共查询到20条相似文献，搜索用时 0 毫秒
1.
Barile, Michael F. (Division of Biologics Standards, National Institutes of Health, Bethesda, Md.), Robert T. Schimke, and Donald B. Riggs. Presence of the arginine dihydrolase pathway in Mycoplasma. J. Bacteriol. 91:189-192. 1966.-The presence of the arginine dihydrolase pathway was examined in 61 Mycoplasma strains representing at least 18 Mycoplasma species isolated from nine different sources: human, bovine, avian, murine, swine, goat, canine, sewage, and tissue cell culture origin. Some species were represented by only one or two strains. Different strains of the same species gave the same results. Ten species (56%) were positive. Many nonpathogenic Mycoplasma species (M. hominis, type 1 and 2, M. fermentans, M. salivarium, and M. gallinarum) were positive, whereas most pathogenic species (M. pneumoniae, M. gallisepticum, M. neurolyticum, and M. hyorhinis) were negative. The presence of arginine dihydrolase activity among Mycoplasma species may prove to be useful for purposes of identification and classification. 相似文献
2.
Arginine deiminase activity was induced during the vegetative growth of Clostridium sporogenes. The enzyme was sensitive to catabolite repression. The other enzymes of the arginine dihydrolase pathway, namely, ornithine carbamoyl-transferase and carbamate kinase, did not show such variation. 相似文献
3.
María C. Manca de Nadra Carlos A. Nadra Chaud Aída Pesce de Ruiz Holgado Dr. Guillermo Oliver 《Current microbiology》1986,13(5):261-264
The formation of the arginine dihydrolase pathway enzymes inLactobacillus buchneri NCDO110, a heterofermentative organism, was investigated. The specific activities of arginine deiminase, ornithine transcarbamylase, and carbamate kinase were higher in galactose-grown cells than in glucose- or sucrose-grown cells in the early stationary phase of growth. The addition of arginine to growing cells increased the specific activity of these three enzymes with all growth sugars. The specific activities of the enzymes decreased during the stationary phase of growth when the sugar-grown cells was galactose. When glucose was virtually exhausted from the medium, the activities of the three enzymes were not altered. This enzymic system was not repressed by glucose, and these results are different from those obtained withL. leichmanni, homofermentative organism.Dedicated to Dr. Luis F. Leloir on the occasion of his 80th birthday, 6 September 1986.Member of the Scientific Researcher's Career of theConsejo Nacional de Investigaciones Cientificas Ténicas (CONICET) Argentina. 相似文献
4.
The generation of energy by the arginine dihydrolase pathway in Mycoplasma hominis 07 总被引：27，自引：0，他引：27
R T Schimke C M Berlin E W Sweeney W R Carroll 《The Journal of biological chemistry》1966,241(10):2228-2236
5.
6.
7.
8.
Early diverged extant organisms, which may serve as convenient laboratory models to look for and study evolutionary ancient features of eukaryotic cell biology, are rare. The diplomonad Giardia intestinalis, a protozoan parasite known to cause diarrhoeal disease, has become an increasingly popular object of basic research in cell biology, not least because of a genome sequencing project nearing completion. Commensurate with its phylogenetic status, the Giardia trophozoite has a very basic secretory system and even lacks hallmark structures such as a morphologically identifiable Golgi apparatus. The cell's capacity for protein sorting is nevertheless unimpeded, exemplified by its ability to cope with massive amounts of newly synthesized cyst wall proteins and glycans, which are sorted to dedicated Golgi-like compartments termed encystation-specific vesicles (ESVs) generated from endoplasmic reticulum (ER)-derived transport intermediates. This soluble bulk cargo is kept strictly separate from constitutively transported variant surface proteins during export, a function that is dependent on the stage-specific recognition of trafficking signals. Encysting Giardia therefore provide a unique system for the study of unconventional, Golgi-independent protein trafficking mechanisms in the broader context of eukaryotic endomembrane organization and evolution. 相似文献
9.
10.
