Bisintercalation of ditercalinium into a d(CpGpApTpCpG)2 minihelix: a 1H- and 31P-NMR study

The structure of the complex formed in aqueous solution between ditercalinium, a bisintercalating drug, and the self-complementary hexanucleotide d(CpGpApTpCpG)2 is investigated by 400-MHz 1H-nmr and 162-MHz 31P-nmr. Whatever the drug to helix ratio, ditercalinium occurred in the bound form, whereas free and complexed hexanucleotide are in slow exchange. This allows unambiguous resonance assignment through two-dimensional chemical exchange experiments. The strong upfield shifts measured on most aromatic protons on both drug and bases as well as on DNA imino protons are consistent with bisintercalation of the dimer. Nuclear Overhauser effects observed between drug and nucleotide protons give a defined geometry for complexation, and suggest a DNA conformational change upon drug binding.     

1H- and 31P-NMR studies of ditercalinium binding to a d(GCGC)2 and d(CCTATAGG)2 minihelices: a sequence specificity study

The structures of the complexes formed in aqueous solution between ditercalinium, a bis-intercalating drug, and both the self-complementary tetranucleotide d(GCGC)2 and octanucleotide d(CCTATAGG)2, have been investigated by 400-MHz 1H-nmr and 162-MHz 31P-nmr. All the nonexchangeable protons, as well as the exchangeable imino protons and the phosphorus signals, have been assigned. Both oligonucleotides have been shown to adopt a right-handed B-DNA type structure. The addition of ditercalinium to the oligonucleotides lead to the formation of complexes in slow exchange at the nmr time scale with the free helices. At all drug-to-helix ratios studied, the ditercalinium was found in the bound form, whereas free and complexed oligonucleotides were in slow exchange, allowing resonance assignments through two-dimensional chemical exchange experiments. for d(GCGC)2 the strong upfield shifts induced on all aromatic protons of both the bases and the drug by complexation with ditercalinium suggest an interaction by intercalation of the two rings. However, the loss of twofold symmetry upon binding, as well as the chemical shift variation of the drug proton signals of one of the chromophores with temperature and concentration, favor a model in which the drug-nucleotide complexes have one ring of the drug intercalated and the other stacked on top of the external base pair. The intermolecular contacts between drug protons and nucleotide protons give a defined geometry for complexation that is consistent with the proposed model. In contrast, with d(CCTATAGG)2 several drug-nucleotide complexes were formed and a large increase in line broadening was observed at high drug-to-DNA ratios, precluding a detailed analysis of these complexes. However, the large upfield shift in the imino proton resonances together with the shielding of the ditercalinium ring protons favor a model with bis-intercalation of ditercalinium. This model is supported by the downfield shift of at least 4 out of 14 phosphorus signals. The results are compared with those obtained on ditercalinium binding to the homologous sequences d(CGCG)2 and d(TTCGCGAA)2, and discussed in terms of sequence specificity.     

Study of the bisintercalation of the antitumor drug ditercalinium by 31P-NMR

Bisintercalation of ditercalinium, a potent antitumoral 7H-pyriodo[4,3-c]carbazole rigid dimer, into the self-complementary tetranucleotides d(CpGpCpG)₂, d(m⁵CpGpm⁵CpG) and the self-complementary hexanucleotide d(CpGpApTpCpG)₂ was investigated by 162-MHz ³¹P-nmr. The slow exchange, on the nmr time scale, observed between the free and complexed nucleotides allows identification of the phosphorus signals in the complexes through two-dimensional chemical exchange spectroscopy. Differences in ³¹P chemical shifts upon intercalation are discussed in relation to the complex geometry and nature of the drug.     

1H NMR study of the structure of a pyridocarbazole dimer-d[CpGpCpG] complex

The structure of the complexes formed between a 7H-pyridocarbazole dimer (ditercalinium) or the corresponding monomer and d[CpGpCpG] is analyzed in aqueous solution by 270 MHz 1H NMR. In both cases the strong upfield shifts observed on most aromatic resonances are assigned to the formation of intercalated complexes. Bisintercalation of the dimer in the tetranucleotide minihelix is then observed at pH 5.5. The observation of intermolecular negative NOEs induced to some drug resonances by irradiation of sugar protons confirms these conclusions. The orientation of the ligand in the intercalation site is discussed.     

Comparison of the bis-intercalating complexes formed between either ditercalinium or a flexible analogue and d(CpGpCpG)2 or d(TpTpCpGpCpGpApA)2 minihelices: 1H- and 31P-NMR analyses.

