Cloning and mapping of fourteen different DNA fragments containing Aspergillus nidulans 5S rRNA genes

Fourteen different plasmids hybridizing to Aspergillus nidulans 5S rRNA were isolated from a gene bank obtained after cloning Sau3A partial digests of A. nidulans DNA in a yeast--Escherichia coli vector, pBB29. The restriction maps of these plasmids were determined. The size of the cloned fragments was 2.7-9.5 kb, 12 of the plasmids were found to code for single 5S rRNA genes and 2 coded for 2 genes. No similarity of the sequences surrounding the 5S rRNA genes was found by restriction mapping.     

A minor class of 5S rRNA genes in Saccharomyces cerevisiae X2180-1B, one member of which lies adjacent to a Ty transposable element

In Saccharomyces cerevisiae the majority of the genes for 5S rRNA lie within a 9kb rDNA sequence that is present as 100-200 tandemly-repeated copies on Chromosome XII. Following our observations that about 10% of yeast 5S rRNA exists as minor variant sequences, we screened a collection of yeast DNA fragments cloned in lambda gt for 5S rRNA genes whose flanking sequences differed from those adjacent to 5S rRNA genes of the rDNA repeat. Three variant 5S rRNA genes were isolated on the basis of such dissimilarity to rDNA repeat sequences. They display a remarkable conservation of their DNA in the vicinity of the 5S coding region, and are examples of a minor form of 5S rRNA coding sequence present in a small number of copies in the yeast genome. These variant sequences appear to be transcribed as efficiently as 5S rRNA genes of the rDNA repeat. In one of our isolates of the variant sequence a Ty transposable element is inserted 145bp upstream of the initiation point for 5S rRNA synthesis.     

Genes for tRNAIle and tRNAAla in the spacer between the 16S and 23S rRNA genes of a blue-green alga: strong homology to chloroplast tRNA genes and tRNA genes of the E. coli rrnD gene cluster.

A 6.3 kbp Eco RI-Bam HI fragment which carries most of one of the two rRNA gene clusters of the blue-green alga Anacystis nidulans was cloned into plasmid pBR322. Sequence analysis of the spacer region between the 16S and 23S rRNA genes reveals the presence of genes for tRNAIle and tRNAAla. The 16S rRNA gene is separated from the tRNAIle gene by a 162 bp spacer which shows significant homology to the comparable region in Zea mays plastids. The spacer between the two tRNA genes is 33 bp long and can be folded into a 9 bp stem and loop structure. The 5' portion of the tRNAIle gene is 60% homologous to a "pseudogene"-like sequence which maps beyond the 5S rRNA gene.     

The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans

The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans, has been determined. Its coding region is estimated to be 1,487 base pairs long, which is nearly identical to those reported for chloroplast 16S rRNA genes and is about 4% shorter than that of the Escherichia coli gene. The 16S rRNA sequence of A. nidulans has 83% homology with that of tobacco chloroplast and 74% homology with that of E. coli. Possible stem and loop structures of A. nidulans 16S rRNA sequences resemble more closely those of chloroplast 16S rRNAs than those of E. coli 16S rRNA. These observations support the endosymbiotic theory of chloroplast origin.     

The intron of the mitochondrial 21S rRNA gene: distribution in different yeast species and sequence comparison between Kluyveromyces thermotolerans and Saccharomyces cerevisiae

We have screened numerous different yeast species for the presence of sequences homologous to the intron of the mitochondrial 21S rRNA gene of Saccharomyces cerevisiae (intron r1) and found them in all Kluyveromyces species, some of the Saccharomyces species and none of the other yeasts tested. We have determined the nucleotide sequence of the r1-intron in K. thermotolerans and compared it with that of S. cerevisiae. The two introns are inserted at the same position within the 21S rRNA gene. They contain homologous internal open reading frames (ORFs) initiated at the same AUG codon which can be aligned over their entire length. Several silent multi-substitutions indicate that these intronic ORFs represent selectively conserved functional genes. Other intron segments, on the contrary, reveal short blocks of extensive homology separated by non-homologous stretches and/or additions-deletions. Comparison of our two yeast r1-introns with equivalent introns of N. crassa and A. nidulans mitochondria reveals that introns with very similar RNA secondary structures can accommodate different types of ORFs.     

Precursor of 5S Ribosomal Ribonucleic Acid in the Blue-Green Alga Anacystis nidulans

The maturation of 5S ribosomal ribonucleic acid (rRNA) in the obligately photoautotrophic unicellular blue-green alga Anacystis nidulans has been studied by using polyacrylamide gel electrophoresis and T1 ribonuclease oligonucleotide analysis. A. nidulans mature 5S rRNA (m5) is of approximately the same molecular weight as the 5S rRNA of Escherichia coli, and is derived by cleavage of a precursor (p5) containing a few (three to six) additional nucleotides. Some of these additional nucleotides occur at the 5' end of the precursor molecule; others may occur at the 3' end. Kinetic experiments indicate that precursors of mature 5S rRNA larger than p5 either do not exist or are very transient in A. nidulans. These results are discussed in relation to those obtained with other prokaryotes.     

