The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.     

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Structural characteristics (reassociation and melting kinetics) of kinetoplast DNA from Crithidia oncopelti

A highly purified associate of kinetoplast DNA is isolated from C. oncopelti, and its physico-chemical properties are studied. Both native associate and its ultrasonic fragments are found to have a complex character of melting. 5-6 melting zones (3 of them being the main) are found on the melting curve. Analysis of reassociation kinetics of sonicated associate of kinetoplast DNA has revealed the presence of at least two components: fast reassociating component (65-70% of complex DNA), which reassociation kinetics is equivalent to the unique sequence with molecular weight of 2.3. - 10(6) daltons, and slow reassotiating component (15% of complex DNA), having reassociation kinetics equivalent to unique sequence of 26 - 10(6) daltons. The data obtained suggest that complex associate of kinetoplast DNA is heterogenous for its nucleotide sequence and base composition.     

Repeated sequences with unusual properties from the divergent region of Crithidia oncopelti maxicircle kinetoplast DNA

Summary The occurrence of bacterial promoter-like sequences was shown in the divergent region ofCrithidia oncopelti maxicircular kinetoplast DNA. A promoter-cloning vector based on the neomycin phosphotransferase II (NPT II) gene was used to localize promoters in three homologous blocks of repeated sequences. The elements found displayed greater promoter strength inEscherichia coli than the normal promoter of the NPT II gene. Sequences of three promoter-containing inserts from different blocks were determined and typical prokaryotic promoter sequences were localized.     

The structure of the yeast ribosomal RNA genes. I. The complete nucleotide sequence of the 18S ribosomal RNA gene from Saccharomyces cerevisiae.

The cloned 18 S ribosomal RNA gene from Saccharomyces cerevisiae have been sequenced, using the Maxam-Gilbert procedure. From this data the complete sequence of 1789 nucleotides of the 18 S RNA was deduced. Extensive homology with many eucaryotic as well as E. coli ribosomal small subunit rRNA (S-rRNA) has been observed in the 3'-end region of the rRNA molecule. Comparison of the yeast 18 S rRNA sequences with partial sequence data, available for rRNAs of the other eucaryotes provides strong evidence that a substantial portion of the 18 S RNA sequence has been conserved in evolution.     

The nucleotide sequence of 5S ribosomal RNA from Schizosaccharomyces pombe

The nucleotide sequence of 5S rRNA from the fission yeast, S. pombe, has been established by post labeling procedures combined with cataloging RNase T1- and A-oligonucleotides derived from unlabeled 5S rRNA. The sequence consists of 119 nucleotides without a modified base and shows more dissimilarities (at 38 positions) from that of S. cerevisiae than from that of humans (at 33 positions).     

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista.     

The nucleotide sequence of the 5S ribosomal RNA from a photobacterium

Comparative sequencing studies provide powerful insights into molecular function and evolution. The sequence for 5S ribosomal RNA from Photobacter strain 8265 is eighteen base replacements removed from that of Escherichia coli. Of these, the vast majority involve a G or C becoming an A or U. These variations also define unequivocally a hexanucleotide base paired region, which appears to be a universal feature of the 5S RNA molecule. The base composition of this helix seems to be under rather stringent, and so unusual, energetic constraints. The possible implications of this are discussed - in particular the prospect of a 5S RNA molecule that undergoes conformational transitions as a part of the overall state changes that constitute the function of the ribosome.     

The nucleotide sequence of the 16S ribosomal RNA gene of the archaebacterium Halococcus morrhua.

The sequence of the 16S rRNA gene from the archaebacterium Halococcus morrhua was determined by the dideoxynucleotide sequencing method. It is 1475 nucleotides long. This is the second archaebacterial sequence to be determined and it provides sequence comparison evidence for the secondary structural elements confined to the RNAs of this kingdom and, also, support for controversial or additional base pairing in the eubacterial RNAs. Six structural features are localized that have varied during the evolution of the archaebacteria, eubacteria and eukaryotes. Moreover, although the secondary structures of both sequenced archaebacterial RNAs strongly resemble those of eubacteria, they contain sufficient eukaryotic-like structural characteristics to reinforce the view that they belong to a separate line of evolutionary descent.