首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 78 毫秒
1.
2.
The inhibitor peptide DT-2 (YGRKKRRQRRRPPLRKKKKKH) is the most potent and selective inhibitor of the cGMP-dependent protein kinase (PKG) known today. DT-2 is a construct of a PKG tight binding sequence (W45, LRKKKKKH, KI = 0.8 μm) and a membrane translocating sequence (DT-6, YGRKKRRQRRRPP, KI = 1.1 μm), that combined strongly inhibits PKG catalyzed phosphorylation (KI = 12.5 nm) with ∼1000-fold selectivity toward PKG over protein kinase A, the closest relative of PKG. However, the molecular mechanism behind this inhibition is not entirely understood. Using a combination of photoaffinity labeling, stable isotope labeling, and mass spectrometry, we have located the binding sites of PKG-specific substrate and inhibitor peptides. Covalent linkage of a PKG-specific substrate analogue was localized in the catalytic core on residues 356–372, also known as the glycine-rich loop, essential for ATP binding. By analogy, the individual inhibitor peptides W45 and DT-6 were also found to cross-link near the glycine-rich loop, suggesting these are both substrate competitive inhibitors. A bifunctional photoreactive analogue of DT-2 was found to generate dimers of PKG. This cross-linking induced covalent PKG dimerization was not observed for an N-terminal deletion mutant of PKG, which lacks the dimerization domain. In addition, non-covalent mass spectrometry was used to determine binding stoichiometry and binding order of the inhibitor peptides. Dimeric PKG binds two W45 and DT-6 peptides, whereas only one DT-2 molecule was observed to bind to the dimeric PKG. Taken together, these findings imply that (i) the two individual components making up DT-2 are both targeted against the substrate-binding site and (ii) binding of a single DT-2 molecule inactivates both PKG monomers simultaneously, which is an indication that (iii) in cGMP-activated PKG the catalytic centers of both subunits may be in each other''s proximity.Among the superfamily of protein kinases the two cyclic nucleotide-regulated protein kinases, cAMP-dependent protein kinase and cGMP-dependent protein kinase, form a closely related subfamily of serine/threonine protein kinases (14). Both proteins share several structural elements, such as the N-terminal dimerization domain, an autoinhibition site, two in-tandem cyclic nucleotide-binding sites, and a highly conserved catalytic core (Fig. 1, A and B). Despite these similarities, these two enzymes display differences, which account for their unique properties. Whereas PKA2 is nearly ubiquitous, PKG is primarily found in the lung, cerebellum, and smooth muscles (5, 6). From a structural point of view these cyclic nucleotide-dependent protein kinases differ as well. The holoenzyme of PKA is a tetramer composed of two regulatory and two catalytic subunits. The catalytic subunits are non-covalently attached to the regulatory subunit dimer. Upon interaction with cAMP, the catalytic subunits dissociate from the holoenzyme and are free to catalyze heterophosphorylation (Fig. 1C). The mammalian type I PKGs are homodimeric cytosolic proteins containing two identical polypeptides of ∼76 kDa. Alternative mRNA splicing produces type Iα and type Iβ PKG, which are identical proteins apart from their first ∼100 N-terminal residues (7). Each PKG subunit is composed of a regulatory and a catalytic domain on a single polypeptide chain. Consequently, when cGMP activates PKG, the catalytic and regulatory components remain physically attached (Fig. 1D). Within the catalytic domain PKA and PKG share a strong primary sequence homology (8). Not surprisingly, these enzymes also exhibit overlapping substrate specificities, a feature that often interferes with efforts to elucidate their distinct biological pathways. Peptide substrates with a primary amino acid sequence motif RRX(S/T)X are in general recognized by both PKA and PKG (9). Besides this strong overlapping substrate specificity, several studies report on subtle differences in determinants that discriminate for PKA and PKG substrate specificity (1016). To specifically discriminate between PKG and PKA activity in biological assays a highly specific PKG peptide inhibitor was developed (17). This peptide, YGRKKRRQRRRPPLRKKKKKH (DT-2), is the most potent and selective PKG inhibitor known today. Recently, the validity of DT-2 as a superior inhibitor of PKG in terms of potency, selectivity, and membrane permeability has been demonstrated (1824). The inhibitor is a construct of a substrate competitive sequence, LRKKKKKH (W45), derived from a library screen that selected for tight PKG binding sequences, with a significant specificity toward PKG over PKA, and a membrane translocating signal peptide, YGRKKRRQRRRPP (DT-6). DT-2 strongly inhibits PKG-catalyzed phosphorylation (Ki = 12.5 nm), however, the molecular nature of DT-2 inhibition is not entirely understood (25). Because high resolution structural data are not available for PKG, one of our goals is to elucidate binding sites for PKG-specific substrates and inhibitors in more detail using a combination of mass spectrometric techniques and photoaffinity labeling. To further delineate the nature of inhibition we have developed photoaffinity analogues of DT-2 and related inhibitory peptides, as well as a high affinity peptide substrate. The method of photoaffinity labeling enables the direct probing of target proteins through a covalent bond, which is photochemically introduced between a ligand and its specific receptor (26). In combination with modern mass spectrometric techniques this is a powerful approach for the characterization of peptide-protein interactions (27). Substrate and inhibitor peptides containing photoactivatable analogues of phenylalanine, 4-benzoyl-l-phenylalanine (Phe(Bz)) or 4′-(3-(trifluoromethyl)-3H-diazirin-3-yl)-l-phenylalanine (Phe(Tmd)) were synthesized and used to locate their substrate/inhibitor-binding sites on PKG. These measurements indicate that the substrate peptide resides near the glycine-rich loop within the catalytic domain and that the inhibitor peptides are directed similarly toward this substrate-binding site, thereby acting as competitive inhibitors. In addition, nanoflow electrospray ionization time of flight mass spectrometry (ESI-TOF-MS) was performed to study the interaction between DT-2 and PKG in more detail. ESI-MS has proven to be a useful tool to analyze the non-covalent interaction of proteins with ligands, oligonucleotides, peptides, or other proteins (2831). Using this technique, important information on conformational changes (3235), measurement of relative dissociation constants (36, 37), and sequential binding order and cooperativity (38, 39) can be obtained. ESI-MS confirms that PKG is primarily a homodimer and is able to bind four cGMP molecules. Binding of DT-2 was strongly enhanced in the presence of cGMP. Surprising is the observation that only one DT-2 molecule binds to dimeric PKG. The information derived from these measurements allows for molecular modeling and structural refinements of the next generation of PKG-selective inhibitors.Open in a separate windowFIGURE 1.Linear arrangement of the functional domains of the regulatory and catalytic subunit of PKA (A) and PKG (B) type I and schematic representation of the current working models of the activation process of PKA (C) and PKG (D) type 1. Binding of cAMP to the PKA induces a conformational change that results in the dissociation of the catalytic subunits. Binding of cGMP to PKG also induces a conformational change, which exposes the catalytic domains, but both catalytic domains remain near each other via the N-terminal dimerization domain. (Images adapted from Scholten et al. (4).)

TABLE 1

Inhibition contants (KI) of PKA- or PKG-specific peptide inhibitors and the PKA/PKG specificity index
PeptideSequencePKGKiPKAKiSpecificity index (PKA/PKG)Ref.
μmμm
PKI(5–24)TTYDFIASGRTGRRNAIHD-NH21500.0030.0002(11)
WW21TQAKRKKALAMA-NH27.5750100(11)
W45LRKKKKKH0.82 ± 0.33559680(17)
DT-6YGRGGRRQRRRPP1.1 ± 0.2226 ± 423.6(17)
DT-2YGRKKRRQRRRPPLRKKKKKH0.0125 ± 0.00316.5 ± 3.81320(17)
Open in a separate window  相似文献   

