Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.     

Complete DNA sequence coding for the large ribosomal RNA of yeast mitochondria.

The mitochondrial gene coding for the large ribosomal RNA (21S) has been isolated from a rho- clone of Saccharomyces cerevisiae. A DNA segment of about 5500 base pairs has been sequenced which included the totality of the sequence coding for the mature ribosomal RNA and the intron. The mature RNA sequence corresponds to a length of 3273 nucleotides. Despite the very low guanine-cytosine content (20.5%), many stretches of sequence are homologous to the corresponding Escherichia coli 23S ribosomal RNA. The sequence can be folded into a secondary structure according to the general models for prokaryotic and eukaryotic large ribosomal RNAs. Like the E.coli gene, the mitochondrial gene contains the sequences that look like the eukaryotic 5.8S and the chloroplastic 4.5S ribosomal RNAs. The 5' and 3' end regions show a complementarity over fourteen nucleotides.     

Genetics of mitochondrial ribosomes of yeast: mitochondrial lethality of a double mutant carrying two mutations of the 21S ribosomal RNA gene

Summary Among the mitochondrial conditional mutations localized in the gene coding for the 21S ribosomal RNA, one — ts 902 — produces severely reduced amounts of 21S RNA and 50S subunit. We investigated its physiological properties and found that this thermosensitive mutation was associated with highly pleiotropic effects. The mutant phenotype is associated with cell death in certain conditions, and with a massive accumulation of rho^- mutants at non-permissive temperature. Furthermore, interactions with the sites of action of erythromycin and chloramphenicol, both localized within the 21S rRNA, were detected. The mutant is hypersensitive to erythromycin and has a cis-incompatibility with the chloramphenicol-resistant mutation C ₃₂₁ ^R .Ts 902 thus appears to have a dual effect, not only at the ribosomal level but also at a cellular level.     

Erythromycin and spiramycin resistance mutations of yeast mitochondria: nature of the rib2 locus in the large ribosomal RNA gene.

Two linked genetic loci, rib 2 and rib 3, of yeast mitochondrial genome are the sites of mutations that confer resistance to erythromycin and/or spiramycin. We have examined two mutations at the rib 2 locus. Mutation ER354 was found at the nucleotide position 3993 of the large ribosomal RNA gene; it corresponded to a C to G transversion leading to a double resistance to erythromycin and spiramycin. Mutation SR551 was found also at the same position, but the C was replaced by a T, conferring resistance to spiramycin only. Rib 2 and rib 3 are 836 base pairs apart on the gene sequence, but are very close to each other in the secondary structure of ribosomal RNA.     

Thiostrepton resistance mutations in the gene for 23S ribosomal RNA of halobacteria

Mutants of Halobacterium (H.) halobium and H. cutirubrum were isolated which are resistant to the 70S ribosome inhibitor thiostrepton. Using primer extension analysis, resistance was shown to correlate with base changes at position 1159, which corresponds to position 1067 of the E. coli 23S rRNA. In four mutants, A1159 was replaced by U, in one mutant by G. The results show that not only methylation (Cundliffe & Thompson (1979) Nature 278, 859-861) of A1067 (E. coli nomenclature), but also base changes at this position cause high-level resistance to thiostrepton.     

Regulation of mitochondrial ribosomal RNA synthesis in yeast

Summary Studies were undertaken to determine if mitochondrial rRNA synthesis in yeast is regulated by general cellular stringent control mechanism. Those variables affecting the relaxation of a cycloheximide-induced stringent response as a result of medium-shift-down or tyrosine limitation include: 1) the stage of cell growth, 2) carbon source, 3) strain differences and, 4) integrity of the cell wall. The extent of phenotypic relaxation decreased or was eliminated entirely in a strain dependent manner as cells entered stationary phase of growth or by growth of cells on galactose or in osmotically stabilized spheroplast cultures.Cytoplasmic and mitochondrial RNA species were extracted from regrowing spheroplast cultures subjected to different experimental regimens and analyzed by electrophoresis on 2.5% polyacrylamide gels. Relative rates of synthesis were determined in pulse experiments and normalized by double-label procedures to longterm label material. Tyrosine starvation was found to inhibit synthesis of the large and small rRNA species of both cytoplasmic and mitochondrial rRNAs to about 5–20% of the control values. Chloramphenicol inhibits mitochondrial and cytoplasmic rRNA synthesis to 60–80% of control; however, chloramphenicol addition does not relax the stringent inhibition of either class of rRNAs. Cycloheximide addition results in 70–80% inhibition of synthesis of both cellular species of rRNAs. As noted above, cycloheximide does not relax the stringent response of cytoplasmic rRNA synthesis in spheroplasts, and also does not relax the stringent inhibition of mitochondrial rRNA synthesis. From these studies, we conclude that both cytoplasmic and mitochondrial rRNA synthesis share common control mechanisms related to regulation of protein synthesis by shift-down or amino acid limitation.     

