, as also demonstrated experimentally, is suitable for IRES activity. Because foot-and-mouth disease virus IRES structure depends on long-range interactions involving domain 3, the perpendicular intermediate, which maintains coaxial stacking of helices and thereby consensus primary and secondary structure information, may be beneficial for guiding the overall organization of the RNA system in domain 3.     

The lonepair triloop: a new motif in RNA structure

The lonepair triloop (LPTL) is an RNA structural motif that contains a single ("lone") base-pair capped by a hairpin loop containing three nucleotides. The two nucleotides immediately outside of this motif (5' and 3' to the lonepair) are not base-paired to one another, restricting the length of this helix to a single base-pair. Four examples of this motif, along with three tentative examples, were initially identified in the 16S and 23S rRNAs with covariation analysis. An evaluation of the recently determined crystal structures of the Thermus thermophilus 30S and Haloarcula marismortui 50S ribosomal subunits revealed the authenticity for all of these proposed interactions and identified 16 more LPTLs in the 5S, 16S and 23S rRNAs. This motif is found in the T loop in the tRNA crystal structures. The lonepairs are positioned, in nearly all examples, immediately 3' to a regular secondary structure helix and are stabilized by coaxial stacking onto this flanking helix. In all but two cases, the nucleotides in the triloop are involved in a tertiary interaction with another section of the rRNA, establishing an overall three-dimensional function for this motif. Of these 24 examples, 14 occur in multi-stem loops, seven in hairpin loops and three in internal loops. While the most common lonepair, U:A, occurs in ten of the 24 LPTLs, the remaining 14 LPTLs contain seven different base-pair types. Only a few of these lonepairs adopt the standard Watson-Crick base-pair conformations, while the majority of the base-pairs have non-standard conformations. While the general three-dimensional conformation is similar for all examples of this motif, characteristic differences lead to several subtypes present in different structural environments. At least one triloop nucleotide in 22 of the 24 LPTLs in the rRNAs and tRNAs forms a tertiary interaction with another part of the RNA. When a LPTL containing the GNR or UYR triloop sequence forms a tertiary interaction with the first (and second) triloop nucleotide, it recruits a fourth nucleotide to mediate stacking and mimic the tetraloop conformation. Approximately half of the LPTL motifs are in close association with proteins. The majority of these LPTLs are positioned at sites in rRNAs that are conserved in the three phylogenetic domains; a few of these occur in regions of the rRNA associated with ribosomal function, including the presumed site of peptidyl transferase activity in the 23S rRNA.     

Predicting coaxial helical stacking in RNA junctions

RNA junctions are important structural elements that form when three or more helices come together in space in the tertiary structures of RNA molecules. Determining their structural configuration is important for predicting RNA 3D structure. We introduce a computational method to predict, at the secondary structure level, the coaxial helical stacking arrangement in junctions, as well as classify the junction topology. Our approach uses a data mining approach known as random forests, which relies on a set of decision trees trained using length, sequence and other variables specified for any given junction. The resulting protocol predicts coaxial stacking within three- and four-way junctions with an accuracy of 81% and 77%, respectively; the accuracy increases to 83% and 87%, respectively, when knowledge from the junction family type is included. Coaxial stacking predictions for the five to ten-way junctions are less accurate (60%) due to sparse data available for training. Additionally, our application predicts the junction family with an accuracy of 85% for three-way junctions and 74% for four-way junctions. Comparisons with other methods, as well applications to unsolved RNAs, are also presented. The web server Junction-Explorer to predict junction topologies is freely available at: http://bioinformatics.njit.edu/junction.     

Correlation of RNA Secondary Structure Statistics with Thermodynamic Stability and Applications to Folding