3.
4.
Forty-five different point mutations in POLG, the gene encoding the catalytic subunit of the human mitochondrial DNA polymerase (pol γ), cause the early onset mitochondrial DNA depletion disorder, Alpers syndrome. Sequence analysis of the C-terminal polymerase region of pol γ revealed a cluster of four Alpers mutations at highly conserved residues in the thumb subdomain (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) and two Alpers mutations at less conserved positions in the adjacent palm subdomain (Q879H, c.2637g→t and T885S, c.2653a→t). Biochemical characterization of purified, recombinant forms of pol γ revealed that Alpers mutations in the thumb subdomain reduced polymerase activity more than 99% relative to the wild-type enzyme, whereas the palm subdomain mutations retained 50–70% wild-type polymerase activity. All six mutant enzymes retained physical and functional interaction with the pol γ accessory subunit (p55), and none of the six mutants exhibited defects in misinsertion fidelity in vitro. However, differential DNA binding by these mutants suggests a possible orientation of the DNA with respect to the polymerase during catalysis. To our knowledge this study represents the first structure-function analysis of the thumb subdomain in pol γ and examines the consequences of mitochondrial disease mutations in this region.As the only DNA polymerase found in animal cell mitochondria, DNA polymerase γ (pol γ)3 bears sole responsibility for DNA synthesis in all replication and repair transactions involving mitochondrial DNA (1, 2). Mammalian cell pol γ is a heterotrimeric complex composed of one catalytic subunit of 140 kDa (p140) and two 55-kDa accessory subunits (p55) that form a dimer (3). The catalytic subunit contains an N-terminal exonuclease domain connected by a linker region to a C-terminal polymerase domain. Whereas the exonuclease domain contains essential motifs I, II, and III for its activity, the polymerase domain comprising the thumb, palm, and finger subdomains contains motifs A, B, and C that are crucial for polymerase activity. The catalytic subunit is a family A DNA polymerase that includes bacterial pol I and T7 DNA polymerase and possesses DNA polymerase, 3′ → 5′ exonuclease, and 5′-deoxyribose phosphate lyase activities (for review, see Refs. 1 and 2). The 55-kDa accessory subunit (p55) confers processive DNA synthesis and tight binding of the pol γ complex to DNA (4, 5).Depletion of mtDNA as well as the accumulation of deletions and point mutations in mtDNA have been observed in several mitochondrial disorders (for review, see Ref. 6). mtDNA depletion syndromes are caused by defects in nuclear genes responsible for replication and maintenance of the mitochondrial genome (7). Mutation of POLG, the gene encoding the catalytic subunit of pol γ, is frequently involved in disorders linked to mutagenesis of mtDNA (8, 9). Presently, more than 150 point mutations in POLG are linked with a wide variety of mitochondrial diseases, including the autosomal dominant (ad) and recessive forms of progressive external ophthalmoplegia (PEO), Alpers syndrome, parkinsonism, ataxia-neuropathy syndromes, and male infertility (tools.niehs.nih.gov/polg) (9).Alpers syndrome, a hepatocerebral mtDNA depletion disorder, and myocerebrohepatopathy are rare heritable autosomal recessive diseases primarily affecting young children (1012). These diseases generally manifest during the first few weeks to years of life, and symptoms gradually develop in a stepwise manner eventually leading to death. Alpers syndrome is characterized by refractory seizures, psychomotor regression, and hepatic failure (11, 12). Mutation of POLG was first linked to Alpers syndrome in 2004 (13), and to date 45 different point mutations in POLG (18 localized to the polymerase domain) are associated with Alpers syndrome (9, 14, 15). However, only two Alpers mutations (A467T and W748S, both in the linker region) have been biochemically characterized (16, 17).During the initial cloning and sequencing of the human, Drosophila, and chicken pol γ genes, we noted a highly conserved region N-terminal to motif A in the polymerase domain that was specific to pol γ (18). This region corresponds to part of the thumb subdomain that tracks DNA into the active site of both Escherichia coli pol I and T7 DNA polymerase (1921). A high concentration of disease mutations, many associated with Alpers syndrome, is found in the thumb subdomain.Here we investigated six mitochondrial disease mutations clustered in the N-terminal portion of the polymerase domain of the enzyme (Fig. 1A). Four mutations (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) reside in the thumb subdomain and two (Q879H, c.2637g→t and T885S, c.2653a→t) are located in the palm subdomain. These mutations are associated with Alpers, PEO, mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS), ataxia-neuropathy syndrome, Leigh syndrome, and myocerebrohepatopathy (
POLG mutationDiseaseGeneticsReference
G848SAlpers syndromeIn trans with A467T, Q497H, T251I-P587L, or W748S-E1143G in Alpers syndrome15, 35, 4350
Leigh syndromeIn trans with R232H in Leigh syndrome49
MELASIn trans with R627Q in MELAS38
PEO with ataxia-neuropathyIn trans with G746S and E1143G in PEO with ataxia50
PEOIn trans with T251I and P587L in PEO51, 52
T851AAlpers syndromeIn trans with R1047W48, 53
In trans with H277C
R852CAlpers syndromeIn trans with A467T14, 48, 50
In cis with G11D and in trans with W748S-E1143G or A467T
Ataxia-neuropathyIn trans with G11D-R627Q15
R853QMyocerebrohepatopathyIn trans with T251I-P587L15
Q879HAlpers syndrome with valproate-induced hepatic failureIn cis with E1143G and in trans with A467T-T885S35, 54
T885SAlpers syndrome with valproate-induced hepatic failureIn cis with A467T and in trans with Q879H-E1143G35, 54
Open in a separate windowOpen in a separate windowFIGURE 1.POLG mutations characterized in this study. A, the location of the six mutations characterized is shown in red in the primary sequence of pol γ. Four mutations, the G848S, T851A, R852C, and R853Q, are located in the thumb domain, whereas two mutations, the Q879H and T885S, are in the palm domain of the polymerase region. B, sequence alignment of pol γ from yeast to humans. The amino acids characterized in this study are shown in red. Yellow-highlighted amino acids are highly conserved, and blue-highlighted amino acids are moderately conserved.  相似文献   

5.
Chimeric Nitrogenase-like Enzymes of (Bacterio)chlorophyll Biosynthesis     
Denise W?tzlich  Markus J. Br?cker  Frank Uliczka  Markus Ribbe  Simone Virus  Dieter Jahn  Jürgen Moser 《The Journal of biological chemistry》2009,284(23):15530-15540
Nitrogenase-like light-independent protochlorophyllide oxidoreductase (DPOR) is involved in chlorophyll biosynthesis. Bacteriochlorophyll formation additionally requires the structurally related chlorophyllide oxidoreductase (COR). During catalysis, homodimeric subunit BchL2 or ChlL2 of DPOR transfers electrons to the corresponding heterotetrameric catalytic subunit, (BchNB)2 or (ChlNB)2. Analogously, subunit BchX2 of the COR enzymes delivers electrons to subunit (BchYZ)2. Various chimeric DPOR enzymes formed between recombinant subunits (BchNB)2 and BchL2 from Chlorobaculum tepidum or (ChlNB)2 and ChlL2 from Prochlorococcus marinus and Thermosynechococcus elongatus were found to be enzymatically active, indicating a conserved docking surface for the interaction of both DPOR protein subunits. Biotin label transfer experiments revealed the interaction of P. marinus ChlL2 with both subunits, ChlN and ChlB, of the (ChlNB)2 tetramer. Based on these findings and on structural information from the homologous nitrogenase system, a site-directed mutagenesis approach yielded 10 DPOR mutants for the characterization of amino acid residues involved in protein-protein interaction. Surface-exposed residues Tyr127 of subunit ChlL, Leu70 and Val107 of subunit ChlN, and Gly66 of subunit ChlB were found essential for P. marinus DPOR activity. Next, the BchL2 or ChlL2 part of DPOR was exchanged with electron-transferring BchX2 subunits of COR and NifH2 of nitrogenase. Active chimeric DPOR was generated via a combination of BchX2 from C. tepidum or Roseobacter denitrificans with (BchNB)2 from C. tepidum. No DPOR activity was observed for the chimeric enzyme consisting of NifH2 from Azotobacter vinelandii in combination with (BchNB)2 from C. tepidum or (ChlNB)2 from P. marinus and T. elongatus, respectively.Chlorophyll and bacteriochlorophyll biosynthesis, as well as nitrogen fixation, are essential biochemical processes developed early in the evolution of life (1). During biological fixation of nitrogen, nitrogenase catalyzes the reduction of atmospheric dinitrogen to ammonia (2). Enzyme systems homologous to nitrogenase play a crucial role in the formation of the chlorin and bacteriochlorin ring system of chlorophylls (Chl)2 and bacteriochlorophylls (Bchl) (3, 4) (Fig. 1a). For the synthesis of both Chl and Bchl, the stereospecific reduction of the C-17-C-18 double bond of ring D of protochlorophyllide (Pchlide) catalyzed by the nitrogenase-like enzyme light-independent (dark-operative) protochlorophyllide oxidoreductase (DPOR) results in the formation of chlorophyllide (Chlide) (Fig. 1a, left) (5, 6). DPOR enzymes consist of three protein subunits which are designated BchN, BchB and BchL in Bchl-synthesizing organisms and ChlN, ChlB and ChlL in Chl-synthesizing organisms. A second reduction step at ring B (C-7-C-8) unique to the synthesis of Bchl converts the chlorin Chlide into a bacteriochlorin ring structure to form bacteriochlorophyllide (Bchlide) (Fig. 1a, right, Bchlide). This reaction is catalyzed by another nitrogenase-like enzyme, termed chlorophyllide oxidoreductase (COR) (7). COR enzymes are composed of subunits BchY, BchZ, and BchX.Open in a separate windowFIGURE 1.Comparison of the three subunit enzymes DPOR, COR, and nitrogenase. a, during Chl and Bchl biosynthesis, ring D is stereospecifically reduced by the nitrogenase-like enzyme DPOR (subunit composition BchL2/(BchNB)2 or ChlL2/(ChlNB)2) leading to the chlorin Chlide. Subunits N, B, and L are named ChlN, ChlB, and ChlL in Chl-synthesizing organisms and BchN, BchB, and BchL in Bchl-synthesizing organisms. The synthesis of Bchl additionally requires the stereospecific B ring reduction by a second nitrogenase-like enzyme called COR, with the subunit composition BchX2/(BchYZ)2. COR catalyzes the formation of the bacteriochlorin Bchlide. Subunits Y, Z, and X of the COR enzyme are named BchY, BchZ, and BchX. b, the homologous nitrogenase complex has the subunit composition NifH2/(NifD/NifK)2. Rings A–E and the carbon atoms are designated according to IUPAC nomenclature (41). R is either a vinyl or an ethyl moiety. The position marked by an asterisk indicates either a vinyl or a hydroxyethyl moiety (42).All subunits share significant amino acid sequence homology to the corresponding subunits of nitrogenase, which are designated NifD, NifK, and NifH, respectively (1) (compare Fig. 1, a and b). Whereas subunits BchL or ChlL, BchX and NifH exhibit a sequence identity at the amino acid level of ∼33%, subunits BchN or ChlN, BchY, NifD, and BchB or ChlB, BchZ, and NifK, respectively, show lower sequence identities of ∼15% (1). For all enzymes a common oligomeric protein architecture has been proposed consisting of the heterotetrameric complexes (BchNB)2 or (ChlNB)2, (BchYZ)2, and (NifD/NifK)2, which are completed by a homodimeric protein subunit BchL2 or ChlL2, BchX2, and NifH2, respectively (compare Fig. 1, a and b) (3, 7, 8).Nitrogenase is a well characterized protein complex that catalyzes the reduction of nitrogen to ammonia in a reaction that requires at least 16 molecules of MgATP (2, 9, 10). During nitrogenase catalysis, subunit NifH2 (Fe protein) associates with and dissociates from the (NifD/NifK)2 complex (MoFe protein). Binding, hydrolysis of MgATP and structural rearrangements are coupled to sequential intersubunit electron transfer. For this purpose, NifH2 contains an ATP-binding motif and an intersubunit [4Fe-4S] cluster coordinated by two cysteine residues from each NifH monomer (1, 11). Electrons from this [4Fe-4S] cluster are transferred via a [8Fe-7S] cluster (P-cluster) onto the [1Mo-7Fe-9S-X-homocitrate] cluster (MoFe cofactor). Both of the latter clusters are located on (NifD/NifK)2, where dinitrogen is reduced to ammonia (10). Three-dimensional structures of NifH2 in complex with (NifD/NifK)2 revealed a detailed picture of the dynamic interaction of both subcomplexes (8, 12).Based on biochemical and bioinformatic approaches, it has been proposed that the initial steps of DPOR reaction strongly resemble nitrogenase catalysis. Key amino acid residues essential for DPOR function have been identified by mutagenesis of the enzyme from Chlorobaculum tepidum (formerly denoted as Chlorobium tepidum) (3). The catalytic mechanism of DPOR includes the electron transfer from a “plant-type” [2Fe-2S] ferredoxin onto the dimeric DPOR subunit, BchL2, carrying an intersubunit [4Fe-4S] redox center coordinated by Cys97 and Cys131 in C. tepidum. Analogous to nitrogenase, Lys10 in the phosphate-binding loop (P-loop) and Leu126 in the switch II region of DPOR were found essential for DPOR catalysis. Moreover, it was shown that the BchL2 protein from C. tepidum does not form a stable complex with the catalytic (BchNB)2 subcomplex. Therefore, a transient interaction responsible for the electron transfer onto protein subunit (BchNB)2 has been proposed (3).The subsequent [Fe-S] cluster-dependent catalysis and the specific substrate recognition at the active site located on subunit (BchNB)2 are unrelated to nitrogenase. The (BchNB)2 subcomplex was shown to carry a second [4Fe-4S] cluster, which was proposed to be ligated by Cys21, Cys46, and Cys103 of the BchN subunit and Cys94 of subunit BchB (C. tepidum numbering) (3). No evidence for any type of additional cofactor was obtained from biochemical and EPR spectroscopic analyses (5, 13). Thus, despite the same common oligomeric architecture, the catalytic subunits (BchNB)2 and (ChlNB)2 clearly differ from the corresponding nitrogenase complex, as no molybdenum-containing cofactor or P-cluster equivalent is employed (5, 14). From these results it was concluded that electrons from the [4Fe-4S] cluster of (BchNB)2 or (ChlNB)2 are transferred directly onto the Pchlide substrate at the active site of DPOR.The second nitrogenase-like enzyme, COR, catalyzes the reduction of ring B of Chlide during the biosynthesis of Bchl (7). Therefore, an accurate discrimination of the ring systems of the individual substrates is required. COR subunits share an overall amino acid sequence identity of 15–22% for BchY and BchZ and 31–35% for subunit BchX when compared with the corresponding DPOR subunits (supplemental Figures S2–S4). In amino acid sequence alignments of BchX proteins with the closely related BchL or ChlL subunits of DPOR, both cysteinyl ligands responsible for [4Fe-4S] cluster formation and residues for ATP binding are conserved (1). Furthermore, all cysteinyl residues characterized as ligands for a catalytic [4Fe-4S] cluster in (BchNB)2 or (ChlNB)2 are conserved in the sequences of subunits BchY and BchZ of COR (7). These findings correspond to a recent EPR study in which a characteristic signal for a [4Fe-4S] cluster was obtained for the COR subunit BchX2 as well as for subunit (BchYZ)2 (15). These results indicate that the catalytic mechanism of COR strongly resembles DPOR catalysis. In vitro assays for nitrogenase as well as for DPOR and COR make use of the artificial electron donor dithionite in the presence of high concentrations of ATP (7, 16, 17).