Identification of a single base change in ribosomal RNA leading to erythromycin resistance.

The molecular basis of a mutation conferring an erythromycin-resistance phenotype was explored, as an approach to the role of 23 S rRNA in the peptidyl-transferase activity of 50 S ribosomal subunits. Mutagenization of an Escherichia coli strain, which carried the multicopy plasmid pLC7-21 containing the rrnH operon, led to the production of an erythromycin-resistant strain. Plasmid pBFL1 isolated from this mutant was able to transform the sensitive RecA- strain EM4 and to induce a "dissociated" type of antibiotic resistance. Two ribosome populations occurred in EM4/pBFL1: normal particles coded for by the seven rrn chromosomal genes and mutated particles containing rRNA of plasmid origin. The latter particles displayed in vitro lower affinity and susceptibility to erythromycin than wild type particles. The mutation within plasmid pBFL1 was mapped by a multiple primer extension technique. Three synthetic primers were used to sequence the central loop in domain V of 23 S rRNA, leading to identification of a C to U transition at position 2611. This base change was proved to be responsible for the erythromycin-resistance phenotype by the plasmid-plasmid marker rescue technique. A molecular explanation for the rrn mutations leading, respectively, to undissociated and to dissociated types of resistance to the MLSb (macrolide-lincosamide-synergimycin B) group of antibiotics is proposed. These results and some literature data support the notion that rRNA bases involved in antibiotic resistance play a conformational role in the ribosomal binding sites for the MLSb antibiotics.     

Inserted sequence in the mitochondrial 23S ribosomal RNA gene of the yeast Saccharomyces cerevisiae.

Summary The sequence organization of the yeast mit-DNA region carrying the large ribosomal RNA gene and the polar locus was examined. Hybridization studies using rho^- deletion mutants and electron microscopy of the heteroduplexes formed between 23S rRNA and the appropriate restriction fragments, lead to the conclusion that the 23S rRNA¹ gene of the ⁺ strains is split by an insertion sequence of 1,000–1,100 bp. In contrast, no detactable insertion was found in the 23S rRNA gene of the ^- strains. The size and the location of the insert found in the 23S rRNA gene of the ⁺ strains appear to be identical to those of the sequence which had previously been found to characterize the difference (at the locus) between the mitDNA of the wild type strains carrying the ⁺ or ^- alleles (Jacq et al., 1977).     

Self-splicing of yeast mitochondrial ribosomal and messenger RNA precursors

We have previously shown linear and circular splicing intermediates resembling intermediates that result from self-splicing of ribosomal precursor RNA of Tetrahymena to be present in mitochondrial RNA. Here we show that splicing of yeast mitochondrial precursor RNA also occurs in vitro in the absence of mitochondrial proteins. The large ribosomal RNA gene, consisting of the intron and part of the flanking exon regions, was inserted behind the SP6 promoter in a recombinant plasmid and was transcribed in vitro. The resulting RNA shows self-catalyzed splicing via incorporation of GTP at the 5'-end of the excised intron, 5'- to 3'-exon ligation, and intron circularization. When purified mitochondrial RNA is incubated under similar conditions with alpha-32P-GTP, the excised ribosomal intron RNA is also labeled, as well as several other RNA species. Some of these RNAs are derived from excised introns from the multiply split gene coding for cytochrome oxidase subunit I.     

Identification of the yeast nuclear gene for the mitochondrial homologue of bacterial ribosomal protein L16.