The 400-MHz 1H- and 162-MHz 31P-nmr have been used to study complexes constituted by (a) the d(TpTpCpGpCpGpApA)2 or the d(CpGpCpG)2 self-complementary oligonucleotides and (b) two bifunctional 7H-pyrido [4,3-c] carbazole dimer drugs, the antitumoral ditercalinium (NSC 366241), a dimer with a rigid bis-piperidine linking chain and its pharmacologically inactive analogue, a dimer with a flexible spermine-like linking chain. Nearly all proton and phosphorus signals have been assigned by two-dimensional (2D) nmr (correlated spectroscopy, homonuclear Hartmann-Hahn, nuclear Overhauser enhancement spectroscopy, 2D 31P (1H) heteronuclear correlated spectroscopy and 31P-31P chemical exchange experiments). Both drugs bis-intercalate into the two CpG sites. The complexes show small differences in the position of the 7H-pyrido [4,3-c] carbazole ring into the intercalation site and possibly in the ribose-phosphate backbone deformation. However, the inactive analogue exhibits a longer residence lifetime in octanucleotide than the ditercalinium does. All these results are discussed in terms of differences in dimer activities.     

1H NMR study of an ethidium dimer poly(dA-dT) complex: evidence of a transition between bis and monointercalation

Comparative 1H NMR and optical studies of the interaction between poly(dA-dT), ethidium bromide (Et) and ethidium dimer (Et2) in 0.7 M NaCl are reported as a function of the temperature. Denaturation of the complexes followed at both polynucleotide and drug levels leads to a biphasic melting process for poly(dA-dT) complexed with ethidium dimer (t1/2 = 75 degrees C; 93 degrees C) but a monophasic one in poly(dA-dT): ethidium bromide complex (t1/2 = 74 degrees C). In both cases drug signals exhibit monophasic thermal dependence (Et = 81 degrees C; Et2 = 95 degrees C). Evidence is presented showing that the ethidium dimer bisintercalates into poly(dA-dT) in high salt, based on the observation that i) dimer and monomer ring protons exhibit similar upfield shifts upon DNA binding, ii) upfield shifts of DNA sugar protons are twice as large with the dimer than with ethidium bromide. Comparison between native DNA fraction and bound drug fraction indicates that ethidium covers, n = 2.5-3 base pairs. The dimer bisintercalates and covers, n = 5.7 base pairs when the helix fraction is high but as the number of available sites decreases the binding mode changes and the drug monointercalates (n = 2.9).     

Proton and phosphorus NMR studies of d-CpG(pCpG)n duplexes in solution. Helix-coil transition and complex formation with actinomycin-D.

The Watson–Crick imino and amino exchangeable protons, the nonexchangeable base and sugar protons, and the backbone phosphates for d-CpG(pCpG)_n, n = 1 and 2, have been monitored by high-resolution nmr spectroscopy in aqueous solution over the temperature range 0°–90°C. The temperature dependence of the chemical shifts of the tetramer and hexamer resonances is consistent with the formation of stable duplexes at low temperature in solution. Comparison of the spectral characteristics of the tetranucleotide with those of the hexanucleotide with temperature permits the differentiation and assignment of the cytosine proton resonances on base pairs located at the end of the helix from those in an interior position. There is fraying at the terminal base pairs in the tetranucleotide and hexanucleotide duplexes. The Watson–Crick ring imino protons exchange at a faster rate than the Watson–Crick side-chain amino protons, with exchange occurring by transient opening of the double helix. The structure of the d-CpG(pCpG)_n double helices has been probed by proton relaxation time measurements, sugar proton coupling constants, and the proton chemical shift changes associated with the helix–coil transition. The experimental data support a structural model in solution, which incorporates an anti conformation about the glycosyl bonds, C(3) exo sugar ring pucker, and base overlap geometries similar to the B-DNA helix. Rotational correlation times of 1.7 and 0.9 × 10^?9 sec have been computed for the hexanucleotide and tetranucleotide duplexes in 0.1 M salt, D₂O, pH 6.25 at 27°C. The well-resolved ³¹P resonances for the internucleotide phosphates of the tetramer and hexamer sequences at superconducting fields shift upfield by 0.2–0.5 ppm on helix formation. These shifts reflect a conformational change about the ω,ω′ phosphodiester bonds from gauche-gauche in the duplex structure to a distribution of gauche-trans states in the coil structure. Significant differences are observed in the transition width and midpoint of the chemical shift versus temperature profiles plotted in differentiated form for the various base and sugar proton and internucleotide phosphorous resonances monitoring the d-CpG(pCpG)_n helix–coil transition. The twofold symmetry of the d-CpGpCpG duplex is removed on complex formation with the antibiotic actinomycin-D. Two phosphorous resonances are shifted downfield by ～2.6 ppm and ～1.6 ppm on formation of the 1:2 Act-D:d-CpGpCpG complex in solution. Model studies on binding of the antibiotic to dinucleotides of varying sequence indicate that intercalation of the actinomycin-D occurs at the GpC site in the d-CpGpCpG duplex and that the magnitude of the downfield shifts reflects strain at the O-P-O backbone angles and hydrogen bonding between the phenoxazone and the phosphate oxygens. Actinomycin-D is known to bind to nucleic acids that exhibit a B-DNA conformation; this suggests that the d-CpG(pCpG)_n duplexes exhibit a B-DNA conformation in solution.     

