Mechanism of Rep-mediated adeno-associated virus origin nicking

The single-stranded adeno-associated virus type 2 (AAV) genome is flanked by terminal repeats (TRs) that fold back on themselves to form hairpinned structures. During AAV DNA replication, the TRs are nicked by the virus-encoded Rep proteins at the terminal resolution site (trs). This origin function apparently requires three sequence elements, the Rep binding element (RBE), a small palindrome that comprises a single tip of an internal hairpin within the TR (RBE'), and the trs. Previously, we determined the sequences at the trs required for Rep-mediated cleavage and demonstrated that the trs endonuclease reaction occurs in two discrete steps. In the first step, the Rep DNA helicase activity unwinds the TR, thereby extruding a stem-loop structure at the trs. In the second step, Rep transesterification activity cleaves the trs. Here we investigate the contribution of the RBE and RBE' during this process. Our data indicate that Rep is tethered to the RBE in a specific orientation during trs nicking. This orientation appears to align Rep on the AAV TR, allowing specific nucleotide contacts with the RBE' and directing nicking to the trs. Accordingly, alterations in the polarity or position of the RBE relative to the trs greatly inhibit Rep nicking. Substitutions within the RBE' also reduce Rep specific activity, but to a lesser extent. Interestingly, Rep interactions with the RBE and RBE' during nicking seem to be functionally distinct. Rep contacts with the RBE appear necessary for both the DNA helicase and trs cleavage steps of the endonuclease reaction. On the other hand, RBE' contacts seem to be required primarily for TR unwinding and formation of the trs stem-loop structure, not cleavage. Together, these results suggest a model of Rep interaction with the AAV TR during origin nicking through a tripartite cleavage signal comprised of the RBE, the RBE', and the trs.     

Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein.

We previously demonstrated that the adeno-associated virus (AAV) Rep68 and Rep78 proteins are able to nick the AAV origin of DNA replication at the terminal resolution site (trs) in an ATP-dependent manner. Using four types of modified or mutant substrates, we now have investigated the substrate requirements of Rep68 in the trs endonuclease reaction. In the first kind of substrate, portions of the hairpinned AAV terminal repeat were deleted. Only deletions that retained virtually all of the small internal palindromes of the AAV terminal repeat were active in the endonuclease reaction. This result confirmed previous genetic and biochemical evidence that the secondary structure of the terminal repeat was an important feature for substrate recognition. In the second type of substrate, the trs was moved eight bases further away from the end of the genome. The mutant was nicked at a 50-fold-lower frequency relative to a wild-type origin, and the nick occurred at the correct trs sequence despite its new position. This finding indicated that the endonuclease reaction required a specific sequence at the trs in addition to the correct secondary structure. It also suggested that the minimum trs recognition sequence extended three bases from the cut site in the 3' direction. The third type of substrate harbored mismatched base pairs at the trs. The mismatch substrates contained a wild-type sequence on the strand normally cut but an incorrect sequence on the complementary strand. All of the mismatch mutants were capable of being nicked in the presence of ATP. However, there was substantial variation in the level of activity, suggesting that the sequence on the opposite strand may also be recognized during nicking. Analysis of the mismatch mutants also suggested that a single-stranded trs was a viable substrate for the enzyme. This interpretation was confirmed by analysis of the fourth type of substrate tested, which contained a single-stranded trs. This substrate was also cleaved efficiently by the enzyme provided that the correct strand was present in the substrate. In addition, the single-stranded substrate no longer required ATP as a cofactor for nicking. Finally, all of the substrates with mutant trss bound the Rep protein as efficiently as the wild-type did. This finding indicated that the sequence at the cut site was not involved in recognition of the terminal repeat for specific binding by the enzyme. We concluded that substrate recognition by the AAV Rep protein involves at least two and possibly as many as four features of the AAV terminal repeat.(ABSTRACT TRUNCATED AT 400 WORDS)     

Charged-to-alanine scanning mutagenesis of the N-terminal half of adeno-associated virus type 2 Rep78 protein