The accurate prediction of the secondary and tertiary structure of an RNA with different folding algorithms is dependent on several factors, including the energy functions. However, an RNA higher-order structure cannot be predicted accurately from its sequence based on a limited set of energy parameters. The inter- and intramolecular forces between this RNA and other small molecules and macromolecules, in addition to other factors in the cell such as pH, ionic strength, and temperature, influence the complex dynamics associated with transition of a single stranded RNA to its secondary and tertiary structure. Since all of the factors that affect the formation of an RNAs 3D structure cannot be determined experimentally, statistically derived potential energy has been used in the prediction of protein structure. In the current work, we evaluate the statistical free energy of various secondary structure motifs, including base-pair stacks, hairpin loops, and internal loops, using their statistical frequency obtained from the comparative analysis of more than 50,000 RNA sequences stored in the RNA Comparative Analysis Database (rCAD) at the Comparative RNA Web (CRW) Site. Statistical energy was computed from the structural statistics for several datasets. While the statistical energy for a base-pair stack correlates with experimentally derived free energy values, suggesting a Boltzmann-like distribution, variation is observed between different molecules and their location on the phylogenetic tree of life. Our statistical energy values calculated for several structural elements were utilized in the Mfold RNA-folding algorithm. The combined statistical energy values for base-pair stacks, hairpins and internal loop flanks result in a significant improvement in the accuracy of secondary structure prediction; the hairpin flanks contribute the most.     

Prevalence of syn nucleobases in the active sites of functional RNAs

Biological RNAs, like their DNA counterparts, contain helical stretches, which have standard Watson-Crick base pairs in the anti conformation. Most functional RNAs also adopt geometries with far greater complexity such as bulges, loops, and multihelical junctions. Occasionally, nucleobases in these regions populate the syn conformation wherein the base resides close to or over the ribose sugar, which leads to a more compact state. The importance of the syn conformation to RNA function is largely unknown. In this study, we analyze 51 RNAs with tertiary structure, including aptamers, riboswitches, ribozymes, and ribosomal RNAs, for number, location, and properties of syn nucleobases. These RNAs represent the set of nonoverlapping, moderate- to high-resolution structures available at present. We find that syn nucleobases are much more common among purines than pyrimidines, and that they favor C2'-endo-like conformations especially among those nucleobases in the intermediate syn conformation. Strikingly, most syn nucleobases participate in tertiary stacking and base-pairing interactions: Inspection of RNA structures revealed that the majority of the syn nucleobases are in regions assigned to function, with many syn nucleobases interacting directly with a ligand or ribozyme active site. These observations suggest that judicious placement of conformationally restricted nucleotides biased into the syn conformation could enhance RNA folding and catalysis. Such changes could also be useful for locking RNAs into functionally competent folds for use in X-ray crystallography and NMR.     

Global structure of four-way RNA junctions studied using fluorescence resonance energy transfer.

Four-way helical junctions are found widely in natural RNA species. In this study, we have studied the conformation of two junctions by fluorescence resonance energy transfer. We show that the junctions are folded by pairwise coaxial helical stacking, forming one predominant stacking conformer in both examples studied. At low magnesium ion concentrations, the helical axes of both junctions are approximately perpendicular. One junction undergoes a rotation into a distorted antiparallel structure induced by the binding of a single magnesium ion. By contrast, the axes of the four-way junction of the U1 snRNA remain approximately perpendicular under all conditions examined, and we have determined the stacking conformer adopted.     

Annotation of tertiary interactions in RNA structures reveals variations and correlations

RNA tertiary motifs play an important role in RNA folding and biochemical functions. To help interpret the complex organization of RNA tertiary interactions, we comprehensively analyze a data set of 54 high-resolution RNA crystal structures for motif occurrence and correlations. Specifically, we search seven recognized categories of RNA tertiary motifs (coaxial helix, A-minor, ribose zipper, pseudoknot, kissing hairpin, tRNA D-loop/T-loop, and tetraloop-tetraloop receptor) by various computer programs. For the nonredundant RNA data set, we find 613 RNA tertiary interactions, most of which occur in the 16S and 23S rRNAs. An analysis of these motifs reveals the diversity and variety of A-minor motif interactions and the various possible loop-loop receptor interactions that expand upon the tetraloop-tetraloop receptor. Correlations between motifs, such as pseudoknot or coaxial helix with A-minor, reveal higher-order patterns. These findings may ultimately help define tertiary structure restraints for RNA tertiary structure prediction. A complete annotation of the RNA diagrams for our data set is available at http://www.biomath.nyu.edu/motifs/.     

