The complete cDNA and polypeptide sequences of human erythroid alpha-spectrin.

Overlapping human erythroid alpha-spectrin cDNA clones were isolated from lambda gt11 libraries constructed from cDNAs of human fetal liver and erythroid bone marrow. The composite 8001-base pair (bp) cDNA nucleotide sequence contains 187-bp 5'- and 528-bp 3'-untranslated regions and has a single long open reading frame of 7287 bp that encodes a polypeptide of 2429 residues. As previously described (Speicher, D. W., and Marchesi, V. T. (1984) Nature 311, 177-180), spectrin is composed largely of homologous 106-amino acid repeat units. From the amino acid sequence deduced from the cDNA, alpha-spectrin can be divided into 22 segments. Segments 1-9 and 12-19 are homologous and can therefore be considered repeats; the average number of identical residues in pairwise comparisons of these repeats is 22 out of 106, or 21%. Of these 17 repeats, 11 are exactly 106 amino acids in length, whereas five others differ from this length by a single residue. Segments 11, 20, and 21, although less homologous, appear to be related to the more highly conserved repeat units. The very N-terminal 22 residues, segment 10, which is atypical both in length and sequence, and the C-terminal 150 residues in segment 22 appear to be unrelated to the conserved repeat units. The sequence of the erythroid alpha-spectrin polypeptide chain is compared to that of human alpha-fodrin and chicken alpha-actinin to which it is related. alpha-Spectrin is more distantly related to dystrophin.     

Amino acid sequence analysis of the annexin super-gene family of proteins.

The annexins are a widespread family of calcium-dependent membrane-binding proteins. No common function has been identified for the family and, until recently, no crystallographic data existed for an annexin. In this paper we draw together 22 available annexin sequences consisting of 88 similar repeat units, and apply the techniques of multiple sequence alignment, pattern matching, secondary structure prediction and conservation analysis to the characterisation of the molecules. The analysis clearly shows that the repeats cluster into four distinct families and that greatest variation occurs within the repeat 3 units. Multiple alignment of the 88 repeats shows amino acids with conserved physicochemical properties at 22 positions, with only Gly at position 23 being absolutely conserved in all repeats. Secondary structure prediction techniques identify five conserved helices in each repeat unit and patterns of conserved hydrophobic amino acids are consistent with one face of a helix packing against the protein core in predicted helices a, c, d, e. Helix b is generally hydrophobic in all repeats, but contains a striking pattern of repeat-specific residue conservation at position 31, with Arg in repeats 4 and Glu in repeats 2, but unconserved amino acids in repeats 1 and 3. This suggests repeats 2 and 4 may interact via a buried saltbridge. The loop between predicted helices a and b of repeat 3 shows features distinct from the equivalent loop in repeats 1, 2 and 4, suggesting an important structural and/or functional role for this region. No compelling evidence emerges from this study for uteroglobin and the annexins sharing similar tertiary structures, or for uteroglobin representing a derivative of a primordial one-repeat structure that underwent duplication to give the present day annexins. The analyses performed in this paper are re-evaluated in the Appendix, in the light of the recently published X-ray structure for human annexin V. The structure confirms most of the predictions and shows the power of techniques for the determination of tertiary structural information from the amino acid sequences of an aligned protein family.     

The finger motif defines a multigene family represented in the maternal mRNA of Xenopus laevis oocytes.

We have screened Xenopus laevis cDNA and genomic libraries for finger motif encoding sequences by use of a synthetic oligonucleotide probe coding for a stretch of conserved amino acids, the H/C-link, which joins individual finger loops in several multi-fingered proteins. Our studies reveal that a large number of different cDNA clones encode amino acid sequences predicting multiple units of the metal-coordinating finger structure. Derived proteins are different from each other as well as from the two examples of Xenopus finger proteins reported to date, TFIIIA and X.fin. The 109 finger repeats characterized are derived from 14 different cDNA clones and have been analysed for the presence of conserved and highly variable amino acids, revealing a close structural relatedness among each other as well as with a few selected finger domains from Drosophila and mouse proteins. The results from this comparative sequence analysis are also discussed in terms of the existing models for DNA binding. All sequences are identified in an ovary cDNA library but the patterns of mRNA level for individual finger clones vary greatly during early development. The prevalence of these structures in the oocyte suggests that part of the maternal information for the realization of the developmental program utilized in Xenopus embryogenesis might be transmitted in the form of regulatory, nucleic-acid-binding proteins.     