Lloyd D Harris JC Maroulis S Mitchell A Hughes MN Wadley RB Edwards MR 《Journal of applied microbiology》2003,95(3):576-583
AIMS: To investigate the antigiardial properties of the nitrosating agents: sodium nitrite, sodium nitroprusside and Roussin's black salt. METHODS AND RESULTS: Use of confocal laser scanning microscopy and flow cytometry indicated permeabilization of the plasma membrane to the anionic fluorophore, DiBAC4(3) [bis(1,3-dibutylbarbituric acid) trimethine oxonol]. Loss of plasma membrane electrochemical potential was accompanied by loss of regulated cellular volume control. Changes in ultrastructure revealed by electron microscopy and capacity for oxygen consumption, were also consequences of nitrosative stress. Roussin's black salt (RBS), active at micromolar concentrations was the most potent of the three agents tested. CONCLUSIONS: These multitargeted cytotoxic agents affected plasma membrane functions, inhibited cellular functions in Giardia intestinalis and led to loss of viability. SIGNIFICANCE AND IMPACT OF THE STUDY: Nitrosative damage, as an antigiardial strategy, may have implications for development of chemotherapy along with suggesting natural host defence mechanisms. 相似文献
11.
12.
13.
14.
Arginine dihydrolase pathway in Lactobacillus buchneri: a review 总被引：1，自引：0，他引：1
The arginine dihydrolase system was studied in homo- and hetero-fermentative lactic acid bacteria. This system is widely distributed in Betabacteria lactobacilli subgroup (group II in Bergey's Manual). It is generally absent in the Thermobacterium lactobacilli subgroup (group IA in Bergey's Manual) and also in the Streptobacterium subgroup (group IB in Bergey's Manual). It is present in some species of the genus Streptococcus (groups II, III and IV in Bergey's Manual). In Lactobacillus buchneri NCDO110 the 3 enzymes of the arginine dihydrolase pathway, arginine deiminase, ornithine transcarbamylase and carbamate kinase, were purified and characterized. Arginine deiminase was partially purified (68-fold); ornithine transcarbamylase was also partially purified (14-fold), while carbamate kinase was purified to homogeneity. The apparent molecular weight of the enzymes was 199,000, 162,000 and 97,000 for arginine deiminase, ornithine transcarbamylase and carbamate kinase respectively. For arginine deiminase, maximum enzymatic activity was observed at 50 degrees C and pH 6; for ornithine transcarbamylase it was observed at 35 degrees C and pH 8.5, and for carbamate kinase at 30 degrees C and pH 5.4. The activation energy of the reactions was determined. For arginine deiminase, delta G* values were: 8,700 cal mol-1 below 50 degrees C and 380 cal mol-1 above 50 degrees C; for ornithine transcarbamylase, the values were: 9,100 cal mol-1 below 35 degrees C and 4,300 cal mol-1 above 35 degrees C; for carbamate kinase, the activation energy was: 4,078 cal mol-1 for the reaction with Mn2+ and 3,059 cal mol-1 for the reaction with Mg2+.(ABSTRACT TRUNCATED AT 250 WORDS) 相似文献
15.
16.
We used translation-blocking morpholinos to reduce protein levels in Giardia intestinalis. Twenty-four hours after electroporation with morpholinos targeting either green fluorescent protein or kinesin-2b, levels of these proteins were reduced by 60%. An epitope-tagged transgene can also be used as a reporter for morpholino efficacy with targets lacking specific antibodies.Giardia intestinalis (synonym Lamblia) is a parasitic protist and a major cause of diarrheal disease in developing countries (1, 16). Certain aspects of giardial biology have proved intractable for researchers seeking to study gene function. The trophozoite contains two diploid nuclei, making the cell effectively tetraploid and gene knockouts infeasible (1a). In addition, although Giardia contains RNA interference genes (homologs of Dicer and Argonaute genes) and this machinery was recently implicated in the control of antigenic variation (13, 15), attempts to manipulate this system for gene knockdown have been unsuccessful (C. C. Wang, personal communication).While many valuable tools for studying gene function in Giardia have been developed, a fast, reliable method to knock down genes is still lacking. A few researchers have used virus-mediated ribozyme constructs to achieve gene knockdown (3). However, the selection of transformants may eliminate cells in which knockdown is deleterious. Dominant-negative mutants are also used to study gene function (4, 7), but few genes are amenable to this approach. Various levels of knockdown (from 34 to 100%) have been achieved by expressing the antisense sequence of large portions of the open reading frame of the target gene under the control of a strong promoter (6, 9, 10, 13, 20). But because a promoter allowing for the tight control of Giardia