共查询到20条相似文献,搜索用时 15 毫秒
1.
Isothermal titration calorimetry (ITC) is one of the most robust label- and immobilization-free techniques used to measure protein – small molecule interactions in drug design for the simultaneous determination of the binding affinity (ΔG) and the enthalpy (ΔH), both of which are important parameters for structure-thermodynamics correlations. It is important to evaluate the precision of the method and of various ITC instrument models by performing a single well-characterized reaction. The binding between carbonic anhydrase II and acetazolamide was measured by four ITC instruments – PEAQ-ITC, iTC200, VP-ITC, and MCS-ITC and the standard deviation of ΔG and ΔH was determined. Furthermore, the limit of an approach to reduce the protein concentration was studied for a high-affinity reaction (Kd = 0.3 nM), too tight to be measured by direct (non-displacement) ITC. Chemical validation of the enthalpy measurements is discussed. 相似文献
2.
Label‐free characterization of carbonic anhydrase—novel inhibitor interactions using surface plasmon resonance,isothermal titration calorimetry and fluorescence‐based thermal shift assays
下载免费PDF全文
![点击此处可从《Journal of molecular recognition : JMR》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Tiphaine Rogez‐Florent Laetitia Duhamel Laurence Goossens Perrine Six Anne‐Sophie Drucbert Patrick Depreux Pierre‐Marie Danzé David Landy Jean‐François Goossens Catherine Foulon 《Journal of molecular recognition : JMR》2014,27(1):46-56
This work describes the development of biophysical unbiased methods to study the interactions between new designed compounds and carbonic anhydrase II (CAII) enzyme. These methods have to permit both a screening of a series of sulfonamide derivatives and the identification of a lead compound after a thorough study of the most promising molecules. Interactions data were collected using surface plasmon resonance (SPR) and thermal shift assay (TSA). In the first step, experiments were performed with bovine CAII isoform and were extended to human CAII. Isothermal titration calorimetry (ITC) experiments were also conducted to obtain thermodynamics parameters necessary for the processing of the TSA data. Results obtained with this reference methodology demonstrate the effectiveness of SPR and TSA. KD values obtained from SPR data were in perfect accordance with ITC. For TSA, despite the fact that the absolute values of KD were quite different, the same affinity scale was obtained for all compounds. The binding affinities of the analytes studied vary by more than 50 orders of magnitude; for example, the KD value determined by SPR were 6 ± 4 and 299 ± 25 nM for compounds 1 and 3, respectively. This paper discusses some of the theoretical and experimental aspects of the affinity‐based methods and evaluates the protein consumption to develop methods for the screening of further new compounds. The double interest of SPR, that is, for screening and for the quick thorough study of the interactions parameters (ka, kd, and KD), leads us to choose this methodology for the study of new potential inhibitors. Copyright © 2013 John Wiley & Sons, Ltd. 相似文献
3.
《Bioorganic & medicinal chemistry》2014,22(6):1804-1808
The role of heart-type fatty acid-binding protein (FABP3) in human physiology as an intracellular carrier of fatty acids (FAs) has been well-documented. In this study, we aimed to develop an analytical method to study real-time interaction kinetics between FABP3 immobilized on the sensor surface and unsaturated C18 FAs using surface plasmon resonance (SPR). To establish the conditions for SPR experiments, we used an FABP3-selective inhibitor 4-(2-(1-(4-bromophenyl)-5-phenyl-1H-pyrazol-3-yl)-phenoxy)-butyric acid. The affinity index thus obtained was comparable to that reported previously, further supporting the usefulness of the SPR-based approach for evaluating interactions between FABPs and hydrophobic ligands. A pseudo-first-order affinity of FABP3 to K+ petroselinate (C18:1 Δ6 cis), K+ elaidate (C18:1 Δ9 trans), and K+ oleate (C18:1 Δ9 cis) was characterized by the dissociation constant (Kd) near micromolar ranges, whereas K+ linoleate (C18:2 Δ9,12 cis/cis) and K+ α-linolenate (C18:3 Δ9,12,15 cis/cis/cis) showed a higher affinity to FABP3 with Kd around 1 × 10−6 M. Interactions between FAPB3 and C18 FAs incorporated in large unilamellar vesicles consisting of 1,2-dimyristoyl-sn-glycero-3-phosphocholine and FAs (5:1 molar ratio) were also analysed. Control DMPC liposomes without FA showed only marginal binding to FABP3 immobilized on a sensor chip while liposome-incorporated FA revealed significant responses in sensorgrams, demonstrating that the affinity of FAs to FABP3 could be evaluated by using the liposome-incorporated analytes. Significant affinity to FABP3 was observed for monounsaturated fatty acids (Kd in the range of 1 × 10−7 M). These experiments demonstrated that highly hydrophobic compounds in a liposome-incorporated form could be subjected to SPR experiments for kinetic analysis. 相似文献
4.