A variant tandemly repeated nucleotide sequence in Balbiani ring 2 of Chironomus tentans

pCtBR2-2 is a genomic clone from Chironomus tentans that hybridized in situ to Balbiani ring 2 (BR2) on salivary gland polytene chromosome IV. DNA sequencing indicated that the insert contained nearly four copies of a 180 bp tandemly repeated nucleotide sequence that was distinctly different from a previously reported BR2 repeat. Sequence titration experiments detected about 70 copies of the 180 bp repeat per haploid genome, which would correspond to approximately 34% of a 37 kb BR2 gene. Each 180 bp repeat included a conserved 90 bp segment whose sequence was internally nonrepeating (INR), and a variable 90 bp repeated (R) segment comprised of three 30 bp repeats that may have evolved from a 9 bp consensus sequence. Results presented here raise the distinct possibility that other BR genes may contain significantly different repeated sequences that have not been identified.     

The involucrin gene of the orangutan: generation of the late region as an evolutionary trend in the hominoids

In the evolutionary line leading to the higher primates, the coding region of the involucrin gene evolved a segment consisting of numerous repeats of a 10-codon sequence. Additions to this segment of repeats have been made successively, thus generating regions that can be defined as early, middle, and late. The involucrin gene of the orangutan (Pongo pygmaeus abelii) possesses a segment of repeats whose early region has the same repeat structure as that in other anthropoids. The middle region is not similar in repeat structure to that of all anthropoids but is similar to that of other hominoids. The late region is unique to the species; it does not correspond at all in its repeat structure to that of the human or gorilla and is much larger. The late region of the orangutan was generated by duplications of blocks of older repeats clearly belonging to the middle region. Continued duplications extending the late region are an evolutionary trend in the hominoids. The process of addition of repeats at a particular location is a more significant aspect of the evolution of involucrin than are random nucleotide substitutions; in addition, it has proceeded more rapidly.      

Remodeling of the involucrin gene during primate evolution

The protein involucrin is a product of terminal differentiation in the epidermal cell and related cell types. By comparing the nucleotide sequence of the involucrin gene of the lemur with that of the human, it is clear that the gene has undergone unusual evolution in the primates. The coding region of the gene contains an ancestral segment, most of which is common to the lemur and the human, and a species-specific segment of repeats derived from the ancestral segment. Instead of the modern segment of repeats found in the human gene, the lemur gene possesses repeats derived from another sequence at a different location in the ancestral segment. The two kinds of segments of repeats probably represent alternative ways of creating a repeat structure in the involucrin molecule. The modern segment of repeats must have been created after divergence of the higher primates from the prosimians.     

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.     

Special evolutionary properties of genes encoding a protein with a simple amino acid repeat

We have examined the evolution of a gene, SM50, encoding a component of the spicule matrix, which plays an integral role in the formation of the echinoderm skeleton. This gene was originally characterized in Strongylocentrotus purpuratus and encodes an imperfect tandem repeat of six or seven amino acids. We have analyzed the sequence of this repeat in a number of sea urchin species and have determined that the repeat regions have undergone concerted evolution. There are differences in the repeat region between species, but the overall repeat structure is conserved, suggesting the repeat forms a structural domain important in biomineralization. The inherent conserved amino acid repeat structure promotes concerted evolution due to the high probability of misreplication and unequal crossing-over in the repeated segment of the gene. While there are constraints on the amino acids allowed in the repeat region, there are also variations, so that the sequences observed illustrate the balance between amino acid substitutions and concerted evolution. We have evidence that substitutions can alter the mechanisms of unequal crossing-over, altering the way concerted evolution occurs. The way in which concerted evolution occurred appears to be determined by the degree of sequence similarity between the repeats in a given gene, which influences how unequal crossing over may occur. We have mapped the differences in repeat regions on existing phylogenetic trees and indicate where concerted evolution has taken place. We also confirm an earlier report that Hemicentrotus pulcherrimus fits into the Strongylocentrotus genus and examine the evolution of the H. pulcherrimus SM50 repeat relative to other members of this genus. Received: 31 October 2000 / Accepted: 20 March 2001     