The adeno-associated virus (AAV) Rep78 and Rep68 proteins are required for site-specific integration of the AAV genome into the AAVS1 locus (19q13.3-qter) as well as for viral DNA replication. Rep78 and Rep68 bind to the GAGC motif on the inverted terminal repeat (ITR) and cut at the trs (terminal resolution site). A similar reaction is believed to occur in AAVS1 harboring an analogous GAGC motif and a trs homolog, followed by integration of the AAV genome. To elucidate the functional domains of Rep proteins at the amino acid level, we performed charged-to-alanine scanning mutagenesis of the N terminus (residues 1 to 240) of Rep78, where DNA binding and nicking domains are thought to exist. Mutants were analyzed for their abilities to bind the GAGC motif, nick at the trs homolog, and integrate an ITR-containing plasmid into AAVS1 by electrophoretic mobility shift assay, trs endonuclease assay, and PCR-based integration assay. We identified the residues responsible for DNA binding: R107A, K136A, and R138A mutations completely abolished the binding activity. The H90A or H92A mutant, carrying a mutation in a putative metal binding site, lost nicking activity while retaining binding activity. Mutations affecting DNA binding or trs nicking also impaired the site-specific integration, except for E66A and E239A. These results provide important information on the structure-function relationship of Rep proteins. We also describe an aberrant nicking of Rep78. We found that Rep78 cuts predominantly at the trs homolog not only between the T residues (GGT/TGG), but also between the G and T residues (GG/TTGG), which may be influenced by the sequence surrounding the GAGC motif.     

Interaction of wild-type and mutant adeno-associated virus (AAV) Rep proteins on AAV hairpin DNA.

Both the Rep68 and Rep78 proteins of adeno-associated virus type 2 (AAV) bind to AAV terminal repeat hairpin DNA and can mediate site-specific nicking in vitro at the terminal resolution site (trs) within the terminal repeats. To define the regions of the Rep proteins required for these functions, a series of truncated Rep78 derivatives was created. Wild-type and mutant proteins were synthesized by in vitro translation and analyzed for AAV hairpin DNA binding, trs endonuclease activity, and interaction on hairpin DNA. Amino-terminal deletion mutants which lacked the first 29 or 79 amino acid residues of Rep78 did not bind hairpin DNA, which is consistent with our previous identification of a DNA-binding domain in this region. Progressive truncation of the carboxyl-terminal region of Rep78 did not eliminate hairpin DNA binding until the deletion reached amino acid 443. The electrophoretic mobility of the Rep-specific protein-DNA complexes was inversely related to the molecular weight of the Rep derivative. Analysis of the C-terminal deletion mutants by the trs endonuclease assay identified a region (amino acids 467 to 476) that is essential for nicking but is not necessary for DNA binding. When endonuclease-positive, truncated Rep proteins that bound hairpin DNA were mixed with full-length Rep78 or Rep68 protein in electrophoretic mobility shift assays, a smear of protein-DNA complexes was observed. This smear migrated at an intermediate position with respect to the bands generated by the proteins individually. An antibody recognizing only the full-length protein produced a novel supershift band when included in a mixed binding assay containing Rep68 and a truncated Rep mutant. These experiments suggest that the Rep proteins can form hetero-oligomers on the AAV hairpin DNA.     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Partial purification of adeno-associated virus Rep78, Rep52, and Rep40 and their biochemical characterization.