DNA nicking by HinP1I endonuclease: bending, base flipping and minor groove expansion

HinP1I recognizes and cleaves the palindromic tetranucleotide sequence G↓CGC in DNA. We report three structures of HinP1I–DNA complexes: in the presence of Ca²⁺ (pre-reactive complex), in the absence of metal ion (binary complex) and in the presence of Mg²⁺ (post-reactive complex). HinP1I forms a back-to-back dimer with two active sites and two DNA duplexes bound on the outer surfaces of the dimer facing away from each other. The 10 bp DNA duplexes undergo protein-induced distortions exhibiting features of A-, B- and Z-conformations: bending on one side (by intercalation of a phenylalanine side chain into the major groove), base flipping on the other side of the recognition site (by expanding the step rise distance of the local base pair to Z-form) and a local A-form conformation between the two central C:G base pairs of the recognition site (by binding of the N-terminal helix in the minor groove). In the pre- and post-reactive complexes, two metals (Ca²⁺ or Mg²⁺) are found in the active site. The enzyme appears to cleave DNA sequentially, hydrolyzing first one DNA strand, as seen in the post-reactive complex in the crystalline state, and then the other, as supported by the observation that, in solution, a nicked DNA intermediate accumulates before linearization.     

1H-NMR studies of a monointercalating drug into a d[CpGpCpG]2 minihelix

The structure of the complex formed between the 7H-pyridocarbazole monomer [{(2-piperidyl)-2,1-ethane-yl} {10-methoxy-7H-pyrido[4,3-c]carbazolium} dimethane sulfonate] and the autocom-plementary tetranucleotide d(CpGpCpG)₂ in aqueous solution is analyzed by 270-MHz and 400-MHz ¹H-nmr. The strong upfield shifts observed on most aromatic resonances of both the drug and the nucleotide are interpreted as the result of intercalation of the 7H-pyridocarbazole monomer in the base-paired minihelix of d(CpGpCpG). The observation of intermolecular negative nuclear Overhauser effects induced in some drug resonances by irradiation of sugar protons confirms this conclusion. A privileged orientation of the drug in the intercalation site with the quaternizing ethyl piperidine chain protruding in the major groove is proposed.     

Intercalative binding of ditercalinium to d(CpGpCpG)2: a theoretical study

The structure of the complex formed between ditercalinium, 2,2'-[4,4'-bipiperidine-1,1'-bis-(ethane-1,2-diyl)]bis(10-me thoxy-7H- pyrido[4,3-c]carbazolium) tetramethane sulfonate (NSC 366241), and the self-complementary tetranucleotide duplex d(CpGpCpG)2 has been investigated by means of a novel theoretical approach for modelling the conformational flexibility of nucleic acids. The methodology used is the JUMNA procedure, a molecular mechanics systematics capable of evaluating the internal energy and the interaction energy of a complex formed from a large number of fragments. In the best energy-minimized structures, the piperidinium chains of ditercalinium are located in the major groove of the right-handed oligonucleotide. Calculations show a distortion of the base-paired d(CpGpCpG)2 minihelix consisting of lateral dislocation of one base pair with respect to another along an axis parallel to the long axis; strong propeller twist and tilt of the end base pairs; a collective motion of all base pairs with respect to the helical axis towards the drug; and an overwinding at the exclusion site. The proposed structure of the complex is in good agreement with reported proton NMR data, supporting the feasibility of such model.     

