Plant small nuclear RNAs. V. U4 RNA is present in broad bean plants in the form of sequence variants and is base-paired with U6 RNA.

U4 RNA, which is known to play an indispensable role in pre-mRNA splicing, is present in plant nuclei, has a canonical m3 2,2,7 G cap at its 5' end and is associated with U6 RNA in snRNP particles. It occurs in broad bean in the form of a number of sequence variants. Two of these were sequenced: U4A RNA is 154 and U4B RNA is 152 nucleotides long. Sequence similarity of broad bean U4B RNA is 94 per cent to broad bean U4A RNA, 65 per cent to rat U4A RNA, 61 per cent to Drosophila U4A RNA and 50 per cent to snR14, the U4 RNA equivalent of the yeast Saccharomyces cerevisiae. Sequence conservation is much more pronounced in the 5' half of the molecule than in its 3' half. The secondary structure of both variants of broad bean U4 RNA perfectly fits with that of all other U4 RNAs sequenced so far. Nucleotide changes between broad bean U4A and U4B RNAs are restricted to molecular regions that affect the thermodynamic stability of these molecules. A model is proposed for the base pairing interaction of broad bean U4 RNA with broad bean U6 RNA. This is the first report on the structure of a plant U4 RNA.     

Plant small nuclear RNAs. Nucleolar U3 snRNA is present in plants: partial characterization

Nuclei, isolated from a number of plant species by either of two independent, newly developed methods, regularly contained a common set of low-molecular-mass RNAs. Partial characterization of these RNAs, based on cell fractionation, polyacrylamide gel electrophoretic and chemical sequencing techniques, as well as comparison with literature data, revealed that, in addition to tRNA, 5S RNA and 5.8S RNA, plant nuclei contain two families of low-molecular-mass RNAs, that are counterparts of vertebrate U1 and U5 RNAs respectively, and three individual low-molecular-mass RNA species. One of these may be related to vertebrate U6 RNA. The two others are true eukaryotic U2 and U3 RNAs, respectively, on the basis of the following lines of evidence obtained from analyses of broad bean nuclear RNAs. The 3'-end portion (121 nucleotides sequenced) of broad bean U2 RNA shows a nearly perfect sequence homology with that of authentic pea U2 RNA. Broad bean U3 RNA is localized in the nucleolus and its 3'-end portion (164 nucleotides sequenced) (a) shows sequence homology with that of both rat U3 RNA (48%) and Dictyostelium D2 RNA (39%), (b) has a secondary structure which fits perfectly that proposed for both rat U3 RNA and Dictyostelium D2 RNA, and (c) contains the specific sequence which, in a model based on the primary structure of rat U3 RNA, is supposed to be involved in the processing of eukaryotic 32S pre-ribosomal RNA. This is the first report on the occurrence in plants of nucleolar U3 RNA.     

A new moderately repetitive rat DNA sequence detected by a cloned 4.5 SI DNA

4.5 SI RNA is an abundant, noncapped, small nuclear RNA found in rodent cells. The 4.5 SI RNA is 98 or 99 nucleotides long and contains no modified nucleotides; it is synthesized by RNA polymerase III, is partly hydrogen-bonded to poly(A+) hnRNA, and was the first small nuclear RNA to be purified and sequenced (Busch, H., Reddy, R., Ruthblum, L., and Choi, Y. C. (1982) Annu. Rev. Biochem. 51, 617-654). In studies on the structure and organization of genes coding for this abundant RNA, it was found that this RNA is homologous to an apparently novel family of repetitive sequences. Two clones were characterized; one clone showed that its sequence is identical to the RNA in the first 92 residues and differed only in the last six nucleotides. In addition, the 3'-end of the sequence contained an A,T-rich region, and the sequence was flanked by a 15-nucleotide long direct repeat of AAAATATAGACACTG. The second clone characterized contained nucleotide sequences 1-57 corresponding to the RNA and was flanked by a 15-nucleotide long direct repeat. The structural features of these two DNAs are consistent with RNA-mediated DNA synthesis and integration of this DNA into the genome at random sites. It is estimated that there are about 10,000 copies of this family of sequences in the haploid rat genome.     

