Interaction of FliS flagellar chaperone with flagellin

Premature polymerization of flagellin (FliC), the main component of flagellar filaments, is prevented by the FliS chaperone in the cytosol. Interaction of FliS with flagellin was characterized by isothermal titration calorimetry producing an association constant of 1.9x10(7) M-1 and a binding stoichiometry of 1:1. Experiments with truncated FliC fragments demonstrated that the C-terminal disordered region of flagellin is essential for FliS binding. As revealed by thermal unfolding experiments, FliS does not function as an antifolding factor keeping flagellin in a secretion-competent conformation. Instead, FliS binding facilitates the formation of alpha-helical secondary structure in the chaperone binding region of flagellin.     

Molecular binding of toxic phenothiazinium derivatives,azures to bovine serum albumin: A comparative spectroscopic,calorimetric, and in silico study

In this paper, the comparative binding behavior of antimalarial drug azure A, azure B and azure C with bovine serum albumin (BSA) has been studied. The interaction has been confirmed by multispectroscopic (UV, fluorescence, Fourier transform infrared (FT‐IR), and circular dichroism) and molecular docking techniques. The experimental results show that azure B has the highest BSA binding affinity followed by azure A and azure C. The experimental evidence of binding showed a static quenching mechanism in the interaction azures with BSA. The isothermal titration calorimetry result reveals that the binding was exothermic with positive entropy contribution in each case. The thermodynamic parameters ΔH, ΔG, and ΔS at 25°C were calculated, which indicates that the weak van der Waals forces and hydrogen bonding rather than the hydrophobic effect played an important role in the interaction. According to the theory of Förster nonradiative energy transfer, the distance (r) between the donor (BSA) and acceptor azures found to be <7 nm in all the case. The circular dichroism and FT‐IR studies show that the content of α‐helix structure has increased for the azures‐BSA system. Overall, experimental studies characterize the interaction dynamics and energetics of the binding of three toxic analogs towards the physiologically relevant serum albumins. We hope, the outcome of this work will be most helpful for synthesizing a new type of phenothiazinium derivatives of the better therapeutic application.     

Interaction of rat poly(A)-binding protein with poly(A)- and non-poly(A) sequences is preferentially mediated by RNA recognition motifs 3+4

Vasopressin (VP) mRNA and the non-coding BC200 RNA are sorted to neuronal dendrites. Among proteins interacting specifically with both RNAs is the multifunctional poly(A)-binding protein (PABP) consisting of four RNA recognition motifs (RRMs) and a C-terminal auxiliary domain. The protein/RNA interaction studies presented here reveal that PABPs association with VP- and BC200 RNA is exclusively mediated by RRMs 3+4. Quantitative binding studies with PABP deletion mutants demonstrate preferential binding of RRMs 3+4 even to poly(A)-homopolymers, while RRMs 1+2 exhibit a lower affinity for those sequences. An optimal interaction with both poly(A)- and non-poly(A) sequences is only achieved by full-size PABP.     

Paip2A inhibits translation by competitively binding to the RNA recognition motifs of PABPC1 and promoting its dissociation from the poly(A) tail

Eukaryotic mRNAs possess a poly(A) tail at their 3′-end, to which poly(A)-binding protein C1 (PABPC1) binds and recruits other proteins that regulate translation. Enhanced poly(A)-dependent translation, which is also PABPC1 dependent, promotes cellular and viral proliferation. PABP-interacting protein 2A (Paip2A) effectively represses poly(A)-dependent translation by causing the dissociation of PABPC1 from the poly(A) tail; however, the underlying mechanism remains unknown. This study was conducted to investigate the functional mechanisms of Paip2A action by characterizing the PABPC1–poly(A) and PABPC1–Paip2A interactions. Isothermal titration calorimetry and NMR analyses indicated that both interactions predominantly occurred at the RNA recognition motif (RRM)2–RRM3 regions of PABPC1, which have comparable affinities for poly(A) and Paip2A (dissociation constant, K_d = 1 nM). However, the K_d values of isolated RRM2 were 200 and 4 μM in their interactions with poly(A) and Paip2A, respectively; K_d values of 5 and 1 μM were observed for the interactions of isolated RRM3 with poly(A) and Paip2A, respectively. NMR analyses also revealed that Paip2A can bind to the poly(A)-binding interfaces of the RRM2 and RRM3 regions of PABPC1. Based on these results, we propose the following functional mechanism for Paip2A: Paip2A initially binds to the RRM2 region of poly(A)-bound PABPC1, and RRM2-anchored Paip2A effectively displaces the RRM3 region from poly(A), resulting in dissociation of the whole PABPC1 molecule. Together, our findings provide insight into the translation repression effect of Paip2A and may aid in the development of novel anticancer and/or antiviral drugs.     