An open reading frame encoding a member of the L16 family of ribosomal proteins is adjacent to the URA7 gene on the left arm of chromosome II in Saccharomyces cerevisiae. The predicted L16-like polypeptide is basic (pl 11.12), contains 232 amino acids (26.52 kDa) and has 36% amino acid sequence identity to E. coli L16. Immunoblot analysis with polyclonal antibodies to the L16-like polypeptide showed specific cross-reaction with a 22,000 Mr mitochondrial polypeptide that co-sediments with the large subunit of the mitochondrial ribosome in sucrose density gradients. The levels of the L16 mRNA and protein varied in response to carbon source. In [rho degree] cells lacking mitochondrial rRNA, the L16 mRNA accumulated at normal levels, but the protein was barely detectable, indicating RNA-dependent accumulation of the L16 protein. Gene disruption experiments demonstrated that the yeast mitochondrial L16 is an essential ribosomal protein in vivo.     

Physical map of Aspergillus nidulans mitochondrial genes coding for ribosomal RNA: an intervening sequence in the large rRNA cistron

Summary A detailed map of the 32 kb mitochondrial genome of Aspergillus nidulans has been obtained by locating the cleavage sites for restriction endonucleases Pst I, Bam H I, Hha I, Pvu II, Hpa II and Hae III relative to the previously determined sites for Eco R I, Hind II and Hind III. The genes for the small and large ribosomal subunit RNAs were mapped by gel transfer hybridization of in vitro labelled rRNA to restriction fragments of mitochondrial DNA and its cloned Eco R I fragment E3, and by electron microscopy of RNA/DNA hybrids.The gene for the large rRNA (2.9 kb) is interrupted by a 1.8 kb insert, and the main segment of this gene (2.4 kb) is separated from the small rRNA gene (1.4 kb) by a spacer sequence of 2.8 kb length.This rRNA gene organization is very similar to that of the two-times larger mitochondrial genome of Neurospora crassa, except that in A. nidulans the spacer and intervening sequences are considerably shorter.     

New antibiotic resistance Loci in the ribosomal region of yeast mitochondrial DNA

A large number of mitochondrial antibiotic-resistant mutants have been isolated following mutagenesis with manganese. These include several different phenotypic classes of mutants, as distinguished by cross-resistance patterns, that have been found to be allelic at cap1 or ery1; some have been found to be heteroallelic.--Seven chloramphenicol-resistant mutants have been identified that are nonallelic by recombination tests with the three loci (cap1, spi1 and ery1) previously identified in the ribosomal region. Four of these are allelic with each other and define a new locus, cap3; two others are allelic and define another new locus, cap2; the seventh maps at yet a different locus, cap4. One new spiramycin-resistant mutant has been identified that defines still another new locus, spi2. A variety of genetic techniques have been used to map these loci within the ribosomal region of the mitochondrial genome.-Manganese has been shown to be effective in inducing the mutation from omega(-) to omega(n) in many mutants that experience a simultaneous mutation at the closely linked cap1 locus. The omega(n) mutation has also been described in the cap4 mutant, and this locus has been shown to be more closely linked to omega than cap1 is to omega.     

MSW, a yeast gene coding for mitochondrial tryptophanyl-tRNA synthetase

E569 and E606 are noncomplementing pet mutants of Saccharomyces cerevisiae. Both strains are defective in mitochondrial protein synthesis and as a result exhibit a pleiotropic deficiency in respiratory components that are translated on mitochondrial ribosomes. The wild type gene MSW capable of complementing the protein synthesis defect has been cloned by transformation of one of the mutants with a genomic library of wild type yeast nuclear DNA. The cloned gene has been sequenced and shown to code for a protein with a molecular weight of 42,414 which is 37 and 39% identical to the tryptophanyl-tRNA synthetases of Escherichia coli and Bacillus stearothermophilus, respectively. A strain containing an insertion in the chromosomal copy of MSW was constructed by in situ gene replacement. This mutant fails to charge mitochondrial tryptophanyl-tRNA providing further evidence that MSW is the structural gene for mitochondrial tryptophanyl tRNA synthetase. The existence of another gene coding for the cytoplasmic tryptophanyl-tRNA synthetase is inferred from the observation that mutations in MSW are not lethal but only result in a respiratory deficiency.