Purified mu EBP-E binds to immunoglobulin enhancers and promoters.

We describe the purification to apparent homogeneity of the murine immunoglobulin heavy-chain (IgH) enhancer-binding protein mu EBP-E from murine plasmacytoma cells by ion exchange and affinity chromatography. Glycerol gradient sedimentation, UV cross-linking, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis confirm that mu EBP-E is a 45-kilodalton molecular mass protein. Orthophenanthroline-copper chemical nuclease footprinting with purified protein has identified high-affinity binding sites for mu EBP-E within the IgH enhancer at the previously identified site E and at sites within IgH promoters and in the kappa light-chain enhancer. Equilibrium binding studies indicate that the dissociation constants for mu EBP-E binding to site E within the enhancer and to a binding site within the V1 heavy-chain promoter are quite low, about 2 x 10(-11) M. Comparison of four mu EBP-E recognition sequences detects only limited sequence similarity among binding sites.     

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.     

Effect of interferon-alpha on immunoglobulin synthesis by human B cells

We have investigated the effect of human recombinant interferon-alpha (IFN-alpha) on mitogen-induced immunoglobulin (Ig) production by peripheral blood mononuclear cells from normal individuals. Low concentrations (1 to 100 IU/ml) of IFN-alpha enhanced pokeweed mitogen-stimulated Ig production. In contrast, high concentrations of IFN-alpha (10(5) IU/ml) suppressed pokeweed mitogen-induced Ig production. Irradiation of T cells did not ablate the high dose suppression, indicating that suppression was not due to a radiation-sensitive T cell. Kinetic experiments revealed that IFN-alpha needed to be added to 10 day cultures within the first 72 hr for either enhancement or suppression to be noted. Preincubation of purified B cells with IFN-alpha suppressed Ig production as completely as when unfractionated mononuclear cells were incubated with IFN-alpha. On the other hand, preincubation of T cells or monocytes with IFN-alpha had no effect on subsequent Ig production in reconstituted mononuclear cell cultures. Mitogen-induced proliferation of purified B cells was not affected by IFN-alpha at any concentration, but Ig production by purified B cells stimulated with Staphylococcus aureus Cowan I or anti-mu and B cell differentiation factors responded to IFN-alpha with low concentration enhancement and high concentration suppression. Studies of Ebstein-Barr virus-transformed B cell lines showed that IFN-alpha caused a similar effect on the CESS line as on peripheral blood B cells, with low dose enhancement and high dose suppression of Ig production. Thus one IFN-alpha effect is to modulate Ig production, and this appears to be a direct effect on B cells. Combined with the data in the accompanying paper, the effects of IFN-alpha on B cell function are similar in vivo and in vitro.     

A "lymphokine-like" soluble product that induces proliferation and maturation of B cells appears in the serum-free supernatant of a T cell hybridoma as a consequence of mycoplasmal contamination

The serum-free supernatant of a cloned murine T cell hybridoma supports the proliferation and maturation to Ig secretion of purified B cells (mu+ cells) from BALB/c nu/nu mice, but has no effect on the proliferation of nylon wool-selected BALB/c nu/+ splenic T cells. Although the supernatant activates B cells without co-stimulation, it synergizes with anti-mu for the proliferative response. The induction of B cell proliferation and maturation to Ig secretion is directly related to contamination of the hybridoma by Mycoplasma hyorhinis. Hybridoma cells freed of mycoplasma by detergent treatment fail to produce active supernatant, and reinfection of the treated cells reconstitutes the activity. Furthermore, deliberate infection of a mycoplasma-free unrelated T cell hybridoma, as well as the monocytic cell line P388D1, results in the production of supernatants with B cell proliferating activity. Mycoplasma organisms isolated from the supernatant induce B cell proliferation without subsequent maturation to Ig secretion. Gel filtration chromatography of the supernatant from mycoplasma-contaminated hybridoma cells yields two peaks of activity. The first peak, found at the exclusion limit of the gel, results in B cell proliferation without maturation and may be attributed to mycoplasma organisms. The second peak (average m.w. 90,000) results in B cell proliferation as well as differentiation to Ig secretion. A "lymphokine-like" soluble product released by Mycoplasma hyorhinis is most likely responsible for this B cell activation, because fractionation of the supernatant from deliberately contaminated P388D1 cells gives essentially the same results, and gel filtration of mycoplasma-free supernatants does not generate any active fractions. The possibility should be considered that mycoplasma-derived soluble products may be among the many factors controlling in vitro B cell growth and maturation.     