gene expression has not been developed, this approach can be applied to study only nonessential (13) or encystation-specific (6, 10) genes. Furthermore, it is not possible to control for off-target effects when using this technique.Morpholinos are modified antisense oligonucleotides in which a six-membered morpholine ring replaces the deoxyribose ring of DNA and nonionic phosphorodiamidate linkages replace the typical anionic phosphodiester linkages (11). As a result, they cannot be degraded by cellular nucleases and are stable in cell culture (19). When designed to bind between the 5′ cap and a point 25 nucleotides downstream of the translation start site of the target mRNA, morpholinos (typically 25-mers) will sterically block ribosome binding and prevent the translation of the target gene (19). These translation-blocking morpholinos have been used previously to prevent new protein synthesis in trypanosomes (17).To determine the efficacy of translation-blocking morpholinos in Giardia, we first targeted enhanced green fluorescent protein (enhanced GFP) in a strain expressing the GFP gene under the control of the glutamate dehydrogenase promoter (23). In this strain, diffuse GFP fluorescence is found throughout the cytoplasm (data not shown). The 25-mer morpholino was designed to target the first 24 bases of the GFP open reading frame, plus 1 base upstream of the start codon (Table (Table1).1). As a specificity control, we used a morpholino containing five mispaired bases (Table (Table1).1). The inclusion of five mispairs has been shown to destabilize the pairing of the morpholino with its target unless the cytoplasmic morpholino concentration is extremely high; therefore, this control can act as a sensor for concentration-dependent off-target effects (11). This control morpholino also shares its chemical properties and base composition with the experimental morpholino.
Open in a separate windowaLowercase letters indicate mispaired bases.Giardia trophozoites were cultured as described previously (14), and the introduction of morpholinos by electroporation was done essentially as described previously for plasmids (18). Lyophilized morpholinos (Gene Tools, LLC, Philomath, OR) were resuspended in sterile water to a concentration of 1 mM. This stock was added directly to a 0.4-cm cuvette with ∼5 × 106 cells in 0.3 ml of medium to produce the desired concentration of morpholinos. For the negative control, a volume of sterile water equal to the volume of the morpholino suspension was added. After electroporation, cells were grown for the amounts of time indicated in the figures and then analyzed by flow cytometry (Fig. (Fig.1).1). For flow cytometry, cells were first incubated in warm HEPES-buffered saline for 30 min to facilitate GFP fluorescence and then fixed with 1% paraformaldehyde and counted on a Beckman-Coulter EPICS XL analyzer. Twenty thousand cells from each sample were counted, enhanced GFP fluorescence was measured, and a gate for GFP-positive cells was created based on comparison to wild-type cells (see Fig. S1 in the supplemental material).Open in a separate windowFIG. 1.Time course of GFP knockdown by morpholinos. Cells were collected at the indicated times after electroporation with water (no-morpholino control), 100 μM mispair anti-GFP morpholino, 10 μM anti-GFP morpholino, or 100 μM anti-GFP morpholino. Fixed samples were subjected to flow cytometry and categorized as GFP positive or GFP negative compared to a wild-type control (see Fig. S1 in the supplemental material). The number of GFP-positive cells in the no-morpholino control culture at each time point was set to 100%. The 96-h culture consisted of cells that were passaged 72 h after electroporation and then grown an additional 24 h before collection. These data are the averages of results for three biological replicates, and error bars represent one standard deviation.In all cases, the presence of a morpholino had no observable effect on cell growth compared to that of the no-morpholino control (data not shown). GFP levels in the no-morpholino and mispair controls remained approximately equal at all time points (Fig. (Fig.1;1; also see Fig. S2 in the supplemental material for representative flow cytometry histograms). However, 24 h after electroporation, GFP levels in the cultures treated with 100 μM anti-GFP morpholino had decreased by ∼60%, and they remained at approximately this level for the next 2 days, increasing only after the cultures were passaged and allowed to grow for 24 h (Fig. (Fig.1,1, 96 h). In the cultures treated with 10 μM anti-GFP morpholino, protein levels decreased by a maximum of ∼40%. Treatment with a higher concentration of morpholino (200 μM) produced approximately the same level of knockdown as treatment with 