TABLE 1

Amino acid sequence identities of the individual subunits of DPOR, COR, and nitrogenaseAmino acid sequences of the individual subunits of DPOR, COR, and nitrogenase employed in the present study (compareFig. 3A) were aligned by using the ClustalW method in MegAlign (DNASTAR), and sequence identities were calculated.
DPOR
COR
Nitrogenase
NBLYZXNifDNifKNifH
DPOR
    N37–5815–1812–20
    B34–6215–2214–18
    L51–6931–3531–38

COR
    Y35–7813–15
    Z39–8111–16
    X42–8329–36

Nitrogenase
    NifD17–70
    NifK37–58
    NifH67–75
Open in a separate windowIn this study, we investigated the transient interaction of the dimeric subunit BchL2 or ChlL2 with the heterotetrameric (BchNB)2 or (ChlNB)2 complex, which is essential for DPOR catalysis. We make use of the individually purified DPOR subunits BchL2 and (BchNB)2 from the green sulfur bacterium C. tepidum and ChlL2 and (ChlNB)2 from the prochlorophyte Prochlorococcus marinus and from the cyanobacterium Thermosynechococcus elongatus. The individual combination of (BchNB)2 or (ChlNB)2 complexes and BchL2 or ChlL2 proteins from these organisms resulted in catalytically active chimeras of DPOR. These results enabled us to propose conserved regions of the postulated docking surface, which were subsequently verified in a mutagenesis study. To elucidate the potential evolution of the electron-transferring subunit of nitrogenase and nitrogenase-like enzymes, we also analyzed chimeric enzymes consisting of DPOR subunits (BchNB)2 or (ChlNB)2 in combination with subunits BchX2 from C. tepidum and R. denitrificans of the COR enzyme and with subunit NifH2 of nitrogenase from Azotobacter vinelandii, respectively.  相似文献   

6.
Peptidoglycan Fine Structure of the Radiotolerant Bacterium Deinococcus radiodurans Sark     
José Carlos Quintela  Francisco García-del Portillo  Ernst Pittenauer  Günter Allmaier  Miguel A. de Pedro 《Journal of bacteriology》1999,181(1):334-337
Peptidoglycan from Deinococcus radiodurans was analyzed by high-performance liquid chromatography and mass spectrometry. The monomeric subunit was: N-acetylglucosamine–N-acetylmuramic acid–l-Ala–d-Glu-(γ)–l-Orn-[(δ)Gly-Gly]–d-Ala–d-Ala. Cross-linkage was mediated by (Gly)2 bridges, and glycan strands were terminated in (1→6)anhydro-muramic acid residues. Structural relations with the phylogenetically close Thermus thermophilus are discussed.The gram-positive bacterium Deinococcus radiodurans is remarkable because of its extreme resistance to ionizing radiation (14). Phylogenetically the closest relatives of Deinococcus are the extreme thermophiles of the genus Thermus (4, 11). In 16S rRNA phylogenetic trees, the genera Thermus and Deinococcus group together as one of the older branches in bacterial evolution (11). Both microorganisms have complex cell envelopes with outer membranes, S-layers, and ornithine-Gly-containing mureins (7, 12, 19, 20, 22, 23). However, Deinococcus and Thermus differ in their response to the Gram reaction, having positive and negative reactions, respectively (4, 14). The murein structure for Thermus thermophilus HB8 has been recently elucidated (19). Here we report the murein structure of Deinococcus radiodurans with similar detail.D. radiodurans Sark (23) was used in the present study. Cultures were grown in Luria-Bertani medium (13) at 30°C with aeration. Murein was purified and subjected to amino acid and high-performance liquid chromatography (HPLC) analyses as previously described (6, 9, 10, 19). For further analysis muropeptides were purified, lyophilized, and desalted as reported elsewhere (6, 19). Purified muropeptides were subjected to plasma desorption linear time-of-flight mass spectrometry (PDMS) as described previously (1, 5, 16, 19). Positive and negative ion mass spectra were obtained on a short linear 252californium time-of-flight instrument (BioIon AB, Uppsala, Sweden). The acceleration voltage was between 17 and 19 kV, and spectra were accumulated for 1 to 10 million fission events. Calibration of the mass spectra was done in the positive ion mode with H+ and Na+ ions and in the negative ion mode with H and CN ions. Calculated m/z values are based on average masses.Amino acid analysis of muramidase (Cellosyl; Hoechst, Frankfurt am Main, Germany)-digested sacculi (50 μg) revealed Glu, Orn, Ala, and Gly as the only amino acids in the muramidase-solubilized material. Less than 3% of the total Orn remained in the muramidase-insoluble fraction, indicating an essentially complete solubilization of murein.Muramidase-digested murein samples (200 μg) were analyzed by HPLC as described in reference 19. The muropeptide pattern (Fig. (Fig.1)1) was relatively simple, with five dominating components (DR5 and DR10 to DR13 [Fig. 1]). The muropeptides resolved by HPLC were collected, desalted, and subjected to PDMS. The results are presented in Table Table11 compared with the m/z values calculated for best-matching muropeptides made up of N-acetylglucosamine (GlucNAc), N-acetylmuramic acid (MurNAc), and the amino acids detected in the murein. The more likely structures are shown in Fig. Fig.1.1. According to the m/z values, muropeptides DR1 to DR7 and DR9 were monomers; DR8, DR10, and DR11 were dimers; and DR12 and DR13 were trimers. The best-fitting structures for DR3 to DR8, DR11, and DR13 coincided with muropeptides previously characterized in T. thermophilus HB8 (19) and had identical retention times in comparative HPLC runs. The minor muropeptide DR7 (Fig. (Fig.1)1) was the only one detected with a d-Ala–d-Ala dipeptide and most likely represents the basic monomeric subunit. The composition of the major cross-linked species DR11 and DR13 confirmed that cross-linking is mediated by (Gly)2 bridges, as proposed previously (20). Open in a separate windowFIG. 1HPLC muropeptide elution patterns of murein purified from D. radiodurans. Muramidase-digested murein samples were subjected to HPLC analysis, and the A204 of the eluate was recorded. The most likely structures for each muroeptide as deduced by PDMS are shown. The position of residues in brackets is the most likely one as deduced from the structures of other muropeptides but could not be formally demonstrated. R = GlucNac–MurNac–l-Ala–d-Glu-(γ)→.

