Representation of cloned genomic sequences in two sequencing vectors: correlation of DNA sequence and subclone distribution.

Representation of subcloned Caenorhabditis elegans and human DNA sequences in both M13 and pUC sequencing vectors was determined in the context of large scale genomic sequencing. In many cases, regions of subclone under-representation correlated with the occurrence of repeat sequences, and in some cases the under-representation was orientation specific. Factors which affected subclone representation included the nature and complexity of the repeat sequence, as well as the length of the repeat region. In some but not all cases, notable differences between the M13 and pUC subclone distributions existed. However, in all regions lacking one type of subclone (either M13 or pUC), an alternate subclone was identified in at least one orientation. This suggests that complementary use of M13 and pUC subclones would provide the most comprehensive subclone coverage of a given genomic sequence.     

Characterization of a gene encoding a 115 K super T antigen expressed by a SV40-transformed rat cell line.

It has been reported that SV40-transformed V 11 F 1 clone 1 subclone 7 rat cells (subclone 7) produce a super T antigen of 115,000 M. This super T antigen is entirely SV40 coded and is synthesized by translation of an elongated form of SV40 early mRNA (May, E., Kress, M. Daya-Grosjean, L., Monier, R. and May, P. (1981) J. Virol., 37, 24-35). The results reported here show that there is only one independent insertion of viral DNA in the cellular genome of subclone 7 cells. When DNA from subclone 7 cells was cleaved with Bam HI endonuclease two distinct SV40 sequence containing fragments were generated with sizes of 5 Kb and 10 Kb, respectively. Two recombinant cosmids were constructed by insertion of the 5 Kb and 10 Kb fragments, respectively, into cosmid pHC 79. Using restriction map analysis and nucleotide sequencing, we showed that the 5 Kb fragment actually contained the complete sequence of a gene encoding super T antigen. As compared to the normal SV40 early gene, the sequence of super T gene showed the following rearrangements: (i) The segment between nucleotides 4116 - 3544 was duplicated in a direct order and (ii) these two copies of 573 nucleotide sequence were separated by a 93 nucleotide tract which was a nearly perfect inverted repeat of the segment located between nucleotides 4868 and 4776 (nucleotide numbering used here = Weissmann number +17).     

Characterization of a chloroplast DNA sequence from Chlorella ellipsoidea that promotes autonomous replication in yeast

Summary An EcoRI 2.7 kbp fragment from Chlorella ellipsoidea chloroplast DNA (cpDNA) cloned in YIp5 was shown to promote autonomous replication in Saccharomyces cerevisiae. The fragment was localized in the small single copy region close to the inverted repeat. The ARS activity (autonomously replicating sequences in yeast) was found to be confined within a subclone of a ca. 300 bp HindIII fragment. Sequence analysis of this fragment revealed its high AT content and the presence of several direct and inverted repeats and a few elements that were related to the yeast ARS consensus sequence. Electron microscopic studies revealed that this sequence did not coincide with the primary replication origin of chloroplast DNA. The functioning of this sequence as a possible origin of plasmid replication in vivo is discussed. This is the first report on Chlorella cpDNA sequence. re]19850821 rv]19851211 ac]19851216     

The Molecular through Ecological Genetics of Abnormal Abdomen. II. Ribosomal DNA Polymorphism Is Associated with the Abnormal Abdomen Syndrome in DROSOPHILA MERCATORUM

Restriction endonuclease cleavage analyses of cloned and genomic DNA samples indicate that the structure of the DNA encoding the large cytoplasmic RNAs (rDNAs) is altered in Drosophila mercatorum lines which exhibit an abnormal abdomen (aa) phenotype. In a majority of the rDNA repeat units from aa flies, the 28S coding sequence is interrupted by a large [5-6 kilobase pairs (kbp)] insert. A subclone containing this inserted DNA (ins 3) hybridizes primarily to rDNA-containing sequences in in situ and genomic blot hybridization experiments. Additionally, genomic nitrocellulose blot hybridization analyses show that ins- containing rDNA repeat units are clustered in a spontaneously arising aa mutant. This rDNA alteration in D. mercatorum flies with the aa phenotype more closely resembles the bobbed (bb) defect of D. hydei than the bb defect of D. melanogaster, which involves alterations in rDNA copy number. By analogy with the other Drosophila systems, we propose that the altered D. mercatorum rDNA repeat units are defective in rRNA production at a critical stage. The lowered levels of rRNA ultimately would limit the concentration of ribosomes needed to produce large quantities of a protein (in these cases, juvenile hormone esterase) needed for normal development.     

