The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.     

The nucleotide sequence of the 5S rRNA from Spiroplasma species BC3 and Mycoplasma mycoides sp. capri PG3

Using in vitro labelling techniques, the complete nucleotide sequence of the 5S ribosomal RNAs isolated from the honeybee pathogen, Spiroplasma species BC3 and Mycoplasma mycoides sp. capri PG3, have been determined. The latter shows only 3 differences from the reported sequence of M. capricolum 5S rRNA, indicating that these two species are very closely related. The Spiroplasma sequence is also 107 nucleotides long and a comparative analysis of the sequence confirms that this Spiroplasma species is closely related to the Mycoplasma species and that they and the Gram-positive eubacteria have descended from a common ancestor and in the process the cell wall-less organisms have lost a large percentage of their genome.     

The nucleotide sequence of phenylalanine tRNA from Mycoplasma sp. (Kid)

The nucleotide sequence of Mycoplasma sp. (Kid) phenylalanine tRNA was determined to be pG-G-U-C-G-U-G-U-A-G-C-U-C-A-G-U-C-G-G-D-A-G-A-G-C-A-G-C- A-G-A-C-U-G-A-A-m(1)G-C-Psi-C-U-G-C-G-U-m(7)G-U-C-G-G-C-G-G-U-Psi-C-A-A-U-U-C-C-G-U-C-C-A-C-G-A-C-C-A-C-C-A(OH). It is characterized by the absence of ribothymidine and the presence of only few modified nucleotides.     

The in vitro Resistance to Antibiotics of Mycoplasma mycoides var. capri

S ummary . Resistance to dihydrostreptomycin, chloramphenicol and oleandomcin has been induced in vitro in a strain of Mycoplasma mycoides var. capri. The chloramphenicol resistant strain showed high resistance to oleandomycin, but the converse was not observed. The same cross resistance was also found, but to only a very small extent, in Staphylococcus aureus and Streptococcus faecalis. No cross resistance was found in three other species of bacteria examined. The osmotic lysis of the normal and the chloramphenicol resistant strains of M. mycoides var. capri were similar.     

Rapid photometric assay of growth of Mycoplasma mycoides subsp. capri

A new spectrophotometric technique for evaluation of early growth in liquid culture of Mycoplasma mycoides subsp. capri has been developed. As turbidity does not appear until after incubation to 18 h the method utilizes the change in absorbance of the medium at 550 nm to monitor growth. The change in absorbance of the medium (which contains phenol red) occurs when the pH changes due to microbial growth. For measurement of growth at later stages when turbidity is proportional to number of colony forming units, two other wavelengths (450 nm and 700 nm) have been suggested.     

Rapid photometric assay of growth of Mycoplasma mycoides subsp. capri

A new spectrophotometric technique for evaluation of early growth in liquid culture of Mycoplasma mycoides subsp. capri has been developed. As turbidity does not appear until after incubation to 18 h the method utilizes the change in absorbance of the medium at 550 nm to monitor growth. The change in absorbance of the medium (which contains phenol red) occurs when the pH changes due to microbial growth. For measurement of growth at later stages when turbidity is proportional to number of colony forming units, two other wavelengths (450 nm and 700 nm) have been suggested.     

Surveillance of Mycoplasma agalactiae and Mycoplasma mycoides subsp. capri in dairy goat herds

This study was designed to monitor the presence of Mycoplasma agalactiae and Mycoplasma mycoides subsp. capri (Mmc) in 66 dairy goat herds of a genetic improvement programme in a region of Spain where contagious agalactia is endemic. Over a whole lactation period, 300 bulk tank milk and 381 milk samples from goats with clinical mastitis were subjected to polymerase chain reaction (PCR) to detect the two mycoplasma species. The presence of mycoplasmas (either species or both) was detected in 66.7% of the herds and M. agalactiae was identified in 95.45% of these positives herds. In a given infected herd, mycoplasmas were not continuously detected over the whole study period. Our findings indicate that in an endemic area, M. agalactiae and Mmc can be monitored through PCR analysis of mastitic milk and bulk tank milk (BTM) samples. Over a lactation period we recommend testing multiple BTM samples on a herd. No relationship was observed between the use of inactivated mycoplasma vaccines and the PCR detection of both mycoplasmas.     

α-glucosidase in Mycoplasma mycoides subspecies capri

Abstract Mycoplasma mycoides subsp. capri utilisede maltose in medium lacking serum and hence serum saccharolytic enzymes. The presence of α-glucosidase activity was demonstrated by p-nitrophenyl-α- d -glucoside hydrolysis in toluene-treated cells. Specific activities were approx. 4-fold higher in cells grown in the presence of maltose than in cells grown with other sugars or with glucose plus maltose. Extracellular activity was < 2% of cellular activity in growing cultures. α-Glucosidase activity was also demonstrated in cells grown in medium containing serum. It is suggested that the presence of α-glucosidase might be of value in mycoplasma chatacterisation; in a previous study, α-glucosidase activity was not detected in Mycoplasma mycoides subsp. mycoides .     