Although allosteric transitions of GroEL by MgATP2− have been widely studied, the initial bimolecular step of MgATP2− binding to GroEL remains unclear. Here, we studied the equilibrium and kinetics of MgATP2− binding to a variant of GroEL, in which Tyr485 was replaced by tryptophan, via isothermal titration calorimetry (ITC) and stopped-flow fluorescence spectroscopy. In the absence of K+ at 4-5 °C, the allosteric transitions and the subsequent ATP hydrolysis by GroEL are halted, and hence, the stopped-flow fluorescence kinetics induced by rapid mixing of MgATP2− and the GroEL variant solely reflected MgATP2− binding, which was well represented by bimolecular noncooperative binding with a binding rate constant, kon, of 9.14 × 104 M− 1 s− 1 and a dissociation rate constant, koff, of 14.2 s− 1, yielding a binding constant, Kb (= kon/koff), of 6.4 × 103 M− 1. We also successfully performed ITC to measure binding isotherms of MgATP2− to GroEL and obtained a Kb of 9.5 × 103 M− 1 and a binding stoichiometric number of 6.6. Kb was thus in good agreement with that obtained by stopped-flow fluorescence. In the presence of 10-50 mM KCl, the fluorescence kinetics consisted of three to four phases (the first fluorescence-increasing phase, followed by one or two exponential fluorescence-decreasing phases, and the final slow fluorescence-increasing phase), and comparison of the kinetics in the absence and presence of K+ clearly demonstrated that the first fluorescence-increasing phase corresponds to bimolecular MgATP2− binding to GroEL. The temperature dependence of the kinetics indicated that MgATP2− binding to GroEL was activation-controlled with an activation enthalpy as large as 14-16 kcal mol− 1. 相似文献
5.
Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies. 相似文献
6.
Ajish S. R. Potty Katerina Kourentzi Han Fang George W. Jackson Xing Zhang Glen B. Legge Richard C. Willson 《Biopolymers》2009,91(2):145-156
The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF165) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant kon = 4.79 ± 0.03 × 104 M?1 s?1 and a dissociation rate constant koff = 5.21 ± 0.02 × 10?4 s?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com 相似文献
7.
Proteins for therapeutic use may contain small amounts of partially misfolded monomeric precursors to postproduction aggregation. To detect these misfolded proteins in the presence of an excess of properly folded protein, fluorescent probes such as 8-anilino-1-naphthalene sulfonate (ANS) are commonly used. We investigated the possibility of using isothermal titration calorimetry (ITC) to improve the detection of this type of conformational change using hydrophobic probes. As a case study, conformational changes in human polyclonal immunoglobulin G (IgG) were monitored by measuring the enthalpies of binding of ANS using ITC. Results were compared with those using fluorescence spectroscopy. IgG heated at 63 °C was used as a model system for “damaged” IgG. Heat-treated IgG can be detected already at levels below 5% with both ITC and fluorescence. However, ITC allows a much wider molar probe-to-protein ratio to be sampled. In particular, using reverse titration experiments (allowing high probe-to-protein ratios not available to fluorescence spectroscopy), an increase in the number of binding sites with a Kd > 10 mM was observed for heat-treated IgG, reflecting subtle changes in structure. Both ITC and fluorescence spectroscopy showed low background signals for native IgG. The nature of the background signals was not clear from the fluorescence measurements. However, further analysis of the ITC background signals shows that a fraction (8%) binds ANS with a dissociation constant of approximately 0.2 mM. Measurements were also carried out at pH 4.5. Precipitation of IgG was induced by ANS at concentrations above 0.5 mM, interfering with the ITC measurements. Instead, with the nonfluorescent probes 4-amino-1-naphthalene sulfonate and 1-naphthalene sulfonate, no precipitation is observed. These probes yield differences in the enthalpies of binding to heated and nonheated IgG similar to ANS. The data illustrate that ITC with low-molecular-weight probes is a versatile tool to monitor conformational changes in proteins with a wider application potential than fluorescence measurements. 相似文献
8.