100 μM (see Fig. S3 in the supplemental material). For both the GFP and G. intestinalis kinesin-2b (GiKIN2b) experiments described below, maximum knockdown was not achieved until 24 h after electroporation (data not shown). This delay likely reflects the time needed for the turnover of preexisting protein in the cell and/or dilution by cell division.To determine whether the remaining GFP-positive cells received morpholinos, we treated cells with a fluorescently labeled anti-GFP morpholino by electroporation. Twenty-four hours after electroporation, >99% of cells with 100 or 200 μM morpholino were positive for morpholino fluorescence whereas only ∼37% of cells with 10 μM morpholino were positive (see Fig. S4 in the supplemental material). However, within the morpholino-positive cells, there was no obvious correlation between morpholino fluorescence and GFP levels. The remaining GFP-positive cells in these experiments likely started out with more GFP than the GFP-negative cells (the population is heterogeneous due to variations in plasmid copy number) and did not receive enough morpholinos to reduce the GFP below the level of detection.Next, we designed a morpholino to target an endogenous protein, G. intestinalis KIN2b (GiKIN2b) (Table (Table1).1). This protein is a homolog of the previously characterized G. intestinalis kinesin-2a (GiKIN2a), which is involved in anterograde intraflagellar transport in Giardia (7). In the GiKIN2a study, the expression of a dominant-negative GiKIN2a mutant produced cells with shortened flagella (7). Because the two kinesin-2 homologs likely function in the same complex (21), we chose to target GiKIN2b for morpholino knockdown to compare the resulting phenotype with the known phenotype of the GiKIN2a dominant-negative mutant.To track the levels of the GiKIN2b protein, we produced a GiKIN2b-specific antibody that recognizes a single ∼72-kDa band in Giardia extracts (Fig. (Fig.2A).2A). A 732-nucleotide segment of GiKIN2b (GenBank accession no. XP_001708236) containing the region encoding the C-terminal stalk and tail of the protein was cloned from Giardia genomic DNA by using primers kin-2b forward (5′-ACTGATATCTAATGGGTGCAGGGTTTACGGGCTATAC-3′) and kin-2b reverse (5′-ACTGCGGCCGCTCAACCGAAACCAGCCATGCCACG- 3′) and introduced into the vector pET30c (EMD Biosciences, Gibbstown, NJ), which includes a sequence encoding an N-terminal His tag. Purification on Ni-nitrilotriacetic acid beads under denaturing conditions was performed according to the instructions of the bead manufacturer (Qiagen, Valencia, CA). The purified protein was used to inoculate two New Zealand White rabbits according to a 77-day immunization protocol developed by Covance (Denver, PA).Open in a separate windowFIG. 2.Translation-blocking morpholinos reduce GiKIN2b protein levels and cause extreme shortening of the flagella. (A) The GiKIN2b antibody produced for this study recognizes a band of the correct size (72 kDa) on Giardia extract immunoblots. (B) Results from a representative immunoblot analysis of samples 24 h after electroporation with water (no-morpholino control), 100 μM mispair anti-GiKIN2b morpholino, or 100 μM anti-GiKIN2b morpholino. PDI-2 was used as a loading control. For each sample, the ratio of GiKIN2b to PDI-2 is given. (C) Average ratios of GiKIN2b to PDI-2 on immunoblots from three experiments like the one described in the legend to panel B. The GiKIN2b/PDI-2 ratio in the no-morpholino control was set to 100%. Error bars represent one standard deviation from the average for three biological replicates. (D) Diagram of a Giardia cell and immunolabeling of wild-type and anti-GiKIN2b morpholino-treated cells. Fixed cells were labeled with an anti-α-tubulin antibody. In the diagram, the identities of the four pairs of flagella are indicated: afl, anterior flagella; pfl, posteriolateral flagella; vfl, ventral flagella; and cfl, caudal flagella. The median body (mb), a bundle of microtubules with an unknown function; the ventral disc (vd), used to attach to substrates; and two nuclei (N) are also labeled. Scale bar, 11 μm. (E) Distribution of mutant phenotypes in fixed and immunolabeled samples. Cells were collected 24 h after electroporation with water (no-morpholino control), 100 μM mispair anti-GiKIN2b morpholino, or 100 μM anti-GiKIN2b morpholino. Cells were classified as normal, mutant (missing the external portions of at least two pairs of flagella), or other (could not be categorized). One hundred cells from each sample were counted.The resulting antibody was used on fluorescent immunoblots at a concentration of 1:50,000, along with an anti-protein disulfide isomerase 2 (anti-PDI-2) antibody (a gift from F. D. Gillin [8]) at 1:500,000 as a loading control (9) (Fig. (Fig.2B).2B). The ratio of