The making of strand-specific M13 probes

A novel approach has been developed for the preparation of highly radioactive, strand-specific M13 probes. A universal primer, complementary to the region 5' to the multiple cloning sites of M13mp7, was used to initiate the DNA synthesis of the complementary strand of the M13 sequence downstream from the inserted sequence. The synthesis of the (?) strand, which was labeled with a radioactively labeled precursor, did not proceed to completion so that the inserted sequence was kept single-stranded. Thus, a partially double-stranded probe that had the specificity of this inserted sequence was obtained. As an example for the application of single-stranded specific hybridization probes, an M13mp7 subclone of a zein cDNA clone of maize (A30) was labeled and used in a dot hybridization test to select from the hundreds of M13mp7 subclones of the zein genomic clone, 24, the sequences complementary to the probe. The specificity of the probe was confirmed by dideoxy chain terminator sequencing experiments.     

Evolution of a long-range repeat family in Chromosome 1 of the genus Mus

Copy numbers and variation of a clustered long-range repeat family on Chromosome (Chr) 1 have been studied in different species of the genus Mus. The repeat sequence was present in all, as inferred from cross-hybridization with probes derived from the Mus musculus repeat family. Copy numbers determined by dot blot hybridization were very low, from three to six per haploid genome in M. caroli, M. cervicolor, and M. cookii. These species form one branch of the phylogenetic tree in the genus Mus. In the other group of phylogenetically related species—M. spicilegus, M. spretus, M. musculus and M. macedonicus—copy numbers ranged from 6 to 1810 per haploid genome. The repeat cluster is cytogenetically visible as a fine C-band in M. macedonicus and as a C-band positive homogeneously staining region (HSR) in several populations of M. m. domesticus and M. m. musculus. When cytogenetically visible, the clusters contained from 179 to 1810 repeats. Intragenomic restriction fragment length polymorphisms (RFLPs), which reflect sequence variation among different copies of the long-range repeat family, increased with higher copy numbers. The high similarity of the RFLP pattern among genomes with C-band positive regions in Chr 1 of M. m. musculus, M. m. domesticus, and M. macedonicus points to a close evolutionary relationship of their Chr 1 repeat families.     

Nucleotide sequence of the respiratory D-lactate dehydrogenase gene of Escherichia coli

The structural gene for the respiratory D-lactate dehydrogenase of Escherichia coli, a membrane-bound flavoenzyme, has been subcloned from a 7 X 10(3)-base-pair chromosomal HindIII fragment containing the gene [Young, I. G., Jaworowski, A., and Poulis, M. (1982) Biochemistry 21, 2092-2095]. The complete nucleotide sequence of the 2340-base-pair PstI-SmaI subclone has been determined on both strands by the dideoxy chain termination method. A single large open reading frame is present in the nucleotide sequence. The reading frame is preceded by a good ribosome binding site and numerous possible promoter sequences, and is followed by a typical rho-independent termination sequence. The reading frame predicts that the D-lactate dehydrogenase polypeptide consists of 571 amino acids (including the initiating methionine residue) with Mr = 64613. The protein does not have a low overall polarity, nor does it contain unusually hydrophobic stretches. It appears to contain a short repeat which is homologous with the well characterized L-lactate dehydrogenases in the vicinity of the 'essential' cysteine residue. Apart from this, homology with other proteins of known sequence has not been detected.     

Biological and biochemical characterization of an SV40-transformed xeroderma pigmentosum cell line

We have isolated a subclone of the SV40-transformed xeroderma pigmentosum (XP) cell line SV40XP12RO. The cell line, designated M1, is highly sensitive to ultraviolet light and is deficient in unscheduled DNA synthesis. The isoenzyme, HLA profile and karyotype of the cell line is presented. The structure and function of the resident SV40 genome is analysed. The M1 clone contains a complete copy of the SV40 genome flanked by partial SV40-DNA copies in a head-to-tail arrangement. The large T-antigen is defective in the ability to induce SV40-DNA replication. The M1 subclone is an efficient recipient of DNA in transfection experiments. Transfection of these cells with the pSV₂gpt plasmid shows that the M1 subclone is as efficient as the NIH 3T3 cell line in uptake and expression of foreign DNA. This cell line should be suitable for genetic analysis of the xeroderma pigmentosum defect. It should also be useful for the study of gene expression in human cells.     

A novel transposon-like repeat interrupted by an LTR element occurs in a cluster of B1 repeats in the mouse c-mos locus.

The mouse genomic locus containing the oncogene c-mos was analyzed for repetitive DNA sequences. We found a single B1 repeat 10 kb upstream and three B1 repeats 0.6 kb, 2.7 kb, and 5.4 kb, respectively, downstream from c-mos. The B1 repeat closest to c-mos contains an internal 7-bp duplication and a 18-bp insertion. Localized between the last two B1 repeats is a copy of a novel mouse repeat. Sequence comparison of three copies of this novel repeat family shows that they a) contain a conserved BglII site, b) are approximately 420 bp long, c) possess internal 50-bp polypurine tracts, and d) have structural characteristics of transposable elements. They are present in about 1500 copies per haploid genome in the mouse, but are not detectable in DNA of other mammals. The BglII repeat downstream from c-mos is interrupted by a single 632-bp LTR element. We estimate that approximately 1200 copies of this element are present per haploid genome in BALB/c mice. It shares sequence homology in the R-U5 region with an LTR element found in 129/J mice.     