Previous isothermal titration calorimetry (ITC) and Förster resonance energy transfer studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34-bp mode that interacts with DNA in large (> 34 bp) gaps between bound proteins, reversibly bending it by 140o and thereby increasing its flexibility, and two weaker, modestly cooperative small site-size modes (10 bp and 6 bp) that are useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and we deduce that DNA in the 34-bp mode is bent around—but not wrapped on—the body of HU, in contrast to specific binding of integration host factor. Analyses of binding isotherms (8-bp, 15-bp, and 34-bp DNA) and initial binding heats (34-bp, 38-bp, and 160-bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; the most probable values of Ski on 34-bp DNA or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that the binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent DNA 34-bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6-bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. 相似文献
9.
In the presence of specific metal ions, DNA oligonucleotides containing guanine repeat sequences can adopt G-quadruplex structures. In this work, we used a combination of spectroscopic and calorimetric techniques to investigate the conformation and unfolding thermodynamics of the K+-form of five G-quadruplexes with sequences: d(G2T2G2TGTG2T2G2), G2, d(G3T2G3TGTG3T2G3), G3, their analogs where T is replaced with U, G2-U and G3-U, and r(G2U2G2UGUG2U2G2), rG2. These G-quadruplexes show CD spectra characteristic of the “chair” conformation (G2 and G2-U), or “basket” conformation (rG2); or a mixture of these two conformers (G3 and G3-U). Thermodynamic profiles show that the favorable folding of each G-quadruplex results from the typical compensation of a favorable enthalpy and unfavorable entropy contributions. G-quadruplex stability increase in the following order (in ΔG°20): rG2 (−1.3 kcal/mol) < G2 < G2-U <G3-U (chair) < G3 (chair) <G3-U (basket) < G3 (basket) (−8.6 kcal/mol), due to favorable enthalpy contribution from the stacking of G-quartets.We used ITC to determine thermodynamic binding profiles for the interaction of the minor groove ligands, netropsin and distamycin, with each G-quadruplex. Both ligands bind with high exothermic enthalpies (∼−10.8 kcal/mol), 1:1 stoichiometries, and weak affinities (∼8 × 104 M−1). The similarity of the binding thermodynamic profiles, together with the absence of induced Cotton effects, indicates a surface or outside binding mode. We speculate that the top and bottom surfaces of the G-quadruplex comprise the potential MGBL binding sites, where the ligand lies on the surface forming van der Waals interactions with the guanines of the G-quartets and loop nucleotides. 相似文献
10.
11.
Serratos IN Pérez-Hernández G Garza-Ramos G Hernández-Arana A González-Mondragón E Zubillaga RA 《Journal of molecular biology》2011,405(1):158-172
Electrostatic interactions have a central role in some biological processes, such as recognition of charged ligands by proteins. We characterized the binding energetics of yeast triosephosphate isomerase (TIM) with phosphorylated inhibitors 2-phosphoglycollate (2PG) and phosphoglycolohydroxamate (PGH). We determined the thermodynamic parameters of the binding process (Kb, ΔGb, ΔHb, ΔSb and ΔCp) with different concentrations of NaCl, using fluorimetric and calorimetric titrations in the conventional mode of ITC and a novel method, multithermal titration calorimetry (MTC), which enabled us to measure ΔCp in a single experiment. We ruled out specific interactions of Na+ and Cl- with the native enzyme and did not detect significant linked protonation effects upon the binding of inhibitors. Increasing ionic strength (I) caused Kb, ΔGb and ΔHb to become less favorable, while ΔSb became less unfavorable. From the variation of Kb with I, we determined the electrostatic contribution of TIM−2PG and TIM−PGH to ΔGb at I = 0.06 M and 25 °C to be 36% and 26%, respectively. The greater affinity of PGH for TIM is due to a more favorable ΔHb compared to 2PG (by 19-24 kJ mol-1 at 25 °C). This difference is compatible with PGH establishing up to five more hydrogen bonds with TIM. Both binding ΔCps were negative, and less negative with increasing ionic strength. ΔCps at I = 0.06 M were much more negative than predicted by surface area models. Water molecules trapped in the interface when ligands bind to protein could explain the highly negative ΔCps. Thermodynamic binding functions for TIM−2PG changed more with ionic strength than those for TIM−PGH. This greater dependence is consistent with linked, but compensated, protonation equilibriums yielding the dianionic species of 2PG that binds to TIM, process that is not required for PGH. 相似文献
12.
