Isolation and characterization of a cDNA encoding a serine proteinase from the root-knot nematode Meloidogyne incognita

This report describes the first serine proteinase gene isolated from the sedentary nematode Meloidogyne incognita. Using degenerate primers, a 1372bp cDNA encoding a chymotrypsin-like serine proteinase (Mi-ser1) was amplified from total RNA of adult females by RT-PCR and 5' and 3' rapid amplification of cDNA ends. The deduced amino acid sequence of Mi-ser1 encoded a putative signal peptide and a prodomain of 22 and 33 amino acids, respectively, and a mature proteinase of 341 amino acids with a predicted molecular mass of 37,680Da. Sequence identity with the top serine proteinases matches from the databases ranged from 23 to 27%, including sequences from insects, mammals, and other nematodes. Southern blot analysis suggested that Mi-ser1 is encoded by a single or few gene copies. The pattern of developmental expression analyzed by Northern blot and RT-PCR indicated that Mi-ser1 was transcribed mainly in females. The domain architecture composed of a single chymotrypsin-like catalytic domain and the detection of a putative signal peptide suggested a digestive role for Mi-ser1.     

Isolation and characterization of a cDNA from flowers of Cynara cardunculus encoding cyprosin (an aspartic proteinase) and its use to study the organ-specific expression of cyprosin

Poly(A)⁺ RNA isolated from flower buds of Cynara cardunculus has been used to prepare a cDNA library. Screening of the cDNA after expression of cloned DNA with antibodies raised against the large subunit of cyprosin 3 resulted in the isolation of six positive clones. One of these clones (cypro1s; a 1.7 kb Eco RI fragment) codes for cyprosin. The nucleotide sequence contain a 1419 bp open reading frame coding for 473 amino acids (aa) including a putative full-length mature protein (440 aa) and a partial prosequence (33 aa). Cypro1s contains a 162 bp 3 non-coding region followed by a poly(A) tail. The deduced amino acid sequence shows high homology to other plant aspartic proteinases. The homology to mammalian and microbial aspartic proteinases is somewhat lower. Plant aspartic proteinases contain an insert of around 100 aa. We are modelling where this plant-specific insert will appear in the structure of cyprosin. Using cypro1s as a probe in northern blot analysis, the expression of cyprosin in developing flowers and other tissues has been studied. The signal on the northern blot increased for RNA samples from early (flower buds 6 mm in length) to later stages of floral development (flower buds up to 40 mm in length). In late stages of floral development (open flowers 50 mm in length and styles from such flowers) no hybridization signal was visualized showing that the synthesis of mRNA encoding the cyprosin starts in early stages of floral development and switches off at maturation of the flower. Southern blot analysis of genomic DNA showed 4–5 strong hybridizing bands and several minor bands indicating that the cyprosin genes are organized as a multi-gene family in C. cardunculus.     

Pepsin-like aspartic protease (Sc-ASP155) cloning,molecular characterization and gene expression analysis in developmental stages of nematode Steinernema carpocapsae

Steinernema carpocapsae is an insect parasitic nematode associated with the bacterium Xenorhabdus nematophila. These symbiotic complexes are virulent against the insect host. Many protease genes were shown previously to be induced during parasitism, including one predicted to encode an aspartic protease, which was cloned and analyzed in this study. A cDNA encoding Sc-ASP155 was cloned based on the EST fragment. The full-length cDNA of Sc-ASP155 consists of 955 nucleotides with multiple domains, including a signal peptide (aa1–15), a pro-peptide region (aa16–45), and a typical catalytic aspartic domain (aa71–230). The putative 230 amino acid residues have a calculated molecular mass of 23,812 Da and a theoretical pI of 5.01. Sc-ASP155 blastp analysis showed 40–62% amino acid sequence identity to aspartic proteases from parasitic and free-living nematodes. Expression analysis showed that the sc-asp155 gene was up-regulated during the initial parasitic stage, especially in L3 gut and 6 h induced nematodes. Sequence comparison revealed that Sc-ASP155 was a member of an aspartic protease family and phylogenetic analysis indicated that Sc-ASP155 was clustered with Sc-ASP113. In situ hybridization showed that sc-asp155 was expressed in subventral cells. Additionally, we determined that sc-asp155 is a single-copy gene in S. carpocapsae. Homology modeling showed that Sc-ASP155 adopts a typical aspartic protease structure. The up-regulated Sc-ASP155 expression revealed that this protease could play a role in the parasitic process. In this study, we have cloned the gene and determined the expression of the pepsin-like aspartic protease Sc-ASP155 in S. carpocapsae.     