Arrangement of 3D structural motifs in ribosomal RNA

Structural 3D motifs in RNA play an important role in the RNA stability and function. Previous studies have focused on the characterization and discovery of 3D motifs in RNA secondary and tertiary structures. However, statistical analyses of the distribution of 3D motifs along the RNA appear to be lacking. Herein, we present a novel strategy for evaluating the distribution of 3D motifs along the RNA chain and those motifs whose distributions are significantly non-random are identified. By applying it to the X-ray structure of the large ribosomal subunit from Haloarcula marismortui, helical motifs were found to cluster together along the chain and in the 3D structure, whereas the known tetraloops tend to be sequentially and spatially dispersed. That the distribution of key structural motifs such as tetraloops differ significantly from a random one suggests that our method could also be used to detect novel 3D motifs of any size in sufficiently long/large RNA structures. The motif distribution type can help in the prediction and design of 3D structures of large RNA molecules.     

RNA structural motifs: building blocks of a modular biomolecule

RNAs are modular biomolecules, composed largely of conserved structural subunits, or motifs. These structural motifs comprise the secondary structure of RNA and are knit together via tertiary interactions into a compact, functional, three-dimensional structure and are to be distinguished from motifs defined by sequence or function. A relatively small number of structural motifs are found repeatedly in RNA hairpin and internal loops, and are observed to be composed of a limited number of common 'structural elements'. In addition to secondary and tertiary structure motifs, there are functional motifs specific for certain biological roles and binding motifs that serve to complex metals or other ligands. Research is continuing into the identification and classification of RNA structural motifs and is being initiated to predict motifs from sequence, to trace their phylogenetic relationships and to use them as building blocks in RNA engineering.     

Nucleic acid structure and recognition

We review the global structures adopted by branched nucleic acids, including three- and four-way helical junctions in DNA and RNA. We find that some general folding principles emerge. First, all the structures exhibit a tendency to undergo pairwise coaxial helical stacking when permitted by the local stereochemistry of strand exchange. Second, metal ions generally play an important role in facilitating folding of branched nucleic acids. These principles can be applied to functionally important branched nucleic acids, such as the Holliday DNA junction of genetic recombination, and the hammerhead ribozyme in RNA.     

Folding of branched RNA species

The global structures of branched RNA species are important to their function. Branched RNA species are defined as molecules in which double-helical segments are interrupted by abrupt discontinuities. These include helical junctions of different orders, and base bulges and loops. Common helical junctions are three- and four-way junctions, often interrupted by mispairs or additional nucleotides. There are many interesting examples of functional RNA junctions, including the hammerhead and hairpin ribozymes, and junctions that serve as binding sites for proteins. The junctions display some common structural properties. These include a tendency to undergo pairwise helical stacking and ion-induced conformational transitions. Helical branchpoints can act as key architectural components and as important sites for interactions with proteins. Copyright 1999 John Wiley & Sons, Inc.     

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.     

The structure of yeast tRNA(Asp). A model for tRNA interacting with messenger RNA

The anticodon of yeast tRNA(Asp), GUC, presents the peculiarity to be self-complementary, with a slight mismatch at the uridine position. In the orthorhombic crystal lattice, tRNA(Asp) molecules are associated by anticodon-anticodon interactions through a two-fold symmetry axis. The anticodon triplets of symmetrically related molecules are base paired and stacked in a normal helical conformation. A stacking interaction between the anticodon loops of two two-fold related tRNA molecules also exists in the orthorhombic form of yeast tRNA(Phe). In that case however the GAA anticodon cannot be base paired. Two characteristic differences can be correlated with the anticodon-anticodon association: the distribution of temperature factors as determined from the X-ray crystallographic refinements and the interaction between T and D loops. In tRNA(Asp) T and D loops present higher temperature factors than the anticodon loop, in marked contrast to the situation in tRNA(Phe). This variation is a consequence of the anticodon-anticodon base pairing which rigidifies the anticodon loop and stem. A transfer of flexibility to the corner of the tRNA molecule disrupts the G19-C56 tertiary interactions. Chemical mapping of the N3 position of cytosine 56 and analysis of self-splitting patterns of tRNA(Asp) substantiate such a correlation.     