TABLE 1

Calculated and measured m/z values for the molecular ions of the major muropeptides from D. radiodurans
MuropeptideaIonm/z
ΔmbError (%)cMuropeptide composition
Muropeptide abundance (mol%)
CalculatedMeasuredNAGdNAMeGluOrnAlaGly
DR1[M+H]+699.69700.10.410.0611101012.0
DR2[M+H]+927.94928.30.360.041111125.7
DR3[M+Na]+1,006.971,007.50.530.051111133.0
DR4[M+Na]+963.95964.60.650.071111212.5
DR5[M+H]+999.02999.80.780.0811112227.7
[M−H]997.00997.30.300.03
DR6[M+Na]+1,078.51,078.80.750.071111232.4
DR7[M+H]+1,070.091,071.00.900.081111322.2
DR8[M+Na]+1,520.531,521.61.080.071122442.2
DR9[M+Na]+701.64702.10.460.0311f10105.0
DR10[M+H]+1,907.941,907.80.140.0122223410.1
[M−H]1,905.921,906.60.680.04
DR11[M+H]+1,979.011,979.10.090.0122224419.1
[M−H]1,977.001,977.30.300.02
DR12[M+H]+2,887.932,886.5−1.43−0.053333564.4
[M−H]2,885.912,885.8−0.11−0.01
DR13[M+H]+2,959.002,957.8−1.20−0.043333663.6
[M−H]2,956.992,955.9−1.09−0.04
Open in a separate windowaDR5 and DR10 to DR13 were analyzed in both the positive and negative ion modes. Muropeptides DR1 to DR4 and DR6 to DR9 were analyzed in the positive mode only due to the small amounts of sample available. bMass difference between measured and calculated quasimolecular ion values. c[(Measured mass−calculated mass)/calculated mass] × 100. dN-Acetylglucosamine. eN-Acetylmuramitol. f(1→6)Anhydro-N-acetylmuramic acid. Structural assignments of muropeptides DR1, DR2, DR8 to DR10, and DR12 deserve special comments. The low m/z value measured for DR1 (700.1) fitted very well with the value calculated for GlucNAc–MurNAc–l-Ala–d-Glu (699.69). Even smaller was the mass deduced for DR9 from the m/z value of the molecular ion of the sodium adduct (702.1) (Fig. (Fig.2).2). The mass difference between DR1 and DR9 (19.9 mass units) was very close indeed to the calculated difference between N-acetylmuramitol and the (1→6)anhydro form of MurNAc (20.04 mass units). Therefore, DR9 was identified as GlucNAc–(1→6)anhydro-MurNAc–l-Ala–d-Glu (Fig. (Fig.1).1). Muropeptides with (1→6)anhydro muramic acid have been identified in mureins from diverse origins (10, 15, 17, 19), indicating that it might be a common feature among peptidoglycan-containing microorganisms. Open in a separate windowFIG. 2Positive-ion linear PDMS of muropeptide DR9. Muropeptide DR9 was purified, desalted by HPLC, and subjected to PDMS to determine the molecular mass. The masses for the dominant molecular ions are indicated.The measured m/z value for the [M+Na]+ ion of DR8 was 1,521.6, very close to the mass calculated for a cross-linked dimer without one disaccharide moiety (1,520.53) (Fig. (Fig.1;1; Table Table1).1). Such muropeptides, also identified in T. thermophilus HB8 and other bacteria (18, 19), are most likely generated by the enzymatic clevage of MurNAc–l-Ala amide bonds in murein by an N-acetylmuramyl–l-alanine amidase (21). In particular, DR8 could derive from DR11. The difference between measured m/z values for DR8 and DR11 was 478.7, which fits with the mass contribution of a disaccharide moiety (480.5) within the mass accuracy of the instrument.The m/z values for muropeptides DR2, DR10, and DR12 supported the argument for structures in which the two d-Ala residues from the d-Ala–d-Ala C-terminal dipeptide were lost, leaving Orn as the C-terminal amino acid.The position of one Gly residue in muropeptides DR2, DR8, and DR10 to DR13 could not be formally demonstrated. One of the Gly residues could be at either the N- or the C-terminal positions. However, the N-terminal position seems more likely. The structure of the basic muropeptide (DR7), with a (Gly)2 acylating the δ-NH2 group of Orn, suggests that major muropeptides should present a (Gly)2 dipeptide. The scarcity of DR3 and DR6, which unambiguously have Gly as the C-terminal amino acid (Fig. (Fig.1),1), supports our assumption.Molar proportions for each muropeptide were calculated as proposed by Glauner et al. (10) and are shown in Table Table1.1. For calculations the structures of DR10 to DR13 were assumed to be those shown in Fig. Fig.1.1. The degree of cross-linkage calculated was 47.2%. Trimeric muropeptides were rather abundant (8 mol%) and made a substantial contribution to total cross-linkage. However, higher-order oligomers were not detected, in contrast with other gram-positive bacteria, such as Staphylococcus aureus, which is rich in such oligomers (8). The proportion of muropeptides with (1→6)anhydro-muramic acid (5 mol%) corresponded to a mean glycan strand length of 20 disaccharide units, which is in the range of values published for other bacteria (10, 17).The results of our study indicate that mureins from D. radiodurans and T. thermophilus HB8 (19) are certainly related in their basic structures but have distinct muropeptide compositions. In accordance with the phylogenetic proximity of Thermus and Deinococcus (11), both mureins are built up from the same basic monomeric subunit (DR7 in Fig. Fig.1),1), are cross-linked by (Gly)2 bridges, and have (1→6)anhydro-muramic acid at the termini of glycan strands. Most interestingly, Deinococcus and Thermus are the only microorganisms identified at present with the murein chemotype A3β as defined by Schleifer and Kandler (20). Nevertheless, the differences in muropeptide composition were substantial. Murein from D. radiodurans was poor in d-Ala–d-Ala- and d-Ala–Gly-terminated muropeptides (2.2 and 2.4 mol%, respectively) but abundant in Orn-terminated muropeptides (23.8 mol%) and in muropeptides with a peptide chain reduced to the dipeptide l-Ala–d-Glu (18 mol%). In contrast, neither Orn- nor Glu-terminated muropeptides have been detected in T. thermophilus HB8 murein, which is highly enriched in muropeptides with d-Ala–d-Ala and d-Ala–Gly (19). Furthermore, no traces of phenyl acetate-containing muropeptides, a landmark for T. thermophilus HB8 murein (19), were found in D. radiodurans. Cross-linkage was definitely higher in D. radiodurans than in T. thermophilus HB8 (47.4 and 27%, respectively), largely due to the higher proportion of trimers in the former.The similarity in murein basic structure suggests that the difference between D. radiodurans and T. thermophilus HB8 with respect to the Gram reaction may simply be a consequence of the difference in the thickness of cell walls (2, 3, 23). Interestingly, D. radiodurans murein turned out to be relatively simple for a gram-positive organism, possibly reflecting the primitive nature of this genus as deduced from phylogenetic trees (11). Our results illustrate the phylogenetic proximity between Deinococcus and Thermus at the cell wall level but also point out the structural divergences originated by the evolutionary history of each genus.  相似文献   