GiKIN2b to PDI-2 was used to compare amounts of GiKIN2b at different time points (Fig. 2B and C). The blots were visualized with a Li-Cor Odyssey infrared imager, and densitometry was performed using the Li-Cor Odyssey software according to the manufacturer''s instructions.When used at 100 μM, the anti-GiKIN2b morpholino achieved a 60% reduction in protein levels in 24 h (Fig. (Fig.2C).2C). Mutants with disrupted cytoskeletons were also observed among fixed cells (Fig. (Fig.2D).2D). Immunostaining with the TAT1 antibody (22) (a gift from K. Gull), image collection, and deconvolution were performed essentially as described previously (12). The cytoskeleton of a Giardia cell includes four pairs of flagella, a bundle of microtubules called the median body, and several other structures (5) (Fig. (Fig.2D).2D). In the mutant cells, the entire external regions of at least two pairs of flagella were missing, with only internal axonemes remaining. The caudal and posteriolateral flagella were most often affected, though three or even all four sets of flagella of some cells were affected. These cells also often had reduced or missing median bodies. After 24 h, approximately 14% of cells in the knockdown cultures displayed mutant phenotypes, compared to 5% in the mispair control culture and 1% in the no-morpholino control culture (Fig. (Fig.2E2E).When using translation-blocking morpholinos in Giardia, determining the level of knockdown generally requires a specific antibody. However, zebrafish researchers have used an epitope-tagged protein to provide a readout for morpholino efficacy (2). To determine whether this strategy would work for Giardia, we used the GiKIN2b morpholino in a strain carrying a plasmid encoding a C-terminally GFP-tagged GiKIN2b protein under the control of its native promoter (7). Thus, the same morpholino could be used to knock down the endogenous and GFP-tagged GiKIN2b proteins simultaneously.Although the endogenous protein in this strain was reduced to the same level as that in the wild type after 24 h, GiKIN2b-GFP took a total of 48 h after electroporation to reach that level (Fig. (Fig.3A).3A). This delay may be due to a difference in the turnover rate between the endogenous GiKIN2b and the GFP-tagged protein and probably also to high gene dosages in cells with multiple copies of the plasmid. Twenty-four hours after electroporation, 50% of the morpholino-treated cells displayed mutant phenotypes (shortened/missing flagella) (Fig. (Fig.3B).3B). In fact, even 15% of the cells of the GiKIN2b::GFP strain without morpholino treatment were mutants. We hypothesize that the GiKIN2b-GFP fusion protein interferes with wild-type GiKIN2b complex function, sensitizing the cells to morpholino knockdown of the remaining GiKIN2b.Open in a separate windowFIG. 3.GFP-tagged GiKIN2b is knocked down by the anti-GiKIN2b morpholino. (A) The ratios of GiKIN2b or GiKIN2b-GFP to PDI-2 on immunoblots are plotted, with the ratio in the mispair control sample set to 100%. Cells were collected 24 and 48 h after electroporation with 100 μM mispair anti-GiKIN2b morpholino or 100 μM anti-GiKIN2b morpholino. (B) Distribution of mutant phenotypes in fixed and immunolabeled samples. GiKIN2b::GFP cells were collected 24 h after electroporation with water (control) or 100 μM anti-GiKIN2b morpholino. Cells were classified as normal, mutant (missing the external portions of at least two pairs of flagella), or other (could not be categorized). One hundred cells from each sample were counted.The phenotype of GiKIN2b knockdown reveals some aspects of kinesin-2 function that the dominant-negative GiKIN2a may have obscured. Induction of the dominant-negative GiKIN2a resulted in a 15 to 30% decrease in flagellar length (7). However, morpholino knockdown of GiKIN2b produced cells missing the entire external regions of their flagella, suggesting that the remaining external flagellar regions of the dominant-negative cells were due probably to residual activity of the wild-type heterotrimeric complex. In any case, some conclusions can be drawn from the results of both studies: that different pairs of flagella are not equally susceptible to kinesin-2 disruption and that the cytoplasmic regions of the flagella are not maintained solely by kinesin-2-mediated intraflagellar transport.Using translation-blocking morpholinos, we achieved a 60% reduction in protein levels in 24 h for both targets. However, for two different targets, unpublished data suggest that up to 80% knockdown can be achieved (A. R. Paredez and S. C. Dawson, unpublished data). Due to their efficacy, rapid action, specificity, and stability in cell culture, we believe that morpholinos have the potential to become a powerful new tool in the field of Giardia biology. 相似文献
TABLE 1.