RNA targeting by DNA binding drugs: Structural,conformational and energetic aspects of the binding of quinacrine and DAPI to A-form and H-form of poly(rC)·poly(rG)

A key step in the rational design of new RNA binding small molecules necessitates a complete elucidation of the molecular aspects of the binding of existing molecules to RNA structures. This work focuses towards the understanding of the interaction of a DNA intercalator, quinacrine and a minor groove binder 4′,6-diamidino-2-phenylindole (DAPI) with the right handed Watson–Crick base paired A-form and the left-handed Hoogsteen base paired H^L-form of poly(rC)·poly(rG) evaluated by multifaceted spectroscopic and viscometric techniques. The energetics of their interaction has also been elucidated by isothermal titration calorimetry. Results of this study converge to suggest that (i) quinacrine intercalates to both A-form and H^L-form of poly(rC)·poly(rG); (ii) DAPI shows both intercalative and groove-binding modes to the A-form of the RNA but binds by intercalative mode to the H^L-form. Isothermal calorimetric patterns of quinacrine binding to both the forms of RNA and of DAPI binding to the H^L-form are indicative of single binding while the binding of DAPI to the A-form reveals two kinds of binding. The binding of both the drugs to both conformations of RNA is exothermic; while the binding of quinacrine to both conformations and DAPI to the A-form (first site) is entropy driven, the binding of DAPI to the second site of A-form and H^L-conformation is enthalpy driven. Temperature dependence of the binding enthalpy revealed that the RNA–ligand interaction reactions are accompanied by small heat capacity changes that are nonetheless significant. We conclude that the binding affinity characteristics and energetics of interaction of these DNA binding molecules to the RNA conformations are significantly different and may serve as data for the development of effective structure selective RNA-based antiviral drugs.     

Molecular Determinants of PAM2 Recognition by the MLLE Domain of Poly(A)-Binding Protein

MLLE (previously known as PABC) is a peptide-binding domain that is found in poly(A)-binding protein (PABP) and EDD (E3 isolated by differential display), a HECT E3 ubiquitin ligase also known as HYD (hyperplastic discs tumor suppressor) or UBR5. The MLLE domain from PABP recruits various regulatory proteins and translation factors to poly(A) mRNAs through binding of a conserved 12 amino acid peptide motif called PAM2 (for PABP-interacting motif 2). Here, we determined crystal structures of the MLLE domain from PABP alone and in complex with PAM2 peptides from PABP-interacting protein 2. The structures provide a detailed view of hydrophobic determinants of the MLLE binding coded by PAM2 positions 3, 5, 7, 10, and 12 and reveal novel intermolecular polar contacts. In particular, the side chain of the invariant MLLE residue K580 forms hydrogen bonds with the backbone of PAM2 residues 5 and 7. The structures also show that peptide residues outside of the conserved PAM2 motif contribute to binding. Altogether, the structures provide a significant advance in understanding the molecular basis for the binding of PABP by PAM2-containing proteins involved in translational control, mRNA deadenylation, and other cellular processes.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Effects of binding three lysine-rich H1-type histones to DNA and poly(dG-dC)

The degree of distortion of the B-form of DNA induced by the binding of the lysine-rich H1 histones is a function of the arginine content of the protein. Lysine-rich H1 histones do not induce the formation of the Z-form of poly(dG-dC) but, when they are bound to this polynucleotide in the B-form, the transition to the Z-form induced by Tb³⁺ is faster.     

Molecular recognition of nucleic acids: coralyne binds strongly to poly(A)

The small molecule coralyne was found to bind preferentially and strongly to single-stranded poly(A) with an apparent association constant (Ka) of (1.8+/-0.3) x 10(6)M(-1). Binding of coralyne to poly(A) is predominantly enthalpically driven with a stoichiometry of one coralyne per four adenine bases. Poly(A) forms a coralyne dependent secondary structure with a melting temperature of 60 degrees C, for the conditions of our study.     