We have used differential cell extraction and conventional chromatography to separate and partially purify the four adeno-associated virus (AAV) nonstructural proteins Rep78, Rep68, Rep52, and Rep40. In the cytoplasmic extracts Rep52 and Rep40 were present in greater abundance than Rep68 and Rep78, with Rep78 being the least abundant. In nuclear extracts the four Rep proteins were approximately equal in abundance. Regardless of the subcellular fraction examined, three of the Rep proteins (Rep78, Rep68, and Rep40) consisted of two protein species with slightly different mobilities during polyacrylamide gel electrophoresis. In contrast, Rep52 consisted of only one protein species. Both Rep78 and Rep68 were capable of binding efficiently to AAV terminal hairpin DNA substrates, but we could not detect site-specific DNA binding by Rep52 and Rep40. Like Rep68, Rep78 had both an ATP-dependent trs endonuclease and a DNA helicase activity. Both Rep78 and Rep68 cut the terminal AAV sequence at the same site (nucleotide 124). The binding, trs endonuclease, and DNA helicase activities comigrated during sucrose density gradient centrifugation with a mobility expected for a monomer of the protein, suggesting that the three biochemical activities were intrinsic properties of the larger Rep proteins. The chromatographic behavior and the DNA-binding properties of the four Rep proteins identified at least two domains within the rep coding region, an exposed hydrophobic domain within the C-terminal end (amino acids 578 to 621) and a region within the N terminus (amino acids 1 to 214) which was necessary for binding to the terminal repeat sequence. No site-specific nuclease activity was seen in the presence of nucleotide analogs ATP-gamma-S or AMP-PNP, suggesting that ATP hydrolysis was required for the endonuclease reaction. Furthermore, although ATP was the only cofactor which would support the trs endonuclease activity of Rep78, Rep68 nuclease activity was seen in the presence of several other nucleotide cofactors, including CTP, GTP, and UTP.     

Stable secondary structure near the nicking site for adeno-associated virus type 2 Rep proteins on human chromosome 19

Adeno-associated virus serotype 2 (AAV-2) can preferentially integrate its DNA into a 4-kb region of human chromosome 19, designated AAVS1. The nicking activity of AAV-2's Rep68 or Rep78 proteins is essential for preferential integration. These proteins nick at the viral origin of DNA replication and at a similar site within AAVS1. The current nicking model suggests that the strand containing the nicking site is separated from its complementary strand prior to nicking. In AAV serotypes 1 through 6, the nicking site is flanked by a sequence that is predicted to form a stem-loop with standard Watson-Crick base pairing. The region flanking the nicking site in AAVS1 (5'-GGCGGCGGT/TGGGGCTCG-3' [the slash indicates the nicking site]) lacks extensive potential for Watson-Crick base pairing. We therefore performed an empirical search for a stable secondary structure. By comparing the migration of radiolabeled oligonucleotides containing wild-type or mutated sequences from the AAVS1 nicking site to appropriate standards, on native and denaturing polyacrylamide gels, we have found evidence that this region forms a stable secondary structure. Further confirmation was provided by circular dichroism analyses. We identified six bases that appear to be important in forming this putative secondary structure. Mutation of five of these bases, within the context of a double-stranded nicking substrate, reduces the ability of the substrate to be nicked by Rep78 in vitro. Four of these five bases are outside the previously recognized GTTGG nicking site motif and include parts of the CTC motif that has been demonstrated to be important for integration targeting.     

Selective cleavage of AAVS1 substrates by the adeno-associated virus type 2 rep68 protein is dependent on topological and sequence constraints

The adeno-associated virus type 2 (AAV-2) Rep78 and Rep68 proteins are required for replication of the virus as well as its site-specific integration into a unique site, called AAVS1, of human chromosome 19. Rep78 and Rep68 initiate replication by binding to a Rep binding site (RBS) contained in the AAV-2 inverted terminal repeats (ITRs) and then specifically nicking at a nearby site called the terminal resolution site (trs). Similarly, Rep78 and Rep68 are postulated to trigger the integration process by binding and nicking RBS and trs homologues present in AAVS1. However, Rep78 and Rep68 cleave in vitro AAVS1 duplex-linear substrates much less efficiently than hairpinned ITRs. In this study, we show that the AAV-2 Rep68 endonuclease activity is affected by the topology of the substrates in that it efficiently cleaves in vitro in a site- and strand-specific manner the AAVS1 trs only if this sequence is in a supercoiled (SC) conformation. DNA sequence mutagenesis in the context of SC templates allowed us to elucidate for the first time the AAVS1 trs sequence and position requirements for Rep68-mediated cleavage. Interestingly, Rep68 did not cleave SC templates containing RBS from other sites of the human genome. These findings have intriguing implications for AAV-2 site-specific integration in vivo.     