Small RNA molecules related to the Alu family of repetitive DNA sequences.

A rodent 4.5S RNA molecule with extensive homology to the Alu family of interspersed repetitive DNA sequences has been found physically associated with polyadenylated nuclear and cytoplasmic RNAs (W. Jelinek and L. Leinwand, Cell 15:205-214, 1978; S. Haynes et al., Mol. Cell. Biol. 1:573-583, 1981). In this report, we describe a 4.5S RNA molecule in rat cells whose RNase fingerprints are identical to those of the equivalent mouse molecule. We show that the rat 4.5S RNA is part of a small family of RNA molecules, all sharing sequence homology to the Alu family of DNA sequences. These RNAs are synthesized by RNA polymerase III and are developmentally regulated and short-lived in the cytoplasm. Of this family of small RNAs, only the 4.5S RNA is found associated with polyadenylated RNA.     

Isolation from rat liver and sequence of a RNA fragment containing 32 nucleotides from position 5 to 36 from the 3'' end of ribosomal 18S RNA.

Crude tRNA isolated from rat liver by the method of Rogg et al. (Biochem. Biophys. Acta 195, 13-15 1969) contains N6-dimethyladenosine (m6-2A) and was therefore fractionated in order to identify the m6-2A-containing RNAs. A unique species of RNA was purified which contained all the m62A present in the crude tRNA. Sequence analysis by postlabeling with gamma-32p-ATP and polynucleotide kinase revealed that this RNA represents the 32 nucleotides AAGGUUUC(C)U GUAGGUGm62Am62ACCUGCGGAAGGAUC from position 5 to 36 of the 3' terminus of ribosomal 18S RNA. The 36 nucleotide long sequence from the 3' end of rat liver 18S rRNA exhibits extensive homology with the corresponding sequence of E. coli 16S rRNA and with the 21 nucleotide long 3' terminal sequence so far known from Saccharomyces carlsbergensis 17S rRNA. A heterogeneity in this sequence provides the first evidence on the molecular level for the existence of (at least) two sets of redundant ribosomal 18S RNA genes in the rat.     

Sequence determination of rat U5 RNA using a chemical modification procedure for counteracting sequence compression

Using post-labeling techniques, the nucleotide sequence of a major species of U5 RNA isolated from rat liver was determined to be: XpppAmUmACUCUGGUUUCUCUUCAGAUCGUAUAAAUCUUUCGmCCUUmUpsiACmNAAAGAUpsiUCCGUGGAGAGGA ACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGA(G)CAAGGCUOH. The 5'-end of the RNA is blocked with a cap structure. In addition to the modified nucleotides around the 5'-end (XpppAmUmA), U5 RNA contains Gm at position 38, Um at position 42, psi at position 44, Cm at position 46, N at position 47, and psi at position 54 as modified nucleotides. U5 RNA is present as a mixture of several species with microheterogeneity, whose lengths are 117, 118, or 119 nucleotides. The major species, with 117 nucleotides, comprised approximately 60% of the total U5 RNA. A region near the 3'-end forms a stable second structure, which causes sequence compression on electrophoresis in polyacrylamide gel. To surmount with this obstacle, we developed a chemical modification procedure with sodium bisulfite prior to partial hydrolysis in formamide, which allows denaturation of the secondary structure in polyacrylamide gel containing 7 M urea. The procedure provides a good system for checking RNA sequences determined by electrophoresis in polyacrylamide gel which might have apparent deletions on account of sequence compression.     

Nonrandom integration of human U4 RNA pseudogenes.

Four loci for human U4 RNA have been characterized by DNA sequence analysis. The results show that all four loci represent pseudogenes, which are flanked by direct repeats. Three of the pseudogenes, designated U4/5, U4/6, and U4/8, have very similar structures; they are all truncated and contain the first 67 to 68 nucleotides of the U4 RNA sequence. Their properties suggest that they were created by integration of truncated cDNA copies of the U4 RNA into new chromosomal sites. An interesting observation was that their flanking regions exhibit sequence homology. A purine-rich 5'-flanking sequence 12 to 13 nucleotides long is almost perfectly conserved in all three loci. Boxes of homology were also found on the 3' side when the U4/6 and U4/8 loci were compared. The U4/4 locus has a slightly different structure; the pseudogene matches the first 79 nucleotides of U4 RNA, but contains a greater number of mutations than the other pseudogenes. Taken together, the results suggest that a frequently occurring type of pseudogene for human U4 was created by a RNA-mediated mechanism and that the integration sites have features in common.     