Characterization and identification of the integrin family in silkworm, Bombyx mori

As an important economic insect, Bombyx mori is also a useful model organism for lepidopteran insect. Integrins are evolutionarily conserved from sponges to humans, and play vital roles in many physiological and pathological processes. To explore their diverse functions of integrins in insect, eleven integrins including six α and five β subunits were cloned and characterized from silkworm. Our results showed that integrins from silkworm own more family members compared to other invertebrates. Among those α subunits, integrins α1, α2, and the other four subunits belong to PS1, PS2, and PS3 groups, respectively. The β subunits mainly gather in the insect βν group except the β1 subunit which belongs to the insect β group. Expression profiles demonstrated that the integrins exhibited distinct patterns, but were mainly expressed in hemocytes. α1 and β2 subunits are the predominant ones either in the embryogenesis or larva stages. Interestingly, integrins were significantly up-regulated after stimulated by 20-hydroxyecdysone (20-E) in vivo. These results indicate that integrins perform diverse functions in hemocytes of silkworm. Overall, our results provide a new insight into the functional and evolutionary features of integrins.     

Eimeria tenella: cloning of a novel Eimeria tenella cDNA encoding a protein related to rhomboid family from F2 hybrid strain

A novel cDNA sequence with an open reading frame of 774 bp from Eimeria tenella F2 hybrid strain (ETRH01) was isolated from a lambda cDNA library with a monoclonal antibody against sporozoite. Analysis of the genomic sequence suggests that this is an intronless gene. The deduced protein sequence has 257 amino acids with a calculated molecular weight of 28.349 kDa and an isoelectric point of 8.56. Sequence analysis revealed seven transmembrane domains and a rhomboid domain within the protein. RT-PCR result indicates that this gene was expressed in all of the five E. tenella isolates analyzed. To further study the role of this novel gene in the life cycle of E. tenella, ETRH01 was successfully expressed using pET28b(+) expression system.     

Molecular cloning and catalytic characterization of a recombinant tropine biosynthetic tropinone reductase from Withania coagulans leaf

Tropinone reductases (TRs) are small proteins belonging to the SDR (short chain dehydrogenase/reductase) family of enzymes. TR-I and TR-II catalyze the conversion of tropinone into tropane alcohols (tropine and pseudotropine, respectively). The steps are intermediary enroute to biosynthesis of tropane esters of medicinal importance, hyoscyamine/scopolamine, and calystegins, respectively. Biosynthesis of tropane alkaloids has been proposed to occur in roots. However, in the present report, a tropine forming tropinone reductase (TR-I) cDNA was isolated from the aerial tissue (leaf) of a medicinal plant, Withania coagulans. The ORF was deduced to encode a polypeptide of 29.34 kDa. The complete cDNA (WcTRI) was expressed in E. coli and the recombinant His-tagged protein was purified for functional characterization. The enzyme had a narrow pH range of substantial activity with maxima at 6.6. Relatively superior thermostability of the enzyme (30% retention of activity at 60 °C) was catalytic novelty in consonance with the desert area restricted habitat of the plant. The in vitro reaction kinetics predominantly favoured the forward reaction. The enzyme had wide substrate specificity but did not cover the substrates of other well-known plant SDR related to menthol metabolism. To our knowledge, this pertains to be the first report on any gene and enzyme of secondary metabolism from the commercially and medicinally important vegetable rennet species.     

cDNA cloning,expression, and enzymatic activity of a novel endogenous cellulase from the beetle Batocera horsfieldi

In this study, we report a novel cellulase [β-1,4-endoglucanase (EGase), EC 3.2.1.4] cDNA (Bh-EGase II) belonging to the glycoside hydrolase family (GHF) 45 from the beetle Batocera horsfieldi. The Bh-EGase II gene spans 720 bp and consists of a single exon coding for 239 amino acid residues. Bh-EGase II showed 93.72% protein sequence identity to Ag-EGase II from the beetle Apriona germari. The GHF 45 catalytic site is conserved in Bh-EGase II. Bh-EGase II has three putative N-glycosylation sites at 56–58 (N–K–S), 99–101 (N–S–T), and 237–239 (N–Y–S), respectively. The cDNA encoding Bh-EGase II was expressed in baculovirus-infected insect BmN cells and Bombyx mori larvae. Recombinant Bh-EGase II from BmN cells and larval hemolymph had an enzymatic activity of approximately 928 U/mg. The enzymatic catalysis of recombinant Bh-EGase II showed the highest activity at 50 °C and pH 6.0.     

Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.