Preferential integration of adeno-associated virus type 2 into a polypyrimidine/polypurine-rich region within AAVS1

Adeno-associated virus type 2 (AAV2) preferentially integrates its genome into the AAVS1 locus on human chromosome 19. Preferential integration requires the AAV2 Rep68 or Rep78 protein (Rep68/78), a Rep68/78 binding site (RBS), and a nicking site within AAVS1 and may also require an RBS within the virus genome. To obtain further information that might help to elucidate the mechanism and preferred substrate configurations of preferential integration, we amplified junctions between AAV2 DNA and AAVS1 from AAV2-infected HeLaJW cells and cells with defective Artemis or xeroderma pigmentosum group A genes. We sequenced 61 distinct junctions. The integration junction sequences show the three classical types of nonhomologous-end-joining joints: microhomology at junctions (57%), insertion of sequences that are not normally contiguous with either the AAV2 or the AAVS1 sequences at the junction (31%), and direct joining (11%). These junctions were spread over 750 bases and were all downstream of the Rep68/78 nicking site within AAVS1. Two-thirds of the junctions map to 350 bases of AAVS1 that are rich in polypyrimidine tracts on the nicked strand. The majority of AAV2 breakpoints were within the inverted terminal repeat (ITR) sequences, which contain RBSs. We never detected a complete ITR at a junction. Residual ITRs at junctions never contained more than one RBS, suggesting that the hairpin form, rather than the linear ITR, is the more frequent integration substrate. Our data are consistent with a model in which a cellular protein other than Artemis cleaves AAV2 hairpins to produce free ends for integration.     

Directed integration of minute virus of mice DNA into episomes.

Recent studies with adeno-associated virus (AAV) have shown that site-specific integration is directed by DNA sequence motifs that are present in both the viral replication origin and the chromosomal preintegration DNA and that specify binding and nicking sites for the viral regulatory Rep protein. This finding raised the question as to whether other parvovirus regulatory proteins might direct site-specific recombination with DNA targets that contain origin sequences functionally equivalent to those described for AAV. To investigate this question, active and inactive forms of the minute virus of mice (MVM) 3' replication origin, derived from a replicative-form dimer-bridge intermediate, were propagated in an Epstein-Barr virus-based shuttle vector which replicates as an episome in a cell-cycle-dependent manner in mammalian cells. Upon MVM infection of these cells, the infecting genome integrated into episomes containing the active-origin sequence reported to be efficiently nicked by the MVM regulatory protein NS1. In contrast, MVM did not integrate into episomes containing either the inactive form of the origin sequence reported to be inefficiently nicked by NS1 or the active form from which the NS1 consensus nick site had been deleted. The structure of the cloned MVM episomal recombinants displayed several features previously described for AAV episomal and chromosomal recombinants. The findings indicate that the rules which govern AAV site-specific recombination also apply to MVM and suggest that site-specific chromosomal insertions may be achievable with different autonomous parvovirus replicator proteins which recognize binding and nicking sites on the target DNA.     

Asymmetric replication in vitro from a human sequence element is dependent on adeno-associated virus Rep protein.

The DNA of human parvovirus adeno-associated virus type 2 (AAV) integrates preferentially into a defined region of human chromosome 19. Southern blots of genomic DNA from latently infected cell lines revealed that the provirus was not simply inserted into the cellular DNA. Both the proviral and adjoining cellular DNA organization indicated that integration occurred by a complex, coordinated process involving limited DNA replication and rearrangements. However, the mechanism for targeted integration has remained obscure. The two larger nonstructural proteins (Rep68 and Rep78) of AAV bind to a sequence element that is present in both the integration locus (P1) and the AAV inverted terminal repeat. This binding may be important for targeted integration. To investigate the mechanism of targeted integration, we tested the cloned integration site subfragment in a cell-free replication assay in the presence or absence of recombinant Rep proteins. Extensive, asymmetric replication of linear or open-circular template DNA was dependent on the presence of P1 sequence and Rep protein. The activities of Rep on the cloned P1 element are analogous to activities on the AAV inverted terminal repeat. Replication apparently initiates from a 3'-OH generated by the sequence-specific nicking activity of Rep. This results in a covalent attachment between Rep and the 5'-thymidine of the nick. The complexity of proviral structures can be explained by the participation of limited DNA replication facilitated by Rep during integration.     