Morpholinos used in this study| Morpholino | Sequence (5′ to 3′)a |
|---|---|
| Anti-GFP | CAGCTCCTCGCCCTTGCTCACCATG |
| Mispair anti-GFP | CAcCTgCTCGCCgTTGCTgACgATG |
| Anti-GiKIN2b | GCCTTTGCCCTTACTCTTGCTCATC |
| Mispair anti-GiKIN2b | GCgTTTcCCCTTAgTCTTcCTgATC |
17.
18.
19.
Testa F Mastronicola D Cabelli DE Bordi E Pucillo LP Sarti P Saraiva LM Giuffrè A Teixeira M 《Free radical biology & medicine》2011,51(8):1567-1574
Unlike superoxide dismutases (SODs), superoxide reductases (SORs) eliminate superoxide anion (O2•−) not through its dismutation, but via reduction to hydrogen peroxide (H2O2) in the presence of an electron donor. The microaerobic protist Giardia intestinalis, responsible for a common intestinal disease in humans, though lacking SOD and other canonical reactive oxygen species-detoxifying systems, is among the very few eukaryotes encoding a SOR yet identified. In this study, the recombinant SOR from Giardia (SORGi) was purified and characterized by pulse radiolysis and stopped-flow spectrophotometry. The protein, isolated in the reduced state, after oxidation by superoxide or hexachloroiridate(IV), yields a resting species (Tfinal) with Fe3+ ligated to glutamate or hydroxide depending on pH (apparent pKa = 8.7). Although showing negligible SOD activity, reduced SORGi reacts with O2•− with a pH-independent second-order rate constant k1 = 1.0 × 109 M− 1 s− 1 and yields the ferric-(hydro)peroxo intermediate T1; this in turn rapidly decays to the Tfinal state with pH-dependent rates, without populating other detectable intermediates. Immunoblotting assays show that SORGi is expressed in the disease-causing trophozoite of Giardia. We propose that the superoxide-scavenging activity of SOR in Giardia may promote the survival of this air-sensitive parasite in the fairly aerobic proximal human small intestine during infection. 相似文献
20.
The cyclophilins (Cyps) are family members of proteins that exhibit peptidylprolyl cis-trans isomerase (PPIase, EC 5.2.1.8) activity and bind the immunosuppressive agent cyclosprin A (CsA) in varying degrees. During the process of random sequencing of a cDNA library made from Giardia intestinalis WB strain, the cyclophilin gene (gicyp 1) was isolated. An open reading frame of gicyp 1 gene was 576 nucleotides, which corresponded to a translation product of 176 amino acids (Gicyp 1). The identity with other Cyps was about 58-71%. The 13 residues that constituted the CsA binding site of human cyclophilin were also detected in the amino acid sequence of Gicyp 1, including tryptophan residue essential for the drug binding. The single copy of the gicyp 1 gene was detected in the G. intestinalis chromosome by southern hybridization analysis. Recombinant Gicyp 1 protein clearly accelerated the rate of cis-->trans isomerization of the peptide substrate and the catalysis was completely inhibited by the addition of 0.5 microM CsA. 相似文献