1H-NMR structural analysis of ethidium bromide complexation with self-complementary deoxytetranucleotides 5′-d (ApCpGpT), 5′-d (ApGpCpT), and 5′-d (TpGpCpA) in aqueous solution

Complexation of the trypanocidal drug, ethidium bromide (EB), and the self-complementary deoxytetraribonucleoside triphosphates, 5′-d(ApCpGpT), 5′-d(ApGpCpT), and 5′-d(TpGpCpA), in aqueous salt solution has been investigated using one-dimensional and two-dimensional 500/600 MHz ¹H-nmr spectroscopy. Six hundred megahertz two-dimensional homonuclear ¹H-nmr spectroscopy (nuclear Overhauser effect spectroscopy) was used for a qualitative determination of the structures of EB binding with the deoxytetranucleotides. Concentration dependencies of proton chemical shifts of the molecules have been measured at constant temperatures (T = 303 or 308 K). Different successive schemes of complex formation between the dye molecule and the tetranucleotides have been examined by taking into account various molecular associations in solution, viz., 1:1, 1:2, 2:1 and 2:2 complexes. Equilibrium reaction constants and the limiting proton chemical shifts in the complexes have been determined. The relative contributions of different types of complexes in the equilibrium mixture have been determined and special features of the dynamic equilibrium have been revealed by analysis of chemical shifts as a function of both the dye and tetranucleotide concentrations. The present analysis leads to the conclusion that EB binds preferentially to the pyrimidine-purine sites of the tetranucleotide duplexes. The results show that the energy of EB binding depends on the base content in the pyrimidine-purine sites of the tetramers and on the nucleotide residuals flanking the preferential site. The most favorable structures of the 1:2 and 2:2 complexes of the dye with the tetranucleotides have been constructed using calculated values of induced chemical shifts of EB protons in conjunction with intermolecular nuclear Overhauser effects. The structures of the EB:tetranucleotide complexes depend on tetramer base sequence and are characterized by differences in helix parameters. © 1996 John Wiley & Sons, Inc.     

Strategy for trapping intermediates in the folding of ribonuclease and for using 1H-nmr to determine their structures

The major unfolded form of ribonuclease A is known to show well-populated structural intermediates transiently during folding at 0°–10°C. We describe here how the exchange reaction between D₂O and peptide NH protons can be used to trap folding intermediates. The protons protected from exchange during folding can be characterized by ¹H-nmr after folding is complete. The feasibility of using ¹H-nmr to resolve a set of protected peptide protons is demonstrated by using a specially prepared sample of ribonuclease S in D₂O in which only the peptide protons of residues 7–14 are in the ¹H-form. All eight of these protected peptide protons are H-bonded. Resonance assignments made on isolated peptides containing these residues have been used to identify the protected protons. Other sets of protected protons trapped in the ¹H-form can also be isolated by differential exchange, using either ribonuclease A or S. Earlier model compound studies have indicated that H-bonded folding intermediates should be unstable in water unless stabilized by additional interactions. Nevertheless, peptides derived from ribonuclease A that contain residues 3–13 do show partial helix formation in water at low temperatures. We discuss the possibility that specific interactions between side chains can stabilize short α-helixes by nucleating the helix, and that specific interactions may also define the helix boundaries at early stages in folding.     

Sequence-specific 1H and 15N resonance assignments and secondary structure of GDP-bound human c-Ha-Ras protein in solution

Summary All the backbone ¹H and ¹⁵N magnetic resonances (except for Pro residues) of the GDP-bound form of a truncated human c-Ha-ras proto-oncogene product (171 amino acid residues, the Ras protein) were assigned by ¹⁵N-edited two-dimensional NMR experiments on selectively ¹⁵N-labeled Ras proteins in combination with three-dimensional NMR experiments on the uniformly ¹⁵N-labeled protein. The sequence-specific assignments were made on the basis of the nuclear Overhauser effect (NOE) connectivities of amide protons with preceding amide and/or Cprotons. In addition to sequential NOEs, vicinal spin coupling constants for amide protons and C protons and deuterium exchange rates of amide protons were used to characterize the secondary structure of the GDP-bound Ras protein; six strands and five helices were identified and the topology of these elements was determined. The secondary structure of the Ras protein in solution was mainly consistent with that in crystal as determined by X-ray analyses. The deuterium exchange rates of amide protons were examined to elucidate the dynamic properties of the secondary structure elements of the Ras protein in solution. In solution, the -sheet structure in the Ras protein is rigid, while the second helix (A66-R73) is much more flexible, and the first and fifth helices (S17-124 and V152-L171) are more rigid than other helices. Secondary structure elements at or near the ends of the effector-region loop were found to be much more flexible in solution than in the crystalline state.     