7.
Quantitative Proteomics by Metabolic Labeling of Model Organisms     
Joost W. Gouw  Jeroen Krijgsveld    Albert J. R. Heck 《Molecular & cellular proteomics : MCP》2010,9(1):11-24
In the biological sciences, model organisms have been used for many decades and have enabled the gathering of a large proportion of our present day knowledge of basic biological processes and their derailments in disease. Although in many of these studies using model organisms, the focus has primarily been on genetics and genomics approaches, it is important that methods become available to extend this to the relevant protein level. Mass spectrometry-based proteomics is increasingly becoming the standard to comprehensively analyze proteomes. An important transition has been made recently by moving from charting static proteomes to monitoring their dynamics by simultaneously quantifying multiple proteins obtained from differently treated samples. Especially the labeling with stable isotopes has proved an effective means to accurately determine differential expression levels of proteins. Among these, metabolic incorporation of stable isotopes in vivo in whole organisms is one of the favored strategies. In this perspective, we will focus on methodologies to stable isotope label a variety of model organisms in vivo, ranging from relatively simple organisms such as bacteria and yeast to Caenorhabditis elegans, Drosophila, and Arabidopsis up to mammals such as rats and mice. We also summarize how this has opened up ways to investigate biological processes at the protein level in health and disease, revealing conservation and variation across the evolutionary tree of life.Well before the genomics era, the foundation for our current understanding of genetics was largely established by biological research performed using model organisms. Early genetics discoveries such as the chromosome theory of heredity and bacterial conjugation were first described in the fruit fly Drosophila melanogaster (1) and the bacterium Escherichia coli (2), respectively. Apart from these organisms, most of the current knowledge of development, evolution, and genetics originates from other classical model organisms including the bakers'' yeast Saccharomyces cerevisiae, the nematode Caenorhabditis elegans, and the mouse Mus musculus. Nowadays, they hold a primary position in the analysis of biological, disease, and pharmaceutical processes in modern biology and probably claim an even more promising position in future biological research. With increasing numbers of completed genome annotations, however, the focus is also shifting somewhat from these classical model organisms toward organisms that have unique genetic properties, are economically interesting, or are more directly related to human disease such as puffer fish, rice, and Plasmodium, respectively. Consequently, the definition of a model organism has broadened over the past decade, and today model organisms are found in nearly all branches of the “tree of life,” providing extensive means to further investigate conservation or diversification of biological principles through evolution (3). This has gained momentum tremendously by the completion of genome sequencing efforts in hundreds of organisms. In relatively simple organisms (bacteria and yeast), this has allowed the systematic investigation of multiple basic biological processes conserved through evolution (e.g. apoptosis (4) and vacuolar transport (5)). Higher organisms are highly useful for the study of complex traits, which is facilitated by large collections of mutant strains (6, 7). This is of particular relevance where model systems of human physiology, either in a healthy or diseased state, are studied. Fruit flies and C. elegans, the “classical” model organisms, have been used as models for a variety of diseases (8) but also for natural processes like aging (9, 10), sleep (11, 12), and olfaction (13). Mouse and rat models have been a long-standing model for human biology (14), especially in cancer (15). Particularly the availability of strains engineered to represent human diseases has increased our understanding of pathological processes tremendously (16).So far, the focus has primarily been on genetic and genomic aspects of these processes and disorders, but with the maturation of proteomics techniques, ways to study these at the protein level in a meaningful way are coming within reach. Over the last decade, proteomics research has experienced significant advances and has evolved into an indispensable technology to investigate the proteomic composition of biological samples. Proteomics has shifted from the analysis of small sets of proteins toward the comprehensive investigation of a much larger number of proteins expressed in a cell, tissue, or organism (17). Nowadays, a typical proteomics experiment is peptide-centric and starts with the enzymatic digestion of a protein mixture followed by fractionation using one or more chromatographic steps to reduce sample complexity (18, 19) as illustrated in Fig.1. Peptides are fragmented in the mass spectrometer as they elute, and subsequent matching of fragmentation profiles against a protein database leads to peptide and protein identification. When performed at a large scale, this can be used for the identification of thousands of proteins in cells or subcellular structures (2023). Although such qualitative approaches are fruitful in providing information on proteins present in cells or tissues, they largely ignore the dynamics of protein expression when different conditions are to be investigated. This is highly relevant because in general only the proteins that differ between biological states (e.g. healthy/diseased) are likely to be of primary interest. Because mass spectrometry is not inherently quantitative, it is beneficial to add an internal standard as a reference for the peptide of interest. For large scale experiments, often all proteins or peptides in one sample are modified with a stable isotope-coded mass label. After mixing the labeled sample with an unmodified sample, the intensity ratio between the modified peptide and the unlabeled peptide accurately reflects the change in expression level.Open in a separate windowFig. 1.Qualitative proteomics work flow. Proteins are extracted, digested, and separated by strong cation exchange. Each strong cation exchange fraction is then analyzed by nano-LC-MS/MS. Peptide fragment spectra are used in a database search to identify the peptide sequence and the corresponding protein.Various approaches have been developed for the incorporation of stable isotopes into proteins that can be divided into in vivo and in vitro methods. In the former, isotope-enriched compounds (salts or amino acids) are added to the growth media that can be metabolized by the cell and incorporated into proteins. In vitro labeling can be established using chemical derivatization of proteins or peptides after protein extraction. The choice for either approach depends on the biological system under investigation, but there are a few considerations that should be taken into account because of their impact on the experimental work flow. In Labeling methodCostStrengthsWeaknessesMetabolic labeling (in vivo)    SILAC+Incorporation at the organism level (lowest variation). Available (free) quantitation software.Not applicable to human samples. Arginine-to-proline conversion. Expensive and slow. Enzymes other than trypsin and/or Lys-N may produce non-quantifiable peptides. Auxotroph for the labeled amino acid(s).    15N labeling+Incorporation at the organism level (lowest variation). All peptides can be used for quantitation regardless of the enzymeNot applicable to human samples. Expensive and slow. Available quantitation software. Unknown mass difference prior to identification.    13C labeling+Incorporation at the organism level (lowest variation). All peptides can be used for quantitation regardless of the enzyme.Not applicable to human samples. Expensive and slow. Available quantitation software. Unknown mass difference prior to identification. Isotope distribution might hamper identification.    SMIRP+/−Incorporation at the organism level (lowest variation). All peptides can be used for quantitation regardless of the enzyme.Not applicable to human samples. Slow. Available quantitation software.    Isotope-depleted labeling+Incorporation at the organism level (lowest variation). All peptides can be used for quantitation regardless of the enzyme.Not applicable to human samples. Expensive and slow. Available quantitation software. Identification requires ECD or ETD. Quantitation at the protein level.Chemical labeling (in vitro)    ICAT+/−Applicable to any sample. Fast.Incorporation at the protein level (moderate variation). Only Cys-containing peptides can be used for quantitation.    ICPL+/−Applicable to any sample. Fast.Incorporation at the protein level (moderate variation). Only Lys-containing peptides and the protein N terminus can be used for quantitation. Trypsin cleaves C-terminal to arginine residues only.    iTRAQ+/−Applicable to any sample. Fast. Simultaneous analysis of 8 labeled samples. No increase in complexity at the MS level.Incorporation at the peptide level (high variation). Quantitation is based on 1 or a few tandem mass spectra. Requires mass spectrometers that can analyze the low m/z region.    18O labeling−Applicable to any sample. Cheap and fast.Incorporation at the peptide level (high variation). Difficult to reach complete labeling. Available quantitation software.    Dimethyl labeling−Applicable to any sample. Cheap and fast. Automation is possible.Incorporation at the peptide level (high variation). Identification issues due to the number of variable modifications.Open in a separate windowOne major consideration for labeling in vivo (metabolic) or in vitro (chemical) critically depends on whether the biological sample in question can metabolically incorporate the isotope label. Metabolic labeling requires the addition of an isotopically enriched element (e.g. 13C, 15N, or 18O in salts or amino acids) to the growth media in a form that makes it available for incorporation into the entire organism, tissue, or cell. In contrast, chemical labeling occurs after protein extraction and therefore is completely independent of the source and preparation of the sample. This has the advantage that virtually any type of biological sample can be labeled, including human tissue or body fluids. Additionally, the time needed for this type of labeling is in general much shorter than when a label is incorporated metabolically where it may take weeks to in vivo label organisms or cells depending on the growth rate. This can even increase to a few months if a secondary labeling step is required such as is the case in the 15N labeling procedure of fruit flies and worms by feeding them on labeled yeast and E. coli, respectively.The great advantage of metabolic labeling becomes clear when the proteomics work flow is considered. Fig.2 gives an overview of the different positions in the experimental work flow where the internal standard can be introduced. Clearly, the best place to introduce an internal standard is by metabolically incorporating the stable isotope into living organisms or cells, thereby producing the lowest variation before any sample processing occurs (Fig. 2, left). When the internal standard is introduced further downstream in the work flow, higher levels of variation can be expected due to parallel sample processing as is the case with chemical derivatization of intact proteins (e.g. with ICAT and isotope-coded protein labeling (ICPL)1 (24, 25)) (Fig. 2, middle) or with chemical labeling of peptides such as isobaric tag for relative and absolute quantitation (iTRAQ) and stable isotope dimethyl labeling procedures (2628) or proteolytic digestion in 18O-labeled water (29, 30) (Fig. 2, right).Open in a separate windowFig. 2.Strategies for quantitative proteomics. Stable isotopes can be incorporated at different stages of the quantitative work flow and are indicated in black. The methods are metabolic labeling (left), protein labeling (middle), and peptide labeling (right). Relative expression levels are obtained by mass spectrometry where the signal of the unlabeled peptide is compared with that of the labeled peptide.  相似文献   

8.
Critical Factors Determining Dimerization of Human Antizyme Inhibitor     
Kuo-Liang Su  Ya-Fan Liao  Hui-Chih Hung    Guang-Yaw Liu 《The Journal of biological chemistry》2009,284(39):26768-26777
Ornithine decarboxylase (ODC) is the first enzyme involved in polyamine biosynthesis, and it catalyzes the decarboxylation of ornithine to putrescine. ODC is a dimeric enzyme, whereas antizyme inhibitor (AZI), a positive regulator of ODC that is homologous to ODC, exists predominantly as a monomer and lacks decarboxylase activity. The goal of this paper was to identify the essential amino acid residues that determine the dimerization of AZI. The nonconserved amino acid residues in the putative dimer interface of AZI (Ser-277, Ser-331, Glu-332, and Asp-389) were substituted with the corresponding residues in the putative dimer interface of ODC (Arg-277, Tyr-331, Asp-332, and Tyr-389, respectively). Analytical ultracentrifugation analysis was used to determine the size distribution of these AZI mutants. The size-distribution analysis data suggest that residue 331 may play a major role in the dimerization of AZI. Mutating Ser-331 to Tyr in AZI (AZI-S331Y) caused a shift from a monomer configuration to a dimer. Furthermore, in comparison with the single mutant AZI-S331Y, the AZI-S331Y/D389Y double mutant displayed a further reduction in the monomer-dimer Kd, suggesting that residue 389 is also crucial for AZI dimerization. Analysis of the triple mutant AZI-S331Y/D389Y/S277R showed that it formed a stable dimer (Kd value = 1.3 μm). Finally, a quadruple mutant, S331Y/D389Y/S277R/E332D, behaved as a dimer with a Kd value of ∼0.1 μm, which is very close to that of the human ODC enzyme. The quadruple mutant, although forming a dimer, could still be disrupted by antizyme (AZ), further forming a heterodimer, and it could rescue the AZ-inhibited ODC activity, suggesting that the AZ-binding ability of the AZI dimer was retained.Polyamines (putrescine, spermidine, and spermine) have been shown to have both structural and regulatory roles in protein and nucleic acid biosynthesis and function (13). Ornithine decarboxylase (ODC,3 EC 4.1.1.17) is a central regulator of cellular polyamine synthesis (reviewed in Refs. 1, 4, 5). This enzyme catalyzes the pyridoxal 5-phosphate (PLP)-dependent decarboxylation of ornithine to putrescine, and it is the first and rate-limiting enzyme in polyamine biosynthesis (2, 3, 6, 7). ODC and polyamines play important roles in a number of biological functions, including embryonic development, cell cycle, proliferation, differentiation, and apoptosis (815). They also have been associated with human diseases and a variety of cancers (1626). Because the regulation of ODC and polyamine content is critical to cell proliferation (11), as well as in the origin and progression of neoplastic diseases (23, 24), ODC has been identified as an oncogenic enzyme, and the inhibitors of ODC and the polyamine pathway are important targets for therapeutic intervention in many cancers (6, 11).ODC is ubiquitously found in organisms ranging from bacteria to humans. It contains 461 amino acid residues in each monomer and is a 106-kDa homodimer with molecular 2-fold symmetry (27, 28). Importantly, ODC activity requires the formation of a dimer (2931). X-ray structures of the ODC enzyme reveal that this dimer contains two active sites, both of which are formed at the interface between the N-terminal domain of one monomer, which provides residues involved in PLP interactions, and the C-terminal domain of the other subunit, which provides the residues that interact with substrate (27, 3241).ODC undergoes a unique ubiquitin-independent proteasomal degradation via a direct interaction with the regulatory protein antizyme (AZ). Binding of AZ promotes the dissociation of the ODC homodimers and targets ODC for degradation by the 26 S proteasome (4246). Current models of antizyme function indicate that increased polyamine levels promote the fidelity of the AZ mRNA translational frameshift, leading to increased concentrations of AZ (47). The AZ monomer selectively binds to dimeric ODC, thereby inactivating ODC by forming inactive AZ-ODC heterodimers (44, 4850). AZ acts as a regulator of polyamine metabolism that inhibits ODC activity and polyamine transport, thus restricting polyamine levels (4, 5, 51, 52). When antizymes are overexpressed, they inhibit ODC and promote ubiquitin-independent proteolytic degradation of ODC. Because elevated ODC activity is associated with most forms of human malignancies (1), it has been suggested that antizymes may function as tumor suppressors.In contrast to the extensive studies on the oncogene ODC, the endogenous antizyme inhibitor (AZI) is less well understood. AZI is homologous to the enzyme ODC. It is a 448-amino acid protein with a molecular mass of 50 kDa. However, despite the homology between these proteins, AZI does not possess any decarboxylase activity. It binds to antizyme more tightly than does ODC and releases ODC from the ODC-antizyme complex (53, 54). Both the AZI and AZ proteins display rapid ubiquitin-dependent turnover within a few minutes to 1 h in vivo (5). However, AZ binding actually stabilizes AZI by inhibiting its ubiquitination (55).AZI, which inactivates all members of the AZ family (53, 56), restores ODC activity (54), and prevents the proteolytic degradation of ODC, may play a role in tumor progression. It has been reported that down-regulation of AZI is associated with the inhibition of cell proliferation and reduced ODC activity, presumably through the modulation of AZ function (57). Moreover, overexpression of AZI has been shown to increase cell proliferation and promote cell transformation (5860). Furthermore, AZI is capable of direct interaction with cyclin D1, preventing its degradation, and this effect is at least partially independent of AZ function (60, 61). These results demonstrate a role for AZI in the positive regulation of cell proliferation and tumorigenesis.It is now known that ODC exists as a dimer and that AZI may exist as a monomer physiologically (62). Fig. 1 shows the dimeric structures of ODC (Fig. 1A) and AZI (Fig. 1B). Although structural studies indicate that both ODC and AZI crystallize as dimers, the dimeric AZI structure has fewer interactions at the dimer interface, a smaller buried surface area, and a lack of symmetry of the interactions between residues from the two monomers, suggesting that the AZI dimer may be nonphysiological (62). In this study, we identify the critical amino acid residues governing the difference in dimer formation between ODC and AZI. Our preliminary studies using analytical ultracentrifugation indicated that ODC exists as a dimer, whereas AZI exists in a concentration-dependent monomer-dimer equilibrium. Multiple sequence alignments of ODC and AZI from various species have shown that residues 277, 331, 332, and 389 are not conserved between ODC and AZI (Open in a separate windowFIGURE 1.Crystal structure and the amino acid residues at the dimer interface of human ornithine decarboxylase (hODC) and mouse antizyme inhibitor (mAZI). A, homodimeric structure of human ODC with the cofactor PLP analog, LLP (Protein Data Bank code 1D7K). B, putative dimeric structure of mouse AZI (Protein Data Bank code 3BTN). The amino acid residues in the dimer interface are shown as a ball-and-stick model. The putative AZ-binding site is colored in cyan. This figure was generated using PyMOL (DeLano Scientific LLC, San Carlos, CA).