Structural and transcriptional analysis of a human subtelomeric repeat

A human subtelomeric repeat (designated as the HST repeat) has been isolated and characterized from a yeast artificial chromosome containing one human telomere. This repeat is located immediately adjacent to the telomeric T2AG3 repeats at the extreme termini of the human chromosomes. The DNA sequence of 3.6 kb of the HST repeat has been determined. The HST repeat spans over 3.6 kb in length, and contains one evolutionarily conserved CpG-rich region. The copy number of the HST repeat varies among telomeres. Genomic hybridization experiments suggest that the HST repeat consists of two distinct segments, and the distal portions of the HST repeat are also distributed elsewhere in the genome. In HeLa cells, the HST repeat sequence appears to be transcribed into a 6 kb polyadenylated RNA and a variety of non-polyadenylated RNA species.     

Overdrive, a T-DNA transmission enhancer on the A. tumefaciens tumour-inducing plasmid

During crown gall tumorigenesis a specific segment of the Agrobacterium tumefaciens tumour-inducing (Ti) plasmid, the T-DNA, integrates into plant nuclear DNA. Similar 23-bp direct repeats at each end of the T region signal T-DNA borders, and T-DNA transmission (transfer and integration) requires the right-hand direct repeat. A chemically synthesized right border repeat in its wild-type orientation promotes T-DNA transmission at a low frequency; Ti plasmid sequences which normally flank the right repeat greatly stimulate the process. To identify flanking sequences required for full right border activity, we tested the activity of a border repeat surrounded by different amounts of normal flanking sequences. Efficient T-DNA transmission required a conserved sequence (5' TAAPuTPy-CTGTPuT-TGTTTGTTTG 3') which lies to the right of the two known right border repeats. In either orientation, a synthetic oligonucleotide containing this conserved sequence greatly stimulated the activity of a right border repeat, and a deletion removing 15 bp from the right end of this sequence destroyed it stimulatory effect. Thus, wild-type T-DNA transmission required both the 23-bp right border repeat and a conserved flanking sequence which we call overdrive.     

Molecular cloning and expression of human tumor-associated polymorphic epithelial mucin.

Human mammary cells present on the cell surface a polymorphic epithelial mucin (PEM) which is developmentally regulated and aberrantly expressed in tumors. PEM carries tumor-associated epitopes recognized by the monoclonal antibodies HMFG-1, HMFG-2, and SM-3. Previously isolated partial cDNA clones revealed that the core protein contained a large domain consisting of variable numbers of 20-amino acid repeat units. We now report the full sequence for PEM, as deduced from cDNA sequences. The encoded protein consists of three distinct regions: the amino terminus consisting of a putative signal peptide and degenerate repeats; the major portion of the protein which is the tandem repeat region; the carboxyl terminus consisting of degenerate tandem repeats and a unique sequence containing a transmembrane sequence and a cytoplasmic tail. Potential O-glycosylation sites (serines or threonines) make up more than one-fourth of the amino acids. Length variations in the tandem repeat result in PEM being an expressed variable number tandem repeat locus. Tandem repeats appear to be a general characteristic of mucin core proteins.     

Sequence homologies of diverse length tandem repetitions near ends of vaccinia virus genome suggest unequal crossing over.