A Rep recognition sequence is necessary but not sufficient for nicking of DNA by adeno-associated virus type-2 Rep proteins

The strand-specific, site-specific endonuclease (nicking) activity of the Rep68 and Rep78 (Rep68/78) proteins of adeno-associated virus type 2 (AAV) is involved in AAV replication, and appears to be involved in AAV site-specific integration. Rep68/78 cuts within the inverted terminal repeats (ITRs) of the AAV genome and in the AAV preferred integration locus on human chromosome 19 (AAVS1). The known endonuclease cut sites are 11-16 bases away from the primary binding sites, known as Rep recognition sequences (RRSs). A linear, double-stranded segment of DNA, containing an RRS and a cut site, has previously been shown to function as a substrate for the Rep68/78 endonuclease activity. We show here that mutation of the Rep recognition sequence, within such a DNA segment derived from the AAV ITRs, eliminates the ability of this substrate to be cleaved detectably by Rep78. Rep78 nicks the RRS-containing site from AAVS1 about half as well as the linear ITR sequence. Eighteen other RRS-containing sequences found in the human genome, but outside AAVS1, are not cleaved by Rep78. These results may help to explain the specificity of AAV integration.     

Mutational analysis of adeno-associated virus type 2 Rep68 protein endonuclease activity on partially single-stranded substrates

The endonuclease activity of the Rep68 and Rep78 proteins (Rep68/78) of adeno-associated virus type 2 (AAV) cuts at the terminal resolution site (trs) within the hairpin structure formed by the AAV inverted terminal repeats. Recent studies suggest that a DNA unwinding function of Rep68/78 may be required for endonuclease activity. We demonstrate that several mutant proteins which are endonuclease negative on a fully duplex hairpin substrate are endonuclease positive on a partially single-stranded hairpin substrate. Truncation analysis revealed that the endonuclease function is contained within the first 200 amino acids of Rep68/78. This endonucleolytic cleavage is believed to involve the covalent attachment of Rep68/78 to the trs via a phosphate-tyrosine linkage. A previous report (S. L. Walker, R. S. Wonderling, and R. A. Owens, J. Virol. 71:2722-2730, 1997) suggested that tyrosine 152 was part of the active site. We individually mutated each tyrosine within the first 200 amino acids of the Rep68 moiety of a maltose binding protein-Rep68/78 fusion protein to phenylalanine. Only mutation of tyrosine 156 resulted in a protein incapable of covalent attachment to a partially single-stranded hairpin substrate, suggesting that tyrosine 156 is part of the endonuclease active site.     

Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats.

Replication of the palindromic inverted terminal repeats (ITRs) of adeno-associated virus type 2 requires several functions of the viral nonstructural Rep proteins. These include binding to the ITR, nicking of the double-stranded replication intermediate at the terminal resolution site (trs), and then strand displacement and synthesis from the nick. This report demonstrates the ability of both recombinant fusion maltose-binding protein (MBP)-Rep68 delta produced in Escherichia coli and wild-type (wt) Rep68 to bind to a linear truncated form of the ITR, delta 57 ITR, with similar affinity as to the wt hairpin ITR. A dissociation constant for MBP-Rep68 delta of approximately 8 x 10(-10) M was determined for the wt ITR and delta 57 ITR probes. Truncation of delta 57 ITR to generate delta 28 ITR, which retains the GCTC repeat motif but not the trs, bound at least 10 times less efficiently than delta 57 ITR. Extension of delta 28 ITR with nonspecific sequence restored the ability of MBP-Rep68 delta to bind to delta 28 ITR. Thus, high-affinity binding would appear to require stabilization by flanking sequence as well as the intact GCTC repeat motif. Cleavage of the delta 57 ITR probe with DdeI, which truncates the flanking sequence and was previously shown to inhibit binding by Rep68, also inhibited the binding of MBP-Rep68 delta. The requirements for stable binding were further defined with a series of oligonucleotide probes which spanned the region protected by MBP-Rep78 in DNase I footprinting. The binding activity of either MBP-Rep68 delta or wt Rep68 to hairpin ITR or delta 57 ITR was indistinguishable. However, the binding activity of MBP-Rep68 delta to DNA does not appear to correlate with trs endonuclease activity. The nicking and covalent linkage of MBP-Rep68 delta to the nonhairpin delta 57 ITR was approximately 100-fold less efficient than its linkage to a hairpin-containing ITR. Therefore, although the hairpin portion of the ITR does not appear to play a role in recognition and stabilization of MBP-Rep68 delta binding, its presence does affect the trs cleavage activity of the protein.     