TABLE 1

Amino acid residues at the dimer interface of human ODC and AZI
Human ODCResidueHuman AZI
Nonconserved
    Arg277Ser
    Tyr331Ser
    Asp332Glu
    Tyr389Asp

Conserved
    Asp134Asp
    Lys169Lys
    Lys294Lys
    Tyr323Tyr
    Asp364Asp
    Gly387Gly
    Phe397Phe
Open in a separate window  相似文献   

9.
Active Efflux of Organic Solvents by Pseudomonas putida S12 Is Induced by Solvents   总被引:2,自引:0,他引:2       下载免费PDF全文
Jasper Kieboom  Jonathan J. Dennis  Gerben J. Zylstra    Jan A. M. de Bont 《Journal of bacteriology》1998,180(24):6769-6772
  相似文献   

10.
Phanerochaete chrysosporium Cellobiohydrolase and Cellobiose Dehydrogenase Transcripts in Wood     
Marcelo A. Vallim  Bernard J. H. Janse  Jill Gaskell  Aline A. Pizzirani-Kleiner  Daniel Cullen 《Applied and environmental microbiology》1998,64(5):1924
  相似文献   

11.
Characterization of dacC, Which Encodes a New Low-Molecular-Weight Penicillin-Binding Protein in Bacillus subtilis          下载免费PDF全文
Lotte B. Pedersen  Thomas Murray  David L. Popham    Peter Setlow 《Journal of bacteriology》1998,180(18):4967-4973
  相似文献   

12.
A Region in Bacillus subtilis ςH Required for Spo0A-Dependent Promoter Activity          下载免费PDF全文
Cindy M. Buckner  Charles P. Moran  Jr. 《Journal of bacteriology》1998,180(18):4987-4990
  相似文献   

13.
Intramolecular Regulation of MyoD Activation Domain Conformation and Function   总被引:3,自引:2,他引:1       下载免费PDF全文
Jing Huang  Hal Weintraub    Larry Kedes 《Molecular and cellular biology》1998,18(9):5478-5484
  相似文献   

14.
Identical 371-Base-Pair Deletion Mutations in the LAT Genes of Herpes Simplex Virus Type 1 McKrae and 17syn+ Result in Different In Vivo Reactivation Phenotypes          下载免费PDF全文
Jeannette M. Loutsch  Guey-Chuen Perng  James M. Hill  Xiaodong Zheng  Mary E. Marquart  Timothy M. Block  Homayon Ghiasi  Anthony B. Nesburn    Steven L. Wechsler 《Journal of virology》1999,73(1):767-771
  相似文献   

15.
The Atrazine Catabolism Genes atzABC Are Widespread and Highly Conserved     
Mervyn L. de Souza  Jennifer Seffernick  Betsy Martinez  Michael J. Sadowsky  Lawrence P. Wackett 《Journal of bacteriology》1998,180(7):1951-1954
Pseudomonas strain ADP metabolizes the herbicide atrazine via three enzymatic steps, encoded by the genes atzABC, to yield cyanuric acid, a nitrogen source for many bacteria. Here, we show that five geographically distinct atrazine-degrading bacteria contain genes homologous to atzA, -B, and -C. The sequence identities of the atz genes from different atrazine-degrading bacteria were greater than 99% in all pairwise comparisons. This differs from bacterial genes involved in the catabolism of other chlorinated compounds, for which the average sequence identity in pairwise comparisons of the known members of a class ranged from 25 to 56%. Our results indicate that globally distributed atrazine-catabolic genes are highly conserved in diverse genera of bacteria.Atrazine [2-chloro-4-(ethylamino)-6-(isopropylamino)- 1,3,5-triazine] is a herbicide used for controlling broad-leaf and grassy weeds and is relatively persistent in soils (51). Atrazine and other s-triazine compounds have been detected in ground and surface waters at levels exceeding the Environmental Protection Agency’s maximum contaminant level of 3 ppb (30).Microbial populations exposed to synthetic chlorinated compounds, such as atrazine, often respond by producing enzymes that degrade these molecules. Most of our current understanding of the genes and enzymes involved in atrazine degradation derives from studies using Pseudomonas strain ADP, in which the first three enzymatic steps in atrazine degradation have been defined (6, 14, 15, 48). The genes atz A, -B, and -C, which encode these enzymes, have been cloned and sequenced. Atrazine chlorohydrolase (AtzA), hydroxyatrazine ethylaminohydrolase (AtzB), and N-isopropylammelide isopropylaminohydrolase (AtzC) sequentially convert atrazine to cyanuric acid (6, 14, 15, 48) (Fig. (Fig.1).1). Cyanuric acid and related compounds are catabolized by many soil bacteria (10, 11, 17, 24, 26, 61), and by Pseudomonas sp. ADP, to carbon dioxide and ammonia (35). This provides the evolutionary pressure for the atzA, -B, and -C genes to permit bacterial growth on the more than one billion pounds of atrazine that have been applied to soils globally (20). Here we used a knowledge of the atzA, -B, and -C gene sequences to investigate the presence of homologous genes in other atrazine-degrading bacteria. In this study, we report that five atrazine-degrading microorganisms, which were recently isolated from geographically separated sites exposed to atrazine, contained nearly identical atzA, -B, and -C genes. Open in a separate windowFIG. 1Pathway for atrazine catabolism to cyanuric acid in Pseudomonas sp. strain ADP.

Atrazine-catabolizing bacteria used in this study.

Until recently, attempts at isolating bacteria (18) or fungi (27) that completely degrade atrazine to carbon dioxide, ammonia, and chloride were unsuccessful. While several microorganisms were shown to dealkylate atrazine, they were unable to displace the chlorine atom (41, 54). Since 1994, several research groups have independently isolated atrazine-degrading bacteria that displaced the chlorine atom and mineralized atrazine (3, 7, 13, 35, 39, 46). Six of these bacterial cultures, listed in Table Table1,1, were studied here, and the Clavibacter strain had been investigated previously (13).

TABLE 1

Recently isolated atrazine-catabolizing bacteria
GenusStrainLocation where isolatedYr reported (reference)
PseudomonasaADPAgricultural-chemical dealership site, Little Falls, Minn.1995 (35)
RalstoniaaM91-3Agricultural soil, Ohio1995 (46, 55)
Mixed cultureBasel, Switzerland1995 (57)
ClavibacterAgricultural soil, Riverside, Calif.1996 (13)
AgrobacteriumJ14aAgricultural soil, Nebraska1996 (39)
NDb38/38Atrazine-contaminated soil, Indiana1996 (3)
AlcaligenesaSG1Industrial settling pond, San Gabriel, La.1997 (7)
Open in a separate windowaIsolate identity based on 16S rRNA sequence analysis. bND, not determined. 

Detection of atzA, -B, and -C homologs in atrazine-degrading microorganisms by PCR analysis.