DNA sequence recognition by the antitumor drug ditercalinium

The antitumor drug ditercalinium is a rare example of a noncovalent DNA-binding ligand that forms bisintercalation complexes via the major groove of the double helix. Previous structural studies have revealed that the two connected pyridocarbazolium chromophores intercalate into DNA with the positively charged bis(ethylpiperidinium) linking chain oriented to the wide groove side of the helix. Although the interaction of ditercalinium with short oligonucleotides containing 4-6 contiguous GC base pairs has been examined in detail by biophysical and theoretical approaches, the sequence preference for ditercalinium binding to long DNA fragments that offer a wide variety of binding sites has been investigated only superficially. Here we have investigated both sequence preferences and possible molecular determinants of selectivity in the binding of ditercalinium to DNA, primarily using methods based upon DNase I footprinting. A range of multisite DNA substrates, including several natural restriction fragments and different PCR-generated fragments containing unconventional bases (2,6-diaminopurine, inosine, uridine, 5-fluoro- and 5-methylcytosine, 7-deazaguanine, 7-deazaadenine, and N(7)-cyanoboranoguanine), have been employed to show that ditercalinium selectively recognizes certain GC-rich sequences in DNA and to identify some of the factors which affect its DNA-binding sequence selectivity. Specifically, the footprinting data have revealed that the 2-amino group on the purines or the 5-methyl group on the pyrimidines is not essential for the formation of ditercalinium-DNA complexes whereas the major groove-oriented N(7) of guanine does appear as a key element in the molecular recognition process. The loss of N(7) at guanines but not adenines is sufficient to practically abolish sequence-selective binding of ditercalinium to DNA. Thus, as expected for a major groove binding drug, the N(7) of guanine is normally required for effective complex formation with GC base pairs, but interestingly the substitution of the N(7) with a relatively bulky cyanoborane group does not markedly affect the sequence recognition process. Therefore, the hydrogen bond accepting capability at N(7) of guanines is not sufficient to explain the GC-selective drug-DNA association, and the implications of these findings are considered.     

Removal of DNA curving by DNA ligands: gel electrophoresis study.

The removal of inherent curving in Crithidia fasciculata kinetoplast DNA by various small DNA ligands, groove binders and mono- and bisintercalators, has been studied by gel retardation and electron microscopy. The migration of the kinetoplast DNA fragment is highly retarded during gel electrophoresis. We demonstrate that this retardation is suppressed by DNA ligands such as distamycin and ditercalinium, which have different modes of binding and sequence specificities. Observation by electron microscopy confirms that the effect of ditercalinium on gel migration of curved DNA is linked to DNA uncurving. As the drug is progressively added to DNA, a large broadening of the retarded band is observed during gel electrophoresis for distamycin and ditercalinium. In the case of distamycin, the retarded DNA band splits into two broad bands, whereas the noncurved DNA bands remain homogeneous. This indicates that the drug-DNA exchange is extremely slow in the gel and that a limited number of specific sites on DNA are critical for the removal of bending. GC-specific quinomycin, monointercalators, and bisintercalators act in a manner similar to that of AT-specific distamycin. This indicates that direct drug binding at the dAn tracts is not required for DNA uncurving. We propose that the uncurving of kinetoplast DNA by drugs is caused by a global alteration of DNA structure; subsequent increased flexibility leads to the suppression of rigid bending at the AT tract junctions.     

Sequence and conformational effects on imino proton exchange in A.T- and A.U-containing DNA and RNA duplexes

¹H-nmr relaxation has been used to study the effect of sequence and conformation on imino proton exchange in adenine–thymine (A · T) and adenine–uracil (A · U) containing DNA and RNA duplexes. At low temperature, relaxation is caused by dipolar interactions between the imino and the adenine amino and AH2 protons, and at higher temperature, by exchange with the solvent protons. Although room temperature exchange rates vary between 3 and 12s^?1, the exchange activation energies (E_α) are insensitive to changes in the duplex sequence (alternating vs homopolymer duplexes), the conformation (B-form DNA vs A-form RNA), and the identity of the pyrimidine base (thymine vs uracil). The average value of the activation energy for the five duplexes studied, poly[d(A-T)], poly[d(A) · d(T)], poly[d(A-U)], Poly[d(A) · d(U)], and poly[r(A) · r(U)], was 16.8 ± 1.3 kcal/mol. In addition, we find that the average E_α for the A.T base pairs in a 43-base-pair restriction fragment is 16.4 ± 1.0 kcal/mol. This result is to be contrasted with the observation that the E_α of cytosine-containing duplexes depends on the sequence, conformation, and substituent groups on the purine and pyrimidine bases. Taken together, the data indicate that there is a common low-energy pathway for the escape of the thymine (uracil) imino protons from the double helix. The absolute values of the exchange rates in the simple sequence polymers are typically 3–10 times faster than in DNAs containing both A · T and G · C base pairs.     