A novel 165-base-pair terminal repeat sequence is the sole cis requirement for the adeno-associated virus life cycle.

Adeno-associated virus (AAV) replication is dependent on two copies of a 145-bp inverted terminal repeat (ITR) that flank the AAV genome. This is the primary cis-acting element required for productive infection and the generation of recombinant AAV (rAAV) vectors. We have engineered a plasmid (pDD-2) containing only 165 bp of AAV sequence: two copies of the D element, a unique sequence adjacent to the AAV nicking site, flanking a single ITR. When assayed in vivo, this modified hairpin was sufficient for the replication of the plasmid vector when Rep and adenovirus (Ad) helper functions were supplied in trans. pDD-2 replication intermediates were characteristic of the AAV replication scheme in which linear monomer, dimer, and other higher-molecular-weight replicative intermediates are generated. Compared to infectious AAV clones for replication, the modified hairpin vector replicated more efficiently independent of size. Further analysis demonstrated conversion of the input circular plasmid to a linear substrate with AAV terminal repeat elements at either end as an initial step for replication. This conversion was independent of both Rep and Ad helper genes, suggesting the role of host factors in the production of these molecules. The generation of these substrates suggested resolution of the modified terminal repeat through a Holliday-like structure rather than replication as a mechanism for rescue. Production of replicative intermediates via this plasmid substrate were competent not only for AAV DNA replication but also for encapsidation, infection, integration, and subsequent rescue from the chromosome when superinfected with Ad and wild-type AAV. These studies demonstrate that this novel 165-bp ITR substrate is sufficient in cis for the AAV life cycle and should provide a valuable reagent for further dissecting the cis sequences involved in AAV replication, packaging, and integration. In addition, this novel plasmid vector can be used as a substrate for both rAAV vector production and synthetic plasmid vector delivery.     

A novel terminal resolution-like site in the adeno-associated virus type 2 genome.

The adeno-associated virus 2 (AAV) contains a single-stranded DNA genome of which the terminal 145 nucleotides are palindromic and form T-shaped hairpin structures. These inverted terminal repeats (ITRs) play an important role in AAV DNA replication and resolution, since each of the ITRs contains a terminal resolution site (trs) that is the target site for the AAV rep gene products (Rep). However, the Rep proteins also interact with the AAV DNA sequences that lie outside the ITRs, and the ITRs also play a crucial role in excision of the proviral genome from latently infected cells or from recombinant AAV plasmids. To distinguish between Rep-mediated excision of the viral genome during rescue from recombinant AAV plasmids and the Rep-mediated resolution of the ITRs during AAV DNA replication, we constructed recombinant AAV genomes that lacked either the left or the right ITR sequence and one of the Rep-binding sites (RBSs). No rescue and replication of the AAV genome occurred from these plasmids following transfection into adenovirus type 2-infected human KB cells, as expected. However, excision and abundant replication of the vector sequences was clearly detected from the plasmid that lacked the AAV left ITR, suggesting the existence of an additional putative excision site in the left end of the AAV genome. This site was precisely mapped to one of the AAV promoters at map unit 5 (AAV p5) that also contains an RBS. Furthermore, deletion of this RBS abolished the rescue and replication of the vector sequences. These studies suggest that the Rep-mediated cleavage at the RBS during viral DNA replication may, in part, account for the generation of the AAV defective interfering particles.     

Biologically active Rep proteins of adeno-associated virus type 2 produced as fusion proteins in Escherichia coli.

