A repeat complex in the mitochondrial control region of Adélie penguins from Antarctica.

We have determined the nucleotide sequence of the entire mitochondrial control region (CR) of the Adélie penguin (Pygoscelis adeliae) from Antarctica. Like in most other birds, this CR region is flanked by the gene nad6 and transfer (t)RNA trnE(uuc) at the 5' end and the gene rns and trnF(gaa) at the 3' end. Sequence analysis shows that the Adelie penguin CR contains many elements in common with other CRs including the termination associated sequences (TAS), conserved F, E, D, and C boxes, the conserved sequence block (CSB)-1, as well as the putative light and heavy strand promoters sites (LSP-HSP). We report an extraordinarily long avian control region (1758 bp) which can be attributed to the presence, at the 3' peripheral domain, of five 81-bp repeat sequences, each containing a putative LSP-HSP, followed by 30 tetranucleotide microsatellite repeat sequences consisting of (dC-dA-dA-dA)30. The microsatellite and the 81-bp repeat reside in an area known to be transcribed in other species.     

Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes

Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.     

Initiation and termination of DNA transfer during conjugation of IncI1 plasmid R64: roles of two sets of inverted repeat sequences within oriT in termination of R64 transfer

Intercellular transfer of plasmid DNA during bacterial conjugation initiates and terminates at a specific origin of transfer, oriT. We have investigated the oriT structure of conjugative plasmid R64 with regard to the initiation and termination of DNA transfer. Using recombinant plasmids containing two tandemly repeated R64 oriT sequences with or without mutations, the subregions required for initiation and termination were determined by examining conjugation-mediated deletion between the repeated oriTs. The oriT subregion required for initiation was found to be identical to the 44-bp oriT core sequence consisting of two units, the conserved nick region sequence and the 17-bp repeat A sequence, that are recognized by R64 relaxosome proteins NikB and NikA, respectively. In contrast, the nick region sequence and two sets of inverted repeat sequences within the 92-bp minimal oriT sequence were required for efficient termination. Mutant repeat A sequences lacking NikA-binding ability were found to be sufficient for termination, suggesting that the inverted repeat structures are involved in the termination process. A duplication of the DNA segment between the repeated oriTs was also found after mobilization of the plasmid carrying initiation-deficient but termination-proficient oriT and initiation-proficient but termination-deficient oriT, suggesting that the 3' terminus of the transferred strand is elongated by rolling-circle-DNA synthesis.     

Molecular structure of canine LINE-1 elements in canine transmissible venereal tumor

We determined the 4251-bp sequence of open reading frame 2 (ORF2) of canine LINE-1 retroposon that encodes 1275 amino acids. The truncated LINE-1 inserts associated with transmissible venereal tumor (TVT) of dogs contained the 1378-bp LINE-1 insert (TVT-LINE) flanked by 10-bp direct repeats upstream to c-myc gene. The TVT-LINE elements were composed of 416 bp inverse sequences homologous to the complementary strand of the LINE-1, a 5-bp deletion and 962-bp sequences homologous to the 3' region of the LINE-1.     

Cloning and characterization of Leishmania donovani telomeres

We describe here the cloning and sequence characterization of the absolute termini of several telomeres from the human parasite Leishmania donovani using a vector-adapter protocol. The 3' protruding strand of L. donovani telomeres terminates with the sequence 5'-GGTTAGGGT-OH 3'. This single-stranded sequence is adjacent to tandemly repeated blocks of double-stranded sequence consisting of variable numbers of the hexameric repeat 5'-TAGGGT-3', variable numbers of an octameric repeat 5'-TGGTCATG-3', and a single 62-bp sequence, in that order. A number of additional, more chromosome-internal, nonrepeated sequences were found adjacent to the telomere sequences. Hybridization analyses indicated that some of these telomere adjacent sequences are found on all L. donovani chromosomes, some are more abundant on certain subsets of chromosomes, and some are unique to individual chromosomes.     

Template-directed arrest of mammalian mitochondrial DNA synthesis.

Mammalian mitochondrial DNA often contains a short DNA displacement loop at the heavy-strand origin of replication. This short nascent DNA molecule has been used to study site-specific termination of mitochondrial DNA synthesis in human and mouse cells. We examined D-loop strand termination in two distantly related artiodactyls, the pig and the cow. Porcine mitochondrial DNA was unique among mammals in that it contained only a single species of D-loop single-stranded DNA. Its 3' end mapped to a site 187 nucleotides from the 5' end of the proline tRNA gene. This site was 21 and 47 nucleotides 5' to two very similar sequences (5' ACATATPyATTAT 3') which are closely related to the human and mouse termination-associated sequences noted by Doda et al. (J. N. Doda, D. T. Wright, and D. A. Clayton, Proc. Nat. Acad. Sci. USA 78:616-6120, 1981). Bovine mitochondrial DNA contained three major D-loop DNA species whose 3' ends mapped to three different sites. These sites were not found in the porcine sequence. However, the bovine termination sites were located 60 to 64 base pairs 5' from sequences which were also very similar to the termination-associated sequences present in pigs and other mammals. These results firmly establish the concept that arrest of heavy-strand DNA synthesis is an event determined, at least in part, by template sequence. They also suggest that arrest is determined by sequences which are a considerable physical distance away from the actual termination site.     