Exchange behavior of the H-bonded amide protons in the 3 to 13 helix of ribonuclease S

The preceding article shows that there are eight highly protected amide protons in the S-peptide moiety of RNAase S at pH 5, 0 degrees C. The residues with protected NH protons are 7 to 13, whose amide protons are H-bonded in the 3 to 13 alpha-helix, and Asp 14, whose NH proton is H-bonded to the CO group of Val47. We describe here the exchange behavior of these eight protected protons as a function of pH. Exchange rates of the individual NH protons are measured by 1H nuclear magnetic resonance in D2O. A procedure is used for specifically labeling with 1H only these eight NH protons. The resonance assignments of the eight protons are made chiefly by partial exchange, through correlating the resonance intensities in spectra taken when the peptide is bound and when it is dissociated from S-protein in 3.5 M-urea-d4, in D2O, pH 2.3, -4 degrees C. The two remaining assignments are made and some other assignments are checked by measurements of the nuclear Overhauser effect between adjacent NH protons of the alpha-helix. There is a transition in exchange behavior between pH 3, where the helix is weakly protected against exchange, and pH 5 where the helix is much more stable. At pH 3.1, 20 degrees C, exchange rates are uniform within the helix within a factor of two, after correction for different intrinsic exchange rates. The degree of protection within the helix is only 10 to 20-fold at this pH. At pH 5.1, 20 degrees C, the helix is more stable by two orders of magnitude and exchange occurs preferentially from the N-terminal end. At both pH values the NH proton of Asp 14, which is just outside the helix, is less protected by an order of magnitude than the adjacent NH protons inside the helix. Opening of the helix can be observed below pH 3.7 by changes in chemical shifts of the NH protons in the helix. At pH 2.4 the changes are 25% of those expected for complete opening. Helix opening is a fast reaction on the n.m.r. time scale (tau much less than 1 ms) unlike the generalized unfolding of RNAase S which is a slow reaction. Dissociation of S-peptide from S-protein in native RNAase S at pH 3.0 also is a slow reaction. Opening of the helix below pH 3.7 is a two-state reaction, as judged by comparing chemical shifts with exchange rates. The exchange rates at pH 3.1 are predicted correctly from the changes in chemical shift by assuming that helix opening is a two-state reaction. At pH values above 3.7, the nature of the helix opening reaction changes. These results indicate that at least one partially unfolded state of RNAase S is populated in the low pH unfolding transition.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

The Effect of Crystal Packing on Oligonucleotide Double Helix Structure

Abstract

Complexes formed between Actinomycin D (ActD) and the tetranucleotides d(AGCT)2 and d(CGCG)₂ were studied in detail by one and two-dimensional ¹H and ³¹P NMR. The ³¹P two dimensional chemical exchange experiment, at room temperature on saturated complexes (1:1), showed unambiguously that the asymmetrical phenoxazone ring binds to the unique GC site under the two possible orientations in the d(AGCT)₂ tetranucleotide but adopts a single orientation in the d(CGCG)₂ tetranucleotide. For the d(CGCG)₂: Act D saturated complex, complete assignments of all protons and phosphorus signals of the two-nucleotide strands, as well as of the two cyclic pentapeptide chains has allowed us to study in details the conformational features of the complex from NOE and coupling constants analysis. The tetranucleotide remains in a right-handed duplex, but the sugar puckers are modified for residues at the intercalation site. A uniform C_2′ endo pucker is observed for residues on the strand facing the quinoid side of the phenoxazone ring while a C_2′ endo-C_3′ endo equilibrium about 60% of C_2′ endo is proposed for the two residues on the strand facing the benzenoid side of the phenoxazone ring. In contrast to previous studies on ActD-DNA interactions, we have been able to measure the ³J phosphorus-proton coupling constants at the intercalation site but also adjacent to it, showing that ³¹P chemical shifts are not simply related to the backbone conformation. Molecular mechanics calculations, using empirical distances deduced from NOE effects as restrained distances during minimizations, led to a model differing mainly from those previously published by orientation of the N methyl groups of both N-Methyl-Valines.