Recently isolated atrazine-degrading bacteria were screened for the presence of DNA homologous to the Pseudomonas strain ADP atzABC genes, which encode enzymes transforming atrazine to cyanuric acid (Fig. (Fig.1).1). Total genomic DNA was isolated from each of these bacteria as described elsewhere (49), and the PCR technique was used to amplify sequences internal to the atzA, -B, and -C genes as described elsewhere (13). Custom primers were designed specifically for atzA (5′CCATGTGAACCAGATCCT3′ and 5′TGAAGCGTCCACATTACC3′), atzB (5′TCACCGGGGATGTCGCGGGC3′ and 5′CTCTCCCGCATGGCATCGGG3′), and atzC (5′GCTCACATGCAGGTACTCCA3′ and 5′GTACCATATCACCGTTTGCCA3′) by using the Primer Designer package, version 2.01 (Scientific and Educational Software, State Line, Pa.), and were synthesized by Gibco BRL (Gaithersburg, Md.). PCR fragments were amplified by using Taq DNA polymerase (Gibco BRL) (22) and were separated from primers on a 1.0% agarose gel. The results of these studies (Fig. (Fig.2)2) indicated that PCR amplification consistently produced DNA fragments of 0.5 kb for all organisms when the atzA or -B primers were used and fragments of 0.6 kb when the atzC primers were used. Open in a separate windowFIG. 2PCR analysis with primers designed to amplify internal regions of atzA (lanes 1 to 5), atzB (lanes 6 to 10), and atzC (lanes 11 to 15). The atrazine-degrading bacteria analyzed were Pseudomonas strain ADP (35) (lanes 1, 6, and 11), Alcaligenes strain SGI (7) (lanes 2, 7, and 12), Ralstonia strain M91-3 (46) (lanes 3, 8, and 13), Agrobacterium strain J14a (39) (lanes 4, 9, and 14), and isolate 38/38 (3) (lanes 5, 10, and 15). Values to the right of the gel are sizes (in kilobase pairs).Southern hybridization analyses were performed on the PCR-amplified DNA as described elsewhere (49) to confirm the presence of homologous DNA. We used a 0.6-kb ApaI/PstI fragment from pMD4 (15), a 1.5-kb BglII fragment from pATZB-2 (6), and a 2.0-kb EcoRI/AvaI fragment from pTD2.5 (48) as probes for atzA, -B, and -C genes, respectively. DNA probes were labeled with [α-32P]dCTP by using the Rediprime Random Primer Labeling Kit (Amersham Life Science, Arlington Heights, Ill.) according to the manufacturer’s instructions. Southern hybridization analyses, performed under stringent conditions, confirmed that each strain contained DNA homologous to atzA, -B, and -C (data not shown). With strain M91-3 and isolate 38/38, however, in addition to the expected 0.5-kb atzB PCR product (Fig. (Fig.2,2, lanes 8 and 10), a 1.2-kb fragment was also obtained. However, no hybridization to this fragment was seen with the atzB probe. Similar investigations showed that a mixed culture obtained from Switzerland (Table (Table1),1), capable of degrading atrazine, also contained DNA homologous to all three atz genes (12).As a negative control, bacteria known not to degrade atrazine were analyzed. PCR analyses were carried out with genomic DNA from the following randomly chosen laboratory strains: Rhodococcus chlorophenolicus (1), Flavobacterium sp. (47), Streptomyces coelicolor M145 (21), Amycolatopsis mediterranei (19), Agrobacterium strain A136 and strain A348 (A136/pTiA6NC) (60), Arthrobacter globiformis MN1 (45), Bradyrhizobium japonicum (33), Rhizobium sp. strain NGR 234 (44), Pseudomonas NRRLB12228, and Klebsiella pneumoniae 99 (16). None of these strains contained DNA that was amplified by PCR using the primers designed to identify the atzA, -B, or -C gene (data not shown).

DNA sequences of atzA, -B, and -C homologs in atrazine-degrading microorganisms.

DNAs amplified from the five strains in Table Table11 with the atzA, -B, and -C primers were purified from gel slices by using the GeneClean II System (Bio 101, Inc., Vista, Calif.) and sequenced with a PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing kit (Perkin-Elmer Corp., Norwalk, Conn.) and an ABI model 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). The GCG sequence analysis software package (Genetics Computer Group, Inc., Madison, Wis.) was used for all DNA and protein sequence comparisons and alignments. Table Table22 summarizes these data. The PCR-amplified genes were ≥99% identical to the Pseudomonas strain ADP atzA, -B, and -C genes in all pairwise comparisons of DNA sequences. This remarkable sequence identity suggested that each atz gene in the different genera was derived from a common ancestor and that they have diverged evolutionarily only to a limited extent.

TABLE 2

Sequence identities of atzABC homologs from different atrazine-degrading bacteria
Strain% DNA sequence identitya
atzAatzBatzC
Pseudomonas ADP100100100
Alcaligenes SG199.2100100
Ralstonia M91-399.0100100
Agrobacterium J14a99.1100100
Isolate 38/3899.310099.8
Open in a separate windowaDNA sequences obtained from each strain by using the ataA, -B, and -C primers were compared with the atzABC gene sequences from Pseudomonas strain ADP. A review of the literature on other bacterial catabolic pathways indicated a much greater degree of divergence when genes encoding enzymes for the catabolism of other commercially relevant chlorinated compounds were compared (Table (Table3).3). As with atrazine, multiple bacterial strains that catabolize 1,2-dichloroethane, chloroacetic acid, 2,4-dichlorophenoxyacetate, dichloromethane, and 4-chlorobenzoate have been isolated. A comparison of the gene sequences encoding the initiating reactions in the catabolism of each of those compounds revealed that sequence divergence was comparatively high. In pairwise comparisons within each gene class, the average sequence identities ranged from 25 to 56% (divergence was 46 to 75%). With the atzABC genes, by contrast, there is at most a 1% sequence difference within the sequenced gene region (Table (Table2).2). Moreover, the atzB sequences were completely identical, and the atzC genes diverged by only 1 bp in one of the five strains tested. This suggests that the atz genes recently arose from a single origin and have become distributed globally. Similarly, identical parathion hydrolase genes were isolated from two bacteria representing different genera and global locations (40, 52, 53).

TABLE 3

Sequence comparisons of isofunctional bacterial enzymes that catabolize chlorinated compounds
GeneEnzymeAverage % protein sequence identitya (no. of pairwise comparisons)References
dhlA, dhaAHaloalkane dehalogenase25.0 (1)23, 31
dehC, hadL, dehH, dehH1, dehH2, dhlB, dehCI, dehCII2-Haloacid dehalogenase36.6 ± 3.9 (36)5, 25, 28, 29, 42, 43, 50, 59
tfdA2,4-Dichlorophenoxyacetate monooxygenase43.2 ± 4.6 (21)b34, 37, 38, 56, 58
dcmADichloromethane dehalogenase56.0 (1)4, 32
atzAAtrazine chlorohydrolase98.6 ± 0.12 (15)cThis study
atzBHydroxyatrazine ethylaminohydrolase100 (10)cThis study
atzCN-Isopropylammelide isopropylaminohydrolase99.0 ± 0.43 (10)cThis study
Open in a separate windowaAll possible pairwise alignments of translated gene sequences were made. The average percent identity is the mean of the percent identity values for all pairwise alignments ± standard error of the mean. bIncludes full protein sequences as well as partial protein sequences of ≥100 amino acids. cSequence identity within a 0.5-kb PCR product for atzA and -B and within a 0.6-kb PCR product for atzC. Six sequences were analyzed for atzA, and five were analyzed for atzB and -C. The data presented here provide further support for previous studies suggesting that hydroxyatrazine in the environment derives from biological processes (36), and not solely from abiotic reactions (2, 9). The present data, and a recent report by Bouquard et al. (8), indicate that the gene encoding atrazine chlorohydrolase is widespread in the United States and Europe.Our observations argue for a single, recent evolutionary origin of the atz genes and their subsequent global distribution. We have recently localized the atzA, -B, and -C genes to a large, self-transmissible plasmid in Pseudomonas strain ADP (12), and possible mechanisms of transfer of the atzABC genes are currently under investigation.  相似文献   

16.
Old knowledge and new technologies allow rapid development of model organisms     
Charles E. Cook  Janet Chenevert  Tomas A. Larsson  Detlev Arendt  Evelyn Houliston  Péter Lénárt 《Molecular biology of the cell》2016,27(6):882-887
  相似文献   

17.
Effect of Oxygen on Translation and Posttranslational Steps in Expression of Photosynthesis Genes in Rhodobacter capsulatus   总被引:2,自引:0,他引:2       下载免费PDF全文
Markus Hebermehl  Gabriele Klug 《Journal of bacteriology》1998,180(15):3983-3987
  相似文献   

18.
The Flagellar Switch Genes fliM and fliN of Rhodobacter sphaeroides Are Contained in a Large Flagellar Gene Cluster          下载免费PDF全文
Norma García  Andrs Campos  Aurora Osorio  Sebastian Poggio  Bertha Gonzlez-Pedrajo  Laura Camarena    Georges Dreyfus 《Journal of bacteriology》1998,180(15):3978-3982
  相似文献   

19.
A Review of Principal Studies on the Development and Treatment of Epithelial Ovarian Cancer in the Laying Hen Gallus gallus     
Purab Pal  Kara Nicole Starkweather  Karen Held Hales  Dale Buchanan Hales 《Comparative medicine》2021,71(4):271
Often referred to as the silent killer, ovarian cancer is the most lethal gynecologic malignancy. This disease rarely shows any physical symptoms until late stages and no known biomarkers are available for early detection. Because ovarian cancer is rarely detected early, the physiology behind the initiation, progression, treatment, and prevention of this disease remains largely unclear. Over the past 2 decades, the laying hen has emerged as a model that naturally develops epithelial ovarian cancer that is both pathologically and histologically similar to that of the human form of the disease. Different molecular signatures found in human ovarian cancer have also been identified in chicken ovarian cancer including increased CA125 and elevated E-cadherin expression, among others. Chemoprevention studies conducted in this model have shown that decreased ovulation and inflammation are associated with decreased incidence of ovarian cancer development. The purpose of this article is to review the major studies performed in laying hen model of ovarian cancer and discuss how these studies shape our current understanding of the pathophysiology, prevention and treatment of epithelial ovarian cancer.