Structures of helical junctions in nucleic acids

Our knowledge of the architectural principles of nucleic acid junctions has seen significant recent advances. The conformation of DNA junctions is now well understood, and this provides a new basis for the analysis of important structural elements in RNA. The most significant new data have come from X-ray crystallography of four-way DNA junctions; incidentally showing the great importance of serendipity in science, since none of the three groups had deliberately set out to crystallise a junction. Fortunately the results confirm, and of course extend, the earlier conformational studies of DNA junctions in almost every detail. This is important, because it means that these methods can be applied with greater confidence to new systems, especially in RNA. Methods like FRET, chemical probing and even the humble polyacrylamide gel can be rapid and very powerful, allowing the examination of a large number of sequence variants relatively quickly. Molecular modelling in conjunction with experiments is also a very important component of the general approach. Ultimately crystallography provides the gold standard for structural analysis, but the other, simple approaches have considerable value along the way. At the beginning of this review I suggested two simple folding principles for branched nucleic acids, and it is instructive to review these in the light of recent data. In brief, these were the tendency for pairwise coaxial stacking of helical arms, and the importance of metal ion interactions in the induction of folding. We see that both are important in a wide range of systems, both in DNA and RNA. The premier example is the four-way DNA junction, which undergoes metal ion-induced folding into the stacked X-structure that is based on coaxial stacking of arms. As in many systems, there are two alternative ways to achieve this depending on the choice of stacking partners. Recent data reveal that both forms often exist in a dynamic equilibrium, and that the relative stability of the two conformers depends upon base sequence extending a significant distance from the junction. The three-way junction has provided a good test of the folding principles. Perfect three-way (3H) DNA junctions seem to defy these principles in that they appear reluctant to undergo coaxial stacking of arms, and exhibit little change in conformation with addition of metal ions. Modelling suggests that such a junction is stereochemically constrained in an extended conformation. However, upon inclusion of a few additional base pairs at the centre (to create a 3HS2 junction for example) the additional stereochemical flexibility allows two arms to undergo coaxial stacking. Such a junction exhibits all the properties consistent with the general folding principles, with ion-induced folding into a form based on pairwise coaxial stacking of arms in one of two different conformers. The three-way junction is therefore very much the exception that proves the rule. It is instructive to compare the folding of corresponding species in DNA and RNA, where we find both similarities and differences. The RNA four-way junction can adopt a structure that is globally similar to the stacked X-structure (Duckett et al. 1995a), and the crystal structure of the DNAzyme shows that the stacked X-conformation can include one helical pair in the A-conformation (Nowakowski et al. 1999). However, modelling suggests that the juxtaposition of strands and grooves will be less satisfactory in RNA, and the higher magnesium ion concentration required to fold the RNA junction indicates a lower stability of the antiparallel form. Perhaps the biggest difference between the properties of the DNA and RNA four-way junctions is the lack of an unstacked structure at low salt concentrations for the RNA species. This clearly reflects a major difference in the electrostatic interactions in the RNA junction. In general the folding of branched DNA provides some good indications on the likely folding of the corresponding RNA species, but caution is required in making the extrapolation because the two polymers are significantly different. A number of studies point to the flexibility and malleability of branched nucleic acids, and this turns out to have particular significance in their interactions with proteins. Proteins such as the DNA junction-resolving enzymes exhibit considerable selectivity for the structure of their substrates, which is still not understood at a molecular level. Despite this, it appears to be universally true that these proteins distort the global, and in some cases at least the local, structure of the junctions. The somewhat perplexing result is that the proteins appear to distort the very property that they recognise. In general it seems that four-way DNA junctions are opened to one extent or another by interaction with proteins. (ABSTRACT TRUNCATED)     

Conformational flexibility of four-way junctions in RNA

Helical junctions are common architectural features in RNA. They are particularly important in autonomously folding molecules, as exemplified by the hairpin ribozyme. We have used single-molecule fluorescence spectroscopy to study the dynamic properties of the perfect (4H) four-way helical junction derived from the hairpin ribozyme. In the presence of Mg(2+), the junction samples parallel and antiparallel conformations and both stacking conformers, with a bias towards one antiparallel stacking conformer. There is continual interconversion between the forms, such that there are several transitions per second under physiological conditions. Our data suggest that interconversion proceeds via an open intermediate with reduced cation binding in which coaxial stacking between helices is disrupted. The rate of interconversion becomes slower at higher Mg(2+) concentrations, yet the activation barrier decreases under these conditions, indicating that entropic effects are important. Transitions also occur in the presence of Na(+) only; however, the coaxial stacking appears incomplete under these conditions. The polymorphic and dynamic character of the four-way RNA junction provides a source of structural diversity, from which particular conformations required for biological function might be stabilised by additional RNA interactions or protein binding.