The 180,000 base pair (bp), covalently closed, linear duplex DNA genome of vaccinia virus contains a 10,000 bp inverted terminal repetition within which are one set of 13 and one set of 18 tandem 70 bp repeating units. A 967 bp segment containing the innermost 70 bp repeat and an adjacent region notable for a scarcity of restriction endonuclease sites has been sequenced. This was facilitated by the cloning of TaqI and partial TaqI fragments in pBR322. We found that the innermost 70 bp repeat overlaps one of two adjacent 125 bp repeats, following which are eight repeats of 54 bp, parts of 54 bp and 70 bp repeats, and four consecutive 6 to 7 bp repeats. The 70, 125, and 54 bp repeating units have extensive sequence homologies and redundancies that suggest evolution by unequal crossing over. Schemes whereby unequal crossovers of 54 bp repeats lead to a recombinant segment 86% homologous to the 125 bp repeat and unequal crossovers of 125 bp repeats lead to a recombinant segment 94% homologous to the 70 bp repeat were considered. This propensity for sequence divergence should provide a useful marker for comparing the relatedness of poxviruses.     

A single EGF-like motif of laminin is responsible for high affinity nidogen binding.

A major nidogen binding site of mouse laminin was previously localized to about three EGF-like repeats (Nos 3-5) of its B2 chain domain III [M. Gerl et al. (1991) Eur. J. Biochem., 202, 167]. The corresponding cDNA was amplified by polymerase chain reaction and inserted into a eukaryotic expression vector tagged with a signal peptide. Stably transfected human kidney cell clones were shown to process and secrete the resulting fragment B2III3-5 in substantial quantities. It possessed high binding activity for recombinant nidogen in ligand assays, with an affinity comparable with that of authentic laminin fragments. In addition, complexes of B2III3-5 and nidogen could be efficiently converted into a covalent complex by cross-linking reagents. Proteolytic degradation of the covalent complex demonstrated the association of B2III3-5 with a approximately 80 residue segment of nidogen domain G3 to which laminin binding has previously been attributed. The correct formation of most of the 12 disulfide bridges in B2III3-5 was indicated from its protease resistance and the complete loss of cross-reacting epitopes as well as of nidogen-binding activity after reduction and alkylation. Smaller fragments were prepared by the same recombinant procedure and showed that combinations of EGF-like repeats 3-4 and 4-5 and the single repeat 4 but not repeats 3 or 5 possess full nidogen-binding activity. This identifies repeat 4 as the only binding structure. The sequence of repeat 4 is well conserved in the human and in part in the Drosophila laminin B2 chain.(ABSTRACT TRUNCATED AT 250 WORDS)     

Identification and characterization of beta V spectrin, a mammalian ortholog of Drosophila beta H spectrin

Four mammalian beta-spectrin genes are currently recognized, all encode proteins of approximately 240-280,000 M(r) and display 17 triple helical homologous approximately 106-residue repeat units. In Drosophila and Caenorhabditis elegans, a variant beta spectrin with unusual properties has been recognized. Termed beta heavy (beta(H)), this spectrin contains 30 spectrin repeats, has a molecular weight in excess of 400,000, and associates with the apical domain of polarized epithelia. We have cloned and characterized from a human retina cDNA library a mammalian ortholog of Drosophila beta(H) spectrin, and in accord with standard spectrin naming conventions we term this new mammalian spectrin beta 5 (betaV). The gene for human betaV spectrin (HUBSPECV) is on chromosome 15q21. The 11, 722-nucleotide cDNA of betaV spectrin is generated from 68 exons and is predicted to encode a protein with a molecular weight of 416,960. Like its fly counterpart, the derived amino acid sequence of this unusual mammalian spectrin displays 30 spectrin repeats, a modestly conserved actin-binding domain, a conserved membrane association domain 1, a conserved self-association domain, and a pleckstrin homology domain near its COOH terminus. Its putative ankyrin-binding domain is poorly conserved and may be inactive. These structural features suggest that betaV spectrin is likely to form heterodimers and oligomers with alpha spectrin and to interact directly with cellular membranes. Unlike its Drosophila ortholog, betaV spectrin does not contain an SH3 domain but displays in repeat 5 a 45-residue insertion that displays 42% identity to amino acids 85-115 of the E4 protein of type 75 human papilloma virus. Human betaV spectrin is expressed at low levels in many tissues. By indirect immunofluorescence, it is detected prominently in the outer segments of photoreceptor rods and cones and in the basolateral membrane and cytosol of gastric epithelial cells. Unlike its Drosophila ortholog, a distinct apical distribution of betaV spectrin is inapparent in the epithelial cell populations examined, although it is confined to the outer segments of photoreceptor cells. The complete cDNA sequence of human betaV spectrin is available from GenBank(TM) as accession number.     