Activation of human B cells and inhibition of their terminal differentiation by monoclonal anti-mu antibodies

Anti-mu antibody preparations have been found to exert both positive and negative effects on B cell activation and differentiation. To explore these paradoxical influences of IgM cross-linkage on human B cells, three gamma 1 kappa murine monoclonal antibodies specific for human mu-chains (DA4.4, AB6.4, 145.8) were examined for their comparative effects on activation of B cells and inhibition of terminal plasma cell differentiation. All three antibodies appeared equally efficient in immunoprecipitation of surface IgM molecules; however, fluorescence-activated cell sorter analysis revealed that the DA4.4 and AB6.4 antibodies saturated the B cell surface IgM at slightly lower concentrations than did the 145.8 antibody. When the affinity-purified antibodies were added in varying concentrations to cultures of small resting B cells, all three antibodies induced B cell enlargement and DNA synthesis, but with varying degrees of efficiency (DA4.4 greater than AB6.4 much greater than 145.8). In striking contrast, large B cells isolated either by FACS or density gradient separation were unresponsive. The anti-mu-induced proliferative response of small B cells required relatively high B cell densities, but not T cells or the Fc portion of the antibody molecules. The maximal proliferative response was obtained during the third day of culture, and the response curve suggested that anti-mu induced only one round of B cell replication. All three antibodies were capable of completely inhibiting T cell factor-induced differentiation of large B cells into IgM plasma cells; both F(ab')2 fragments and intact anti-mu antibodies were effective in final concentrations as low as 1 microgram/ml. Significant suppression of IgG and IgA plasma cell differentiation was also achieved, but required higher concentrations of the anti-mu antibodies. For each antibody, there was a close correlation between the efficiency of inducing small B cell proliferation and of inhibiting large B cell differentiation into plasma cells. The results show that the B cell response to cross-linkage of cell surface IgM varies according to the differentiation stage. We postulate that the mature resting B cell represents the only stage in the life history of the B cell during which surface Ig cross-linkage leads to a positive signal, negative signals being the rule at other stages in B cell replication and differentiation.     

An enhancer at the 3'' end of the mouse immunoglobulin heavy chain locus.

A tissue-specific enhancer (E mu) lies between the joining (JH) and mu constant region (C mu) gene segments of the immunoglobulin heavy chain (IgH) locus. Since mouse endogenous IgH genes are efficiently transcribed in its absence, the normal function of this enhancer remains ill-defined. Recently, another lymphoid-specific enhancer of equal strength has been identified 3' of the rat IgH locus. We have isolated an analogous sequence from mouse and have mapped it 12.5 kb 3' of the 3'-most constant region gene (C alpha-membrane) of the BALB/c mouse locus. The mouse and rat sequences are 82% homologous and share with other enhancers several DNA sequence motifs capable of binding protein. However, in transient transfection assays, the mouse sequence behaves as a weaker enhancer. The role of this distant element in the expression of endogenous IgH genes, both in E mu-deficient, Ig-producing cell lines and during normal B cell development, is discussed.     

Functional studies on B cell hybridomas with B cell surface antigens. I. Effects of anti-immunoglobulin antibodies on proliferation and differentiation

B cell hybridomas with Ia and IgM molecules on the cell membrane were treated with either purified goat anti-mouse mu antibody (anti-mu) or monoclonal rat anti-mouse IgM antibody (anti-IgM). The spontaneous uptake of [3H] thymidine by these cells was markedly inhibited by both reagents. These hybrid cells could be induced to differentiate into IgM-secreting cells in the presence of these reagents at high frequency. Furthermore, the induction of IgM secretion by B cell hybridomas treated with these antibodies was completely T cell independent, and cell division was not required for the differentiative response to anti-mu. In addition, F(ab')2 fragments of anti-mu showed more effects on proliferation and differentiation of these cells than intact anti-mu. Interestingly, TH2.54, a subline of B cell hybridomas, could generate IgG2a production as well as IgM when incubated with anti-mu. These findings suggest very strongly that the interaction of either goat anti-mu or monoclonal rat anti-IgM with surface IgM molecules on the cell membrane of the B cell hybridomas inhibits in vitro spontaneous proliferation, and results in providing signals for differentiation into Ig-secreting cells without T cell factors.