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.     

Plasmidal maintenance of composite DNA derived from polyoma related plasmid, L factor.

Recently, we reported a multicopy mammalian plasmid with a structure related to polyoma. The plasmid, named L factor, was found at a high copy number (5,000 or more per cell) in a subclone derived from mouse L cells. We attempted to utilize L factor as a plasmid vector for mammalian cells. A series of composite DNA consisting of L factor and a foreign (herpes simplex virus tk) were constructed. These DNA could be established as plasmids after transfection to several mouse cell lines, although the copy number of the re-established plasmids was considerably less than that observed for the original subclone. The composite DNA maintained the structure of the original DNA after prolonged culture and the copy number remained constant even with no selective pressure. A composite DNA, with no DNA sequence corresponding to polyoma T antigen, could also be established as a plasmid in a mouse L cell line in which polyoma T antigen is expressed. The potential use of the plasmid is discussed.     

Sequence variation in two ipaH genes of Shigella flexneri 5 and homology to the LRG-like family of proteins

Oligonucleotide primers derived from the ipaH7.8 sequence have been used to determine the boundaries of DNA sequence homology among five ipaH genes on the invasion plasmid (pWR100) of Shigella flexneri 5, strain M9OT-W. The primary structure of IpaH4.5 has been established from DNA sequence analysis. The first 197 amino acids in IpaH7.8 were replaced in IpaH4.5 by a unique set of 251 amino acids, generating two related proteins with variable and conserved sequences. The amino-terminal region of IpaH4.5 displayed an internal repeat structure, also seen in IpaH7.8, characteristic of members of the leucine-rich glycoprotein (LRG) family. The DNA sequences of ipaH2.5 and ipaH1.4 indicate that these genes are truncated versions of ipaH7.8. Western blot analysis of a lambda gt11 ipaH recombinant (W7) subclone demonstrated that the antigenicity of IpaH7.8 resides outside the leucine-rich repetitive region.     

Molecular analysis of a polymorphic domain of alpha satellite from the human X chromosome.

Alpha satellite DNA, a diverse family of tandemly repeated DNA sequences located at the centromeric region of each human chromosome, is organized in a highly chromosome-specific manner and is characterized by a high frequency of restriction-fragment-length polymorphism. To examine events underlying the formation and spread of these polymorphisms within a tandem array, we have cloned and sequenced a representative copy of a polymorphic array from the X chromosome and compared this polymorphic copy with the predominant higher-order repeat form of X-linked alpha satellite. Sequence data indicate that the polymorphism arose by a single base mutation that created a new restriction site (for HindIII) in the sequence of the predominant repeat unit. This variant repeat unit, marked by the new HindIII site, was subsequently amplified in copy number to create a polymorphic domain consisting of approximately 500 copies of the variant repeat unit within the X-linked array of alpha satellite. We propose that a series of intrachromosomal recombination events between misaligned tandem arrays, involving multiple rounds of either unequal crossing-over or sequence conversion, facilitated the spread and fixation of this variant HindIII repeat unit.     

Mutation mechanisms that underlie turnover of a human telomere-adjacent segmental duplication containing an unstable minisatellite

Subterminal regions, juxtaposed to telomeres on human chromosomes, contain a high density of segmental duplications, but relatively little is known about the evolutionary processes that underlie sequence turnover in these regions. We have characterized a segmental duplication adjacent to the Xp/Yp telomere, each copy containing a hypervariable array of the DXYS14 minisatellite. Both DXYS14 repeat arrays mutate at a high rate (0.3 and 0.2% per gamete) but linkage disequilibrium analysis across 27 SNPs and a direct crossover assay show that recombination during meiosis is suppressed. Therefore instability at DXYS14a and b is dominated by intra-allelic processes or possibly conversion limited to the repeat arrays. Furthermore some chromosomes (14%) carry only one copy of the duplicon, including one DXYS14 repeat array that is also highly mutable (1.2% per gamete). To explain these and other observations, we propose there is another low-rate mutation process that causes copy number change in part or all of the duplicon.     

Misdivision analysis of centromere structure in maize.

The size and organization of a representative plant centromere from the supernumerary B chromosome were determined using a repeated sequence specific to the centric region. Several derivatives of the B chromosome that suffered from misdivision of the centromere were analyzed for the content and organization of their B repeat. In all these derivatives, major rearrangements were detected. Some misdivisions produced a significant reduction in size of the B-specific cluster. These results demonstrate that the B repeat is part of the functional centromere, that it is spread throughout its length, and that plant centromeres are composed of repeat units that can be significantly changed in copy number without a change in function.