The primer specificity of cytoplasmic poly(A) polymerase from cryptobiotic gastrulae of Artemia salina

Poly(A) polymerase has been purified to near homogeneity from the cytoplasm of Artemia salina as described previously (Roggen, E and Slegers, H. (1985) Eur. J. Biochem. 147, 225–232). Affinity chromatography on poly(A)-Sepharose 4B separates the enzyme preparation into two fractions. In standard assay conditions poly(A) polymerase fraction I (poly(A)-Sepharose 4B unbound) and fraction II (poly(A)-Sepharose 4B bound) have specific activities of 2.4 and 8.0 μmol AMP/h per mg enzyme, respectively. Poly(A) polymerase fraction II shows a high primer specificity towards the 17 S poly(A)-containing mRNP. Depending on the reaction conditions used, poly(A) sequences of 140 ± 15 AMP residues/μg enzyme are synthesized on the latter primer. In contrast, poly(A) polymerase fraction I only elongates oligo(A) primers efficiently. An endogenous RNA is detected in poly(A) polymerase II preparations. This RNA has a length of 83 ± 2 nucleotides and is a component of a 60 kDa particle. After removal of the latter the specificity of poly(A) polymerase fraction II for the 17 S poly(A)-containing mRNP is abolished and the characteristics of the enzyme resemble those of poly(A) polymerase I.     

Molecular basis of recognition of quadruplexes human telomere and c-myc promoter by the putative anticancer agent sanguinarine

Background

Interaction of putative anticancer agent sanguinarine with two quadruplex forming sequences, human telomeric DNA (H24) and NHE III₁ upstream of the P1 promoter of c-myc (Pu27), has been studied to understand the structural basis of the recognition.

Methods

Absorption, fluorescence and circular dichroism spectroscopy have been employed to characterize the association. Energetics of the interaction was studied by isothermal titration and differential scanning calorimetry. TRAP assay was done to assess the inhibitory potential of sanguinarine.

Results

Absorption and fluorescence studies show that sanguinarine has high binding affinity of ~ 10⁵ M^− 1 for both sequences. Binding stoichiometry is 2:1 for H24 and 3:1 for Pu27. Results suggest stacking interaction between planar sanguinarine moiety and G-quartets. Circular dichroism spectra show that sanguinarine does not cause structural perturbation in the all-parallel Pu27 but causes a structural transition from mixed hybrid to basket form at higher sanguinarine concentration in case of H24. The interaction is characterized by total enthalpy–entropy compensation and high heat capacity values. Differential scanning calorimetry studies suggest that sanguinarine binding increases the melting temperature and also the total enthalpy of transition of both quadruplexes. TRAP results show that sanguinarine effectively blocks telomerase activity in a concentration dependent manner in cell extracts from MDAMB-231 breast cancer cell lines.

Conclusion

These results suggest that there is a difference in the structural modes of association of sanguinarine to the quadruplexes.

General significance

It helps to understand the role of quadruplex structures as a target of small molecule inhibitors of telomerase.     

The roles of cytoplasmic poly(A)-binding proteins in regulating gene expression: a developmental perspective.

Poly(A)-binding proteins (PABPs) are central to the regulation of messenger RNA (mRNA) translation and stability; however, the roles and contributions of different PABP family members in controlling gene expression are not yet fully understood. In this paper, the current state of knowledge of the different cytoplasmic PABP proteins and their function in animal cells will be summarised, with particular reference to their roles in development. Possible regulatory mechanisms and potential new roles for these proteins in the control of specific mRNAs are also highlighted.     

Contributions of Zn(II)-binding to the structural stability of endostatin

Endostatin has a compact structure with a Zn(II)-binding site (His1, His3, His11, and Asp76) at the N-terminus. In this study, the effects of Zn(II)-binding on the folding and stability of recombinant human endostatin were studied. The results show that Zn(II)-binding largely stabilizes the structure of endostatin at physiological pH. Under some proteolytic conditions, Zn(II)-binding also contributes to the integrity of the N-terminus of endostatin, which is critical for endostatin to maintain a stable structure. Moreover, engineering an extra Zn(II)-binding peptide to the N-terminus of human endostatin makes this molecule more stable and cooperative in the presence of Zn(II).     

A Link between Hinge-Bending Domain Motions and the Temperature Dependence of Catalysis in 3-Isopropylmalate Dehydrogenase

Enzyme function depends on specific conformational motions. We show that the temperature dependence of enzyme kinetic parameters can provide insight into these functionally relevant motions. While investigating the catalytic properties of IPMDH from Escherichia coli, we found that its catalytic efficiency (k_cat/K_M,IPM) for the substrate IPM has an unusual temperature dependence, showing a local minimum at ∼35°C. In search of an explanation, we measured the individual constants k_cat and K_M,IPM as a function of temperature, and found that the van 't Hoff plot of K_M,IPM shows sigmoid-like transition in the 20-40°C temperature range. By means of various measurements including hydrogen-deuterium exchange and fluorescence resonance energy transfer, we showed that the conformational fluctuations, including hinge-bending domain motions increase more steeply with temperatures >30°C. The thermodynamic parameters of ligand binding determined by isothermal titration calorimetry as a function of temperature were found to be strongly correlated to the conformational fluctuations of the enzyme. Because the binding of IPM is associated with a hinge-bending domain closure, the more intense hinge-bending fluctuations at higher temperatures increasingly interfere with IPM binding, thereby abruptly increasing its dissociation constant and leading to the observed unusual temperature dependence of the catalytic efficiency.     