DNA binding specificity of the bovine papillomavirus E1 protein is determined by sequences contained within an 18-base-pair inverted repeat element at the origin of replication.

Bovine papillomavirus type 1 (BPV-1) DNA replicates episomally and requires two virally expressed proteins, E1 and E2, for this process. Both proteins bind to the BPV-1 genome in the region that functions as the origin of replication. The binding sequences for the E2 protein have been characterized previously, but little is known about critical sequence requirements for E1 binding. Using a bacterially expressed E1 fusion protein, we examined binding of the BPV-1 E1 protein to the origin region. E1 strongly protected a 28-bp segment of the origin (nucleotides 7932 to 15) from both DNase I and exonuclease III digestion. Additional exonuclease III protection was observed beyond the core region on both the 5' and 3' sides, suggesting that E1 interacted with more distal sequences as well. Within the 28-bp protected core, there were two overlapping imperfect inverted repeats (IR), one of 27 bp and one of 18 bp. We show that sequences within the smaller, 18-bp IR element were sufficient for specific recognition of DNA by E1 and that additional BPV-1 sequences beyond the 18-bp IR element did not significantly increase origin binding by E1 protein. While the 18-bp IR element contained sequences sufficient for specific binding by E1, E1 did not form a stable complex with just the isolated 18-bp element. Formation of a detectable E1-DNA complex required that the 18-bp IR be flanked by additional DNA sequences. Furthermore, binding of E1 to DNA containing the 18-bp IR increased as a function of overall increasing fragment length. We conclude that E1-DNA interactions outside the boundaries of the 18-bp IR are important for thermodynamic stabilization of the E1-DNA complex. However, since the flanking sequences need not be derived from BPV-1, these distal E1-DNA interactions are not sequence specific. Comparison of the 18-bp IR from BPV-1 with the corresponding region from other papillomaviruses revealed a symmetric conserved consensus sequence, T-RY--TTAA--RY-A, that may reflect the specific nucleotides critical for E1-DNA recognition.     

Nucleotide sequence analysis of cellular flanking regions of intracisternal A-particle gene 81

The cellular nucleotide sequences flanking the mouse intracisternal A-particle gene 81 were determined. The results indicated that they were made of many small oligonucleotide repeats both direct and indirect in orientation. These two different kinds of repeating sequences were often found to be overlap. The overall base composition of this region is relatively A + T rich. The most important feature of the sequences determined was that it consists of several repeated dinucleotide tracts containing a (CA)16 repeating cluster in the 5' end flanking region of one strand and another repeating dinucleotide cluster, (GT)16, in the 3' end flanking region of the same strand of this gene. In addition, the existence of two clusters of 9 continuous 5-bp repeat units, GCTTT, was found in the 3' end flanking region. The possible roles of such repeating sequence were discussed.     

Nucleotide sequence and evolution of the rat mitochondrial cytochrome b gene containing the ochre termination codon

The nucleotide sequences of the genes for cytochrome b and three potential transfer RNAs (tRNAPro, tRNAThr and tRNAGlu) in cloned rat mitochondrial DNA were determined. The derived amino acid sequence of the cytochrome b protein from the light strand indicated that the C-terminal amino acid is asparagine and the ochre termination codon is encoded in the DNA, in contrast to the the lack of termination codon in the reading frame of human [Anderson et al., Nature 290 (1981) 457] or mouse [Bibb et al., Cell 26 (1981) 167] mitochondrial DNA. The first ATG codon of the cytochrome b gene was spaced five nucleotides from the 5'-end of the tRNAGlu gene on the heavy strand. There was a single nucleotide spacing between the termination codon of the cytochrome b gene and the 5' end of the tRNAThr gene in the light strand. There was also a single nucleotide spacing between the 3'-end of the tRNAThr gene and the 3'-end of the tRNAPro gene on the heavy strand. The amino acid and nucleotide sequences of the cytochrome b genes of mammals and yeast [Nobrega and Tzagoloff, J. Biol. Chem. 255 (1980) 9828] were compared to reveal structural differences in two very different species. At the same time, amino acid substitutions in particular regions of the mammalian gene corresponding to the exon-intron boundaries in the yeast gene were noted. These genetic features are discussed in relation to the extreme compression of genetic information in the mammalian mitochondrial genome as related to the evolution of the gene organization and its sequence.