Ovarian cancer is the leading cause of death among female gynecologic malignancies, with a 47% 5 y relative survival rate.154 Early detection of the disease is necessary for decreasing the high mortality rate. However, early detection is difficult due to the lack of known specific biomarkers and clinically detectable symptoms until the tumor reaches at an advanced stage. The disease has multiple subtypes. Epithelial ovarian cancer (EOC) is the most common type of ovarian cancer, accounting for about 90% of all reported cases.127,164 EOC is commonly subdivided into 5 histotypes: high-grade serous (HGSOC), low-grade serous, mucinous, endometroid (EC), and clear cell. The histotypes differ in terms of tumor cell morphology, severity, systemic effect, and response to treatment. Among the different subtypes, HGSOC accounts for about 70% of cases of EOC observed in women. HGSOC has a higher mitotic index and is a more aggressive form of cancer with a worse prognosis. HGSOC and low-grade serous histotypes exhibit distinctly different presentations of the disease82,166 and demand different treatment modalities. EC (10% to 20%), mucinous (5% to 20%), and clear cell (3% to 10%) histotypes are less common forms of the disease. The subtypes of EOC also differ in terms of 5 y survival rates of patients; that is, HGSOC (20% to 35%), EC (40% to 63%), mucinous (40% to 69%), and clear cell (35% to 50%).20,76,148Developing a representative animal model for EOC has been challenging due to the histologic and pathologic differences among different subtypes of EOC. While developing a reliable animal model is challenging due to the vast complexity and limited understanding of the origin of the disease, laying hens naturally develop EOC that is histopathologically very similar to the human form of the disease (Figure 1).15 All the different human ovarian cancer histotypes have been observed in laying hen ovarian cancer (Figure 2). In addition, the presentation of the disease in chickens is remarkably similar to the human form of the disease, with early-stage ovarian cancer in laying hens having similar precursor lesions as occur in women.15 The laying hen develops ovarian cancer spontaneously, allowing analysis of early events and investigation into the natural course of the disease, as tumors can be examined as they progress from normal to late-stage ovarian carcinoma. The gross appearance of these stages is shown in Figure 3.Open in a separate windowFigure 1.Gross pathologic presentation of chicken compared with human ovarian cancer. The remarkably similar presentation in hens (A,B) and women (C,D) at the gross anatomic level with profuse abdominal ascites and peritoneal dissemination of metastasis. A) Ascites in abdominal cavity chicken with advanced ovarian cancer (photo credit: DB Hales); (B) Chicken ovarian cancer with extensive peritoneal dissemination of metastasis (photo credit: DB Hales); (C) Distended abdomen from ascites fluid accumulation in woman with ovarian cancer (http://www.pathguy.com/bryanlee/ovca.html) (D) Human ovarian cancer with extensive peritoneal dissemination of metastasis (http://www.pathguy.com/bryanlee/ovca.html).Open in a separate windowFigure 2.Gross anatomic appearance of different stages of ovarian cancer in the chicken The progression from the normal hen ovary to late-stage metastatic ovarian cancer. (A) Normal chicken ovary showing hierarchal clutch of developing follicles and postovulatory follicle; (B) Stage 1 ovarian cancer, confined to ovary with vascularized follicles; (C) Stage 2/3 ovarian cancer, metastasis locally to peritoneal cavity with ascites; (D) Stage 4 ovarian cancer, late stage with metastasis to lung and liver with extensive ascites (photo credits: DB Hales).Open in a separate windowFigure 3.Histologic subtypes in chicken compared with human ovarian cancers. H and E staining of formalin fixed paraffin embedded tissues from hens with ovarian cancer (A through D) and women (E through G). (A) Chicken clear cell carcinoma; (B) Chicken endometrioid carcinoma; (C) Chicken mucinous adenocarcinoma; (D) Chicken serous papillary adenocarcinoma (photo credits: DB Hales). (E) Human clear cell carcinoma; (F) Human endometrioid carcinoma; (G) Human mucinous cystadenocarcinoma; (H) Human serous adenocarcinoma (https://www.womenshealthsection.com).Over the past 2 decades, the laying hen has emerged as a valuable experimental model for EOC, in addition to other in vivo models such as Patient-Derived Xenografts (PDX) and Genetically Engineered Mouse Models (GEMMs). Comparison of the hen model with other animal models has been reviewed elsewhere.72 Modern-day laying hens, such as the white leghorn, have been selected from their ancestor red jungle fowl57 for decreased broodiness and persistent ovulation, resulting in approximately one egg per day, if proper nutrition and light-dark cycles are maintained. Daily rupture and consequent repair of the ovarian surface epithelia (OSE) due to the persistent ovulation promotes potential error during rapid DNA replication. This increases the probability of oncogenic mutations, ultimately leading to neoplasia.137 Inflammation resulting from continuous ovulation also promotes the natural development of EOC.81 By the age of 2.5 to 3 y, laying hens have undergone a similar number of ovulations as a perimenopausal woman. The risk of ovarian cancer in white leghorn hens in this time (4%) is similar to the lifetime risk of ovarian cancer in women (0.35% to 8.8%).125 By the age of 4 to 6 y, the risk of ovarian cancer in hens rises to 30% to 60%.54 The incidence of ovarian carcinoma in the hens, however, depends on the age, genetic strain,80 and the egg-laying frequency of the specific breed.54 The common white leghorn hen has routinely been employed in chicken ovarian cancer studies. On average, hens are exposed to 17 h of light per day, with lights turned on at 0500 h and turned off at 2200 h. The laying hen model of EOC does present some considerable challenges. Despite its great utility for research, the model is still used mainly by agricultural poultry scientists and a small number of ovarian cancer researchers.Comprehensive and proper vivarium support is required to conduct large-scale cancer prevention studies. Only a few facilities are available for biomedical chicken research, including University of Illinois Urbana-Champaign, Cornell University, Penn State University, NC State, Auburn University, and MS State University. Another difficulty is a lack of available antibodies specific for chicken antigens. Because of the structural dissimilarities between most human proteins and murine antigens to their chicken counterparts, cross-reactivity of available antibodies is also limited. The entire chicken genome was sequenced in 2004;78 however, the chromosomal locus of many key genes, such as p53, are still unknown. Overall, humans and chickens share about 60% of genetic commonality, whereas humans and rats share about 88% of their genes. Specific pathway-mutated strains of chickens are not yet available, limiting the ability to study key pathways in carcinogenesis and prevention of cancer using this model. Although all 5 different subtypes of ovarian cancer are present in hens, their most predominant subtype is different from women. Close to 70% of women diagnosed with ovarian cancer have serous EOC, while the predominant subtype reported in hens is endometrioid.15 However, these comparisons are complicated because observations of cancer in hens consist of both early and late stages of the disease, wherein women, most of the data is from late stage and aggressive ovarian carcinoma.The spontaneous onset of ovarian cancer and the histologic and pathologic similarities to the human form of the disease make laying hens an excellent model for continued research on EOC. To date, a large number of studies have been performed on laying hens. Here we have divided the current studies into 2 groups— (A) studies that have described the molecular presentation of EOC to be similar to that in women; (AuthorYearSignificanceKey molecular targetsCitationHaritani and colleagues.1984Investigating ovarian tumors for key gene signaturesOvalbumin 71 Rodriguez-Burford and colleagues.2001Investigating expressions of clinically important prognostic markers in cancerous hensCA125, cytokeratin AE1/AE3, pan cytokeratin, Lewis Y, CEA, Tag 72, PCNA, EGFR, erbB-2, p27, TGF{α}, Ki-67, MUC1, and MUC2 135 Giles and colleagues.2004, 2006Investigating ovarian tumors for key gene signaturesOvalbumin, PR, PCNA, Vimentin62, 63Jackson and colleagues.2007CA125 expression in hen ovarian tumorsCA125 79 Stammer and colleagues.2008SELENBP1 downregulation in hen ovarian tumorsSELENBP1 149 Hales and colleagues.2008Cyclooxygenase expressions in hen ovarian tumorsCOX1, COX2, PGE2 67 Urick and colleagues.2008-2009VEGF expression in cultured ascites cells from hen ovarian tumorsVEGF160, 161Ansenberger and colleagues.2009Elevation of E-cadherin in hen ovarian tumorsE-cad 6 Hakim and colleagues.2009Investigating oncogenic mutations in hen ovarian tumorsp53, K-ras, H-ras 66 Zhuge and colleagues.2009CYP1B1 levels in chicken ovarian tumorsCYP1B1 175 Seo and colleagues.2010Upregulation of Claudin-10 in hen ovarian tumorsClaudin-10 145 Trevino and colleagues.2010Investigating ovarian tumors for key gene signaturesOvalbumin, Pax2, SerpinB3, OVM, LTF, RD 157 Choi and colleagues.2011Upregulation of MMP-3 in hen ovarian tumor stromaMMP-3 28 Barua and colleagues.2012Upregulation of DR6 in hen ovarian tumorsDR6 16 Lee and colleagues.2012-2014Upregulation of DNA methylation in hen ovarian tumorsDNMT1, DNMT3A, DNMT3B,
SPP1, SERPINB11, SERPINB1394, 101, 103, 104Lim and colleagues.2013-2014Key genes upregulated in endometrioid hen tumorsAvBD-11, CTNNB1, Wnt4102, 11, 100Bradaric and colleagues.2013Investigating immune cells in hen ovarian tumors 23 Ma and colleagues.2014Identifying unique proteins from proteomic profilingF2 thrombin, ITIH2 106 Hales and colleagues.2014Key genes upregulated in hen ovarian tumorsPAX2, MSX2, FOXA2, EN1 68 Parada and colleagues,2017Unique ganglioside expressed in hen ovarian tumorsNeuGcGM3 124 Open in a separate windowTable 2.Ovarian cancer prevention studies using laying hen model
AuthorYearSignificanceCitation
Barnes and colleagues.2002Medroxyprogesterone study 14
Johnson and colleagues.2006Different genetic strain of laying hens (C strain and K strain) 80
Urick and colleagues.2009Dietary aspirin in laying hens 161
Giles and colleagues.2010Restricted Ovulator strain 61
Carver and colleagues.2011Calorie-restricted hens 25
Eilati and colleagues.2012-2013Dietary flaxseed in laying hens43, 44, 45
Trevino and colleagues.2012Oral contraceptives in laying hens 156
Rodriguez and colleagues.2013Calorie-restricted hens with or without Vitamin D and progestin 136
Mocka and colleagues.2017p53 stabilizer CP-31398 in laying hens 112
Open in a separate window  相似文献   

20.
A Functionally Distinct TATA Box Required for Late Progression through the Epstein-Barr Virus Life Cycle   总被引:1,自引:1,他引:0       下载免费PDF全文
Tricia R. Serio  Niamh Cahill  Matthew E. Prout    George Miller 《Journal of virology》1998,72(10):8338-8343
  相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号