In silico reconstruction of nutrient-sensing signal transduction pathways in Aspergillus nidulans

We report here probable nutrient-sensing signal transduction pathways in Aspergillus nidulans, a model filamentous fungus, based on sequence homology studies with known Saccharomyces cerevisiae and Schizosaccharomyces pombe proteins. Specifically, we identified A. nidulans homologs for yeast proteins involved in (1) filamentation-invasion, (2) cAMP-PKA, (3) pheromone response, (4) cell integrity and (5) TOR signaling pathways. We have also studied autophagy, one of the most important cellular responses regulated by TOR signaling. The Basic Local Alignment Search Tool program "blastp" was used to assess the homology of proteins. We note that by using a highly conservative approach, 70% of the S. cerevisiae signal transduction proteins (107 proteins out of 153 proteins studied) have significant homologs in A. nidulans. Using a slightly less conservative approach, we are able to identify homologs for as high as 91% of the S. cerevisiae signal transduction proteins (139 proteins out of 153 proteins studied). The filamentation-invasion, cell integrity and TOR signaling pathways showed greatest similarity with S. cerevisiae, while the cAMP-PKA and pheromone response pathways showed greater similarity with S. pombe. Based on these results, probable pathways in A. nidulans were constructed using well-established S. cerevisiae and S. pombe models.     

Tandemly arranged variant 5S ribosomal RNA genes in the yeast Saccharomyces cerevisiae.

Most of the ribosomal RNA genes of the yeast Saccharomyces cerevisiae are about 9 kilobases (kb) in size and encode both the 35S rRNA (processed to produce the 25S, 18S, and 5.8S species) and 5S rRNA. These genes are arranged in a single tandem array of 100 repeats. Below, we present evidence that at the centromere-distal end of this array is a tandem arrangement of a different type of rRNA gene. Each of these repeats is 3.6 kb in length and encodes a single 5S rRNA. The coding sequence of this gene is different from that of the "normal" 5S gene in three positions located at the 3' end of the gene.     

A role for creD, a carbon catabolite repression gene from Aspergillus nidulans, in ubiquitination

In Aspergillus nidulans, it is known that creB encodes a deubiquitinating enzyme that forms a complex with the WD40 motif containing protein encoded by creC, that mutations in these genes lead to altered carbon source utilization and that the creD34 mutation suppresses the phenotypic effects of mutations in creC and creB. Therefore, creD was characterized in order to dissect the regulatory network that involves the CreB-CreC deubiquitination complex. CreD contains arrestin domains and PY motifs and is highly similar to the Rod1p and Rog3p proteins from Saccharomyces cerevisiae. An additional gene was identified in the A. nidulans genome that also encodes an arrestin and PY motif-containing protein, which we have designated apyA, and thus two similar proteins also exist in A. nidulans. In S. cerevisiae, Rod1p and Rog3p interact with the ubiquitin ligase Rsp5p, and so the A. nidulans homologue of Rsp5p was identified, and the gene encoding this HECT ubiquitin ligase was designated hulA. CreD and ApyA were tested for protein-protein interactions with HulA via the bacterial two-hybrid system, and ApyA showed strong interaction, and CreD showed weak interaction, with HulA in this system.     

Nucleotide sequences of the 5S ribosomal RNA genes and their adjacent regions in Schizosaccharomyces pombe.

The organization of 5S ribosomal RNA (rRNA) genes in the genome of Schizosaccharomyces pombe has been investigated by restriction and hybridization analyses. The 5S rRNA genes were not linked to the other three species of rRNA genes which formed a repeating unit of 6.9 megadaltons, but located in other regions surrounded by heterogeneous sequences. The 5S rRNA gene organization in S. pombe is therefore different from those in other yeasts; Saccharomyces cerevisiae and Torulopsis utilis. Four restriction segments of different sizes each containing a single 5S rRNA gene were cloned on a bacterial plasmid, and the sequences in and around the RNA coding regions were determined. In the RNA coding regions, the sequences in four clones were identical with an exception that one residue has been substituted in one clone. In the flanking regions, the sequences were extremely rich in the AT-content and highly heterogeneous. The sequences were also markedly different from those in the corresponding regions of the other two yeasts. THe presence of T-clusters in the regions immediately after the RNA coding sequences was only notable homology among the four clones and the other two yeasts.     

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.     

Mitochondrial L-rRNA from Aspergillus nidulans: potential secondary structure and evolution.

The alignment of gene sequences coding for A. nidulans mitochondrial L-rRNA and E. coli 23S rRNA indicates a strong conservation of primary and potential secondary structure of both rRNA molecules, except that homologies to the 5'-terminal 5.8S-like region and the 3'-terminal 4.5S-like region of bacterial rRNA are not detectable on mtDNA. The structural organization of the A. nidulans mt L-rRNA gene corresponds to that of yeast omega + strains: both genes are interrupted by a large intron sequence (1678 and 1143 bp, respectively) and by another smaller insert (91 and 66 bp) at homologous positions within domain V. An evolutionary tree derived from conserved L-rRNA gene sequences of yeast nuclei, E. coli, maize chloroplasts and six mitochondrial species exhibits a common root of organelle and bacterial sequences separating early from the nuclear branch.     

Isolation and nucleotide sequence of the ribosomal protein S16-encoding gene from Aspergillus nidulans.

A genomic clone has been isolated from Aspergillus nidulans which is homologous to the ribosomal (r) protein S16-encoding gene of Saccharomyces cerevisiae (S16A) and the r-protein S19-encoding gene of rat (S19). The amino acid (aa) sequences, deduced from nucleotide (nt) sequence analysis, show that in both cases more than 63% of the aa are conserved. The proposed A. nidulans r-protein S16 gene (rps16) differs from that of S. cerevisiae in that it occurs as a single copy in the haploid genome (rather than two copies as in yeast) and contains two putative introns (rather than one). The mRNA leader is long compared to many Aspergillus genes, commencing 293 nt upstream from the coding region, and contains an open reading frame of 13 codons.