A novel variety of 4.5 S RNA from Codium fragile chloroplasts

An unusual new chloroplast RNA has been isolated and sequenced in the siphonous green alga, Codium fragile. This RNA is 94 nucleotides in length, has an unusually high A + U content (73%), contains no modified residues, and is as abundant as a single chloroplast tRNA species. Although this RNA is 4.5 S in size, it bears little sequence homology to the widely found and highly conserved 4.5 S RNAs present in the chloroplasts of higher plants. Nevertheless, this RNA may indeed by analogous to the higher plant 4.5 S RNAs, since the Codium 4.5 S RNA has the potential to form a secondary structure which in many respects is remarkably similar to that of known chloroplast 4.5 S RNAs, and hybridization data strongly suggests that the 4.5 S RNA is part of the ribosomal RNA operon, as is the case in higher plant chloroplasts.     

Sequence of a new tRNA(Leu)(U*AA) from brewer's yeast.

The nucleotide sequence of a new tRNA(Leu)(anticodon U*AA) from Saccharomyces cerevisiae which could recognize exclusively the UUA codon has been determined. Its primary structure is: pGGAGGGUUGm2GCac4CGAGDGmGDCDAAGGCm2(2)GGCAGACmUU*AAm1GA++ + psi CUGUUGGACGGUUGUCCGm5CGCGAGT psi CGm1A(orA)ACCUCGCAUCCUUCACCA. This tRNA has a large extraloop and contains 15 modified nucleotides. So far it is the third isoacceptor tRNA for leucine in yeast. It has 61% homology with tRNA(Leu)(anticodon m5CAA) and 63% homology with tRNA(Leu)(anticodon UAG), the two other known yeast tRNAs(Leu).     

Pseudouridine modification of U5 RNA in ribonucleoprotein particles assembled in vitro.

The formation of pseudouridine (psi) in U5 RNA during ribonucleoprotein (RNP) assembly was investigated by using HeLa cell extracts. In vitro transcribed, unmodified U5 RNA assembled into an RNP particle with the same buoyant density and sedimentation velocity as did U5 small nuclear RNP from extracts. The greatest amount of psi modification was detected when a combination of S100 and nuclear extracts was used for assembly. psi formation was inhibited when ATP and creatine phosphate or MgCl2 were not included in the assembly reaction, paralleling the inhibition of RNP particle formation. A time course of assembly and psi formation showed that psi modification lags behind RNP assembly and that at very early time points, Sm-reactive U5 small nuclear RNPs are not modified. Two of three psi modifications normally found in U5 RNA were present in RNA incubated in the extracts. Mutations in the form of deletions and truncations were made in the U5 sequence, and the effect of these mutations on psi formation was investigated. A mutation in the area of stem-loop I which contains the psi moieties or in the Sm binding sequence affected psi formation.     

U2 RNA from yeast is unexpectedly large and contains homology to vertebrate U4, U5, and U6 small nuclear RNAs

I have determined the structure of the gene from Saccharomyces cerevisiae coding for the yeast homolog of vertebrate U2 snRNA. Surprisingly, the RNA is 1175 nucleotides long, six times larger than U2 RNAs from other organisms, including Schizosaccharomyces pombe. Nearly 100 nucleotides of the large RNA share sequence homology and potential secondary structure with metazoan U2. The large RNA also contains homology to vertebrate U4, U5, and U6 snRNAs, implying a "poly-snRNP" structure for the RNP containing the large RNA. The gene LSR1, encoding the large RNA, is essential for growth, suggesting that the yeast spliceosome can be dissected using genetic approaches. The different organization of spliceosomal RNA may underlie differences in splicing between yeast and metazoans.