Relationships between strains of Mycoplasma mycoides subspp. mycoides and capri studied by two-dimensional gel electrophoresis of cell proteins.

Strains of Mycoplasma mycoides subsp. mycoides have been divided into small colony (SC) and large colony (LC) types (Cottew & Yeats, 1978). The protein patterns of representative strains of these two types and of M. mycoides subsp. capri were compared by a high resolution, two-dimensional gel electrophoretic method. The results suggest that the LC strains are more closely related to M. mycoides subsp. capri than to the SC strains of M. mycoides subsp. mycoides.     

The nucleotide sequence of asparagine tRNA from Escherichia coli.

The nucleotide seuquence of Escherichia coli asparagine tRNA was determined to be pU-C-C-U-C-U-G-s4U-A-G-U-U-C-A-G-D-C-G-G-D-A-G-A-A-C-G-G-C-G-G-A-C-U-Q-U-U-t6A-A-phi-C-C-G-U-A-U-m G-U-C-A-C-U-G-G-T-phi-C-G-A-G-U-C-C-A-G-U-C-A-G-A-G-G-A-G-C-C-AOH. Its D-stem and D-loop have almost the same sequence as Escherichia coli aspartate tRNA.     

The nucleotide sequence of lysine tRNA2 from Drosophila.

The nucleotide sequence of Drosophila melanogaster lysine tRNA2 was determined to be: pG-C-C-C-G-G-C-U-A-m2G-C-U-C-A-G-D-C-G-G-D-A-G-A-G-C-A-psi-G-A-G-A-C-U-C-U-U-t6A-A-psi-C-U-C-A-G-G-m7G-D-C-G-U-G-G-G-Xm-U-C-G-m1A-G-C-C-C-C-A-C-G-U-U-G-G-G-C-G-C-C-A(OH). With minor differences in the state of modification of some nucleotides, the sequence is the same as that of lysine tRNA2b from rabbit liver.     

The nucleotide sequence of a glutamine tRNA from rat liver.

A glutamate tRNA from rat liver was purified. By means of post-labeling techniques, its nucleotide sequence was shown to be: pU-C-C-C-A-C-A-U-m1G-G-U-C-psi-A-G-C- G-G-D-D-A-G-G-A-U-U-C-C-U-G-G-psi-U-mcm5S2U-U-C-A-C-C-C-A-G-G-C-G- G-C-m5C-m5C-G-G-G-Tm-psi-C-G-A-C-U-C-C-C-G-G-U-G-U-G-G-G-A-A-C-C-AOH. The sequence is remarkably similar to that of tRNAGlu from Drosophila melanogaster. Only 10 out of 75 nucleotides in the two tRNAs are different.     

The nucleotide sequence of the initiator tRNA from Drosophila melanogaster.

The nucleotide sequence of Drosophila melanogaster methionine tRNAi was determined to be: pA-G-C-A-G-A-G-U-m1G-m2G-C-G-C-A-G-U-G-G-A-A-G-C-G-U-m2G-C-U-G-G-G-C-C-C-A-U-t6A-A-C-C-C-A-G-A-G-m7G-D-m5C-C-C-G-A-G-G-A-U-C-G-m1A-A-A-C-C-U-U-G-C-U-C-U-G-C-U-A-C-C-A(OH). It differs from vertebrate initiator tRNAs in only 6 out of 75 positions.     

The nucleotide sequence of a glutamate tRNA from rat liver.

A glutamate tRNA from rat liver was purified. By means of post-labeling techniques, its nucleotide sequence was shown to be: pU-C-C-C-A-C-A-U-m1G-G-U-C-psi-A-G-C- G-G-D-D-A-G-G-A-U-U-C-C-U-G-G-psi-U-mcm5s2U-U-C-A-C-C-C-A-G-G-C-G- G-C-m5C-m5C-G-G-G-Tm-psi-C-G-A-C-U-C-C-C-G-G-U-G-U-G-G-G-A-A-C-C-AOH. The sequence is remarkably similar to that of tRNA4Glu from Drosophila melanogaster. Only 10 out of 75 nucleotides in the two tRNAs are different.     

The nucleotide sequence of phenylalanine tRNA from Bacillus subtilis

The nucleotide sequence of tRNA(Phe) from Bacillussubtilis W 23 has been determined using (32)P labeled tRNA. This is the second B. subtilis tRNA so far reported. The nucleotide sequence was found to be pG-G-C-U-C-G-G-U-A-G-C-U-C-A-G-U-D-G-G-D-A-G-A-G-C-A-A-C-G-G-A-C-U-Gm-A-A- ms(2)i(6)A-A-psi-C-C-G-U-G-U-m(7)G-U-C-G-G-C-G-G-T-psi- C-G-A-U-U-C-C-G-U-C-C-C-G-A-G-C-C-A-C-C-A(OH).Images