Conservation of a dinucleotide simple sequence repeat locus in sharks

Recent studies indicate that the flanking region and repeat motif structure of conserved microsatellite loci are useful for phylogenetic inference. Most comparative studies of microsatellite loci involve relatively closely related species, however, primarily because primers developed for one species often amplify only related species. We describe an analysis of a microsatellite locus in lamniform sharks that we estimate has been conserved for a billion years. Combined analysis of the flanking sequence and repeat motif structure resulted in a gene tree comparable to those reported from similar analyses of other genes. The conservation of the simple sequence repeat (SSR), and of the sequence flanking the SSR, is explained by a low substitution rate in sharks coupled with the possibility that mutations which interrupt perfect repeats are lost by replication slippage.     

Cloning and analysis of cDNA clones for rat kidney alpha-spectrin

We have isolated a 3922-base pair (bp) cDNA clone for rat nonerythroid alpha-spectrin from a rat kidney lambda gt11 cDNA library. Sequence analysis revealed that this cDNA contains an open reading frame of 3090 bp encoding for the C-terminal 1030 amino acid sequence of rat kidney alpha-spectrin. The 3'-untranslated region (including a 38-bp poly(A+) tail) contains an 832-bp sequence. A single mRNA of about 8 kilobase pairs was detected in rat liver, kidney, brain, heart, intestine, lung, testis, stomach, spleen, and muscle with varying abundances, which is consistent with and further confirms the presence of spectrins in nonerythroid tissues as demonstrated previously by immunoblot analysis. Southern blot analysis suggested that there is a single gene for nonerythroid alpha-spectrin. The derived amino acid sequence contains sequence from the spectrin 106-residue internal repeat 12 to the C terminus of rat kidney alpha-spectrin. Sequence comparison with human and chicken nonerythroid alpha-spectrin showed that nonerythroid alpha-spectrin is well conserved during evolution. The rat kidney alpha-spectrin sequence, when compared to rat brain alpha-spectrin, contains an extra 76-amino-acid sequence at the C terminus. Sequence comparison of all the internal repeats available revealed that the internal repeat 3, 4, 5, 6, 7, and 8 has highest sequence similarity with internal repeat 12, 13, 14, 15, 16, and 17, respectively. Therefore, internal repeats 3-8 and 12-17 are most likely derived from an ancestral gene through gene duplication, suggesting that the spectrin gene is derived from a half-spectrin gene by gene duplication and divergence during evolution.     

Cloning and sequencing of a human pancreatic tumor mucin cDNA

A monospecific polyclonal antiserum against deglycosylated human pancreatic tumor mucin was used to select human pancreatic mucin cDNA clones from a lambda gt11 cDNA expression library developed from a human pancreatic tumor cell line. The full-length 4.4-kilobase mucin cDNA sequence included a 72-base pair 5'-untranslated region and a 307-base pair 3'-untranslated region. The predicted amino acid sequence for this cDNA revealed a protein of 122,071 daltons containing 1,255 amino acid residues of which greater than 60% were serine, threonine, proline, alanine, and glycine. Approximately two-thirds of the protein sequence consisted of identical 20-amino acid tandem repeats which were flanked by degenerate tandem repeats and nontandem repeat sequences on both the amino-terminal and carboxyl-terminal ends. The amino acid sequence also contained five putative N-linked glycosylation sites, a putative signal sequence and transmembrane domain, and numerous serine and threonine residues (potential O-linked glycosylation sites) outside and within the tandem repeat position. The cDNA and deduced amino acid sequence of the pancreatic mucin sequence was over 99% homologous with a mucin cDNA sequence derived from breast tumor mucin, even though the native forms of these molecules are quite distinct in size and degree of glycosylation.