Four Rep proteins are encoded by the human parvovirus adeno-associated virus type 2 (AAV). The two largest proteins, Rep68 and Rep78, have been shown in vitro to perform several activities related to AAV DNA replication. The Rep78 and Rep68 proteins are likely to be involved in the targeted integration of the AAV DNA into human chromosome 19, and the full characterization of these proteins is important for exploiting this phenomenon for the use of AAV as a vector for gene therapy. To obtain sufficient quantities for facilitating the characterization of the biochemical properties of the Rep proteins, the AAV rep open reading frame was cloned and expressed in Escherichia coli as a fusion protein with maltose-binding protein (MBP). Recombinant MBP-Rep68 and MBP-Rep78 proteins displayed the following activities reported for wild-type Rep proteins when assayed in vitro: (i) binding to the AAV inverted terminal repeat (ITR), (ii) helicase activity, (iii) site-specific (terminal resolution site) endonuclease activity, (iv) binding to a sequence within the integration locus for AAV DNA on human chromosome 19, and (v) stimulation of radiolabeling of DNA containing the AAV ITR in a cell extract. These five activities have been described for wild-type Rep produced from mammalian cell extracts. Furthermore, we recharacterized the sequence requirements for Rep binding to the ITR and found that only the A and A' regions are necessary, not the hairpin form of the ITR.     

Biochemical Characterization of Adeno-Associated Virus Rep68 DNA Helicase and ATPase Activities

The adeno-associated virus (AAV) nonstructural proteins Rep68 and Rep78 are site-specific DNA binding proteins, ATP-dependent site-specific endonucleases, helicases, and ATPases. These biochemical activities are required for viral DNA replication and control of viral gene expression. In this study, we characterized the biochemical properties of the helicase and ATPase activities of homogeneously pure Rep68. The enzyme exists as a monomer in solution at the concentrations used in this study (<380 nM), as judged by its mobility in sucrose density gradients. Using a primed single-stranded (ss) circular M13 substrate, the helicase activity had an optimum pH of 7 to 7.5, an optimum temperature of 45°C, and an optimal divalent-cation concentration of 5 mM MgCl₂. Several nucleoside triphosphates could serve as cofactors for Rep68 helicase activity, and the order of preference was ATP = GTP > CTP = dATP > UTP > dGTP. The K_m values for ATP in both the DNA helicase reaction and the site-specific trs endonuclease reaction were essentially the same, approximately 180 μM. Both reactions were sigmoidal with respect to ATP concentration, suggesting that a dimer or higher-order multimer of Rep68 is necessary for both DNA helicase activity and terminal resolution site (trs) nicking activity. Furthermore, when the enzyme itself was titrated in the trs endonuclease and ATPase reactions, both activities were second order with respect to enzyme concentration. This suggests that a dimer of Rep68 is the active form for both the ATPase and nicking activities. In contrast, DNA helicase activity was linear with respect to enzyme concentration. When bound to ssDNA, the enzyme unwound the DNA in the 3′-to-5′ direction. DNA unwinding occurred at a rate of approximately 345 bp per min per monomeric enzyme molecule. The ATP turnover rate was approximately 30 to 50 ATP molecules per min per enzyme molecule. Surprisingly, the presence of DNA was not required for ATPase activity. We estimated that Rep translocates processively for more than 1,300 bases before dissociating from its substrate in the absence of any accessory proteins. DNA helicase activity was not significantly stimulated by substrates that have the structure of a replication fork and contain either a 5′ or 3′ tail. Rep68 binds only to ssDNA, as judged by inhibition of the DNA helicase reaction with ss or double-stranded (ds) DNA. Consistent with this observation, no helicase activity was detected on blunt-ended ds oligonucleotide substrates unless they also contained an ss 3′ tail. However, if a blunt-ended ds oligonucleotide contained the 22-bp Rep binding element sequence, Rep68 was capable of unwinding the substrate. This means that Rep68 can function both as a conventional helicase for strand displacement synthesis and as a terminal-repeat-unwinding protein which catalyzes the conversion of a duplex end to a hairpin primer. Thus, the properties of the Rep DNA helicase activity suggest that Rep is involved in all three of the key steps in AAV DNA replication: terminal resolution, reinitiation, and strand displacement.