Entamoeba histolytica: cloning and expression of the poly(A) polymerase EhPAP

In eukaryotes, polyadenylation of pre-mRNA 3' end is essential for mRNA export, stability, and translation. Here we identified and cloned a gene codifying for a putative nuclear poly(A) polymerase (EhPAP) in Entamoeba histolytica. Protein sequence alignments with eukaryotic PAPs showed that EhPAP has the RNA-binding region and the PAP central domain with the catalytic nucleotidyl transferase domain described for other nuclear PAPs. Recombinant EhPAP expressed in bacteria was used to generate specific antibodies, which recognized two EhPAP isoforms of 60 and 63kDa in nuclear and cytoplasmic extracts by Western blot assays. RT-PCR assays showed that EhPap mRNA expression varies in multidrug-resistant trophozoites growing in different emetine concentrations. Moreover, EhPap mRNA expression is about 10- and 7-fold increased in G1 and S phase, respectively, through cell cycle progression. These results suggest the existence of a link between EhPAP expression and MDR and cell cycle regulation, respectively.     

Interaction of Alzheimer's A beta peptide with an engineered binding protein--thermodynamics and kinetics of coupled folding-binding

The oligomerization and aggregation of the amyloid-β (Aβ) peptide, a cleavage product of the amyloid precursor protein predominantly 40 or 42 amino acids in length, has been implicated in the pathogenesis of Alzheimer's disease. The identification of Aβ-binding agents, e.g., antibodies or peptides, constitutes a promising therapeutic approach. However, the amount of structural and biophysical data on the underlying Aβ interactions is currently very limited. We have earlier determined the structure of Aβ(1-40) in complex with the affibody protein Z_Aβ3, a selected binding protein based on a three-helix bundle scaffold (Z domain). Z_Aβ3 is a dimer of affibody subunits linked via a disulfide bridge involving a selected cysteine mutation at position 28. Z_Aβ3 binds to the central and C-terminal part of Aβ (residues 17-36), which adopts a β-hairpin conformation in the complex. Here we present a detailed biophysical analysis of the Z_Aβ3:Aβ(1-40) interaction, employing NMR, circular dichroism spectroscopy, 8-anilino-1-naphthalenesulfonic acid and tyrosine fluorescence, size-exclusion chromatography, thermal denaturation profiles and isothermal titration calorimetry. We conclude that (i) free Z_Aβ3 is characterized by conformational exchange and the loss of helix 1 of the three-helix bundle scaffold; (ii) a high-energy barrier is associated with the conversion of an initial Z_Aβ3:Aβ(1-40) recognition complex into the native complex structure, entailing slow binding kinetics; (iii) both Aβ and Z_Aβ3 fold upon binding, which, e.g., becomes manifest in the binding thermodynamics that feature a large negative change in heat capacity; (iv) the C28-disulfide does not merely afford dimerization, but its impact on the binding interfaces of the affibody subunits and Aβ is a prerequisite for tight binding. The extensive folding coupled to binding observed here likely constitutes an obligate feature of biomolecular interactions involving the central and C-terminal part of Aβ. Options for improvement of Z_Aβ binding proteins are discussed.     

Thermodynamic and solution state NMR characterization of the binding of secondary and conjugated bile acids to STARD5

STARD5 is a member of the STARD4 sub-family of START domain containing proteins specialized in the non-vesicular transport of lipids and sterols. We recently reported that STARD5 binds primary bile acids. Herein, we report on the biophysical and structural characterization of the binding of secondary and conjugated bile acids by STARD5 at physiological concentrations. We found that the absence of the 7α-OH group and its epimerization increase the affinity of secondary bile acids for STARD5. According to NMR titration and molecular modeling, the affinity depends mainly on the number and positions of the steroid ring hydroxyl groups and to a lesser extent on the presence or type of bile acid side-chain conjugation. Primary and secondary bile acids have different binding modes and display different positioning within the STARD5 binding pocket. The relative STARD5 affinity for the different bile acids studied is: DCA > LCA > CDCA > GDCA > TDCA > CA > UDCA. TCA and GCA do not bind significantly to STARD5. The impact of the ligand chemical structure on the thermodynamics of binding is discussed. The discovery of these new ligands suggests that STARD5 is involved in the cellular response elicited by bile acids and offers many entry points to decipher its physiological role.