Tony Christopeit 《Analytical biochemistry》2009,391(1):39-22
The interactions between Ca2+ and C-reactive protein (CRP) have been characterized using a surface plasmon resonance (SPR) biosensor. The protein was immobilized on a sensor chip, and increasing concentrations of Ca2+ or phosphocholine were injected. Binding of Ca2+ induced a 10-fold higher signal than expected from the molecular weight of Ca2+. It was interpreted to result from the conformational change that occurs on binding of Ca2+. Two sites with different characteristics were distinguished: a high-affinity site with KD = 0.03 mM and a low-affinity site with KD = 5.45 mM. The pH dependencies of the two Ca2+ interactions were different and enabled the assignment of the different sites in the three-dimensional structure of CRP. There was no evidence for cooperativity in the phosphocholine interaction, which had KD = 5 μM at 10 mM Ca2+. SPR biosensors can clearly detect and quantify the binding of very small molecules or ions to immobilized proteins despite the theoretically very low signals expected on binding, provided that significant conformational changes are involved. Both the interactions and the conformational changes can be characterized. The data have important implications for the understanding of the function of CRP and suggest that Ca2+ is an efficient regulator under physiological conditions. 相似文献
13.
We have investigated the thermodynamic parameters and binding of a regulatory subunit of cAMP-dependent protein kinase (PKA) to its natural low-molecular-weight ligand, cAMP, and analogues thereof. For analysis of this model system, we compared side-by-side isothermal titration calorimetry (ITC) with surface plasmon resonance (SPR). Both ITC and SPR analyses revealed that binding of the protein to cAMP or its analogues was enthalpically driven and characterised by similar free energy values (DeltaG=-9.4 to -10.7 kcal mol-1) for all interactions. Despite the similar affinities, binding of the cyclic nucleotides used here was characterised by significant differences in the contribution of entropy (-TDeltaS) and enthalpy (DeltaH) to DeltaG. The comparison of ITC and SPR data for one cAMP analogue further revealed deviations caused by the method. These equilibrium parameters could be complemented by thermodynamic data of the transition state (DeltaHnot equal, DeltaGnot equal, DeltaSnot equal) for both association and dissociation measured by SPR. This direct comparison of ITC and SPR highlights method-specific advantages and drawbacks for thermodynamic analyses of protein/ligand interactions. 相似文献
14.
Natural anthraquinone compounds have emerged as potent anticancer chemotherapeutic agents because of their promising DNA‐binding properties. Aloe vera is among one of the very well‐known medicinal plants, and the anthraquinone derivatives like aloe emodin (ALM), aloins (ALN), and aloe emodin‐8‐glucoside (ALMG) are known to have immense biological activities. Here, we have used biophysical methods to elucidate the comparative DNA‐binding abilities of these three molecules. Steady‐state fluorescence study indicated complexation between calf thymus DNA (ctDNA) and both the molecules ALM and ALMG whereas ALN showed very weak interaction with DNA. Displacement assays with ctDNA‐bound intercalator (ethidium bromide) and a groove binder (Hoechst 33258) indicated preferential binding of both ALM and ALMG to minor groove of DNA. Isothermal titration calorimetric (ITC) data suggested spontaneous exothermic single binding mode of both the molecules: ALM and ALMG. Entropy is the most important factor which contributed to the standard molar Gibbs energy associated with relatively small favorable enthalpic contribution. The equilibrium constants of binding to ctDNA were (6.02 ± 0.10) × 104 M?1 and (4.90 ± 0.11) × 104 M?1 at 298.15 K, for ALM and ALMG, respectively. The enthalpy vs temperature plot yielded negative standard molar heat capacity value, and a strong negative correlation between enthalpy and entropy terms was observed which indicates the enthalpy entropy compensation behavior in both systems. All these thermodynamic phenomena indicate that hydrophobic force is the key factor which is involved in the binding process. Moreover, the enhancement of thermal stability of DNA helix by ALM and ALMG fully agreed to the complexation of these molecules with DNA. 相似文献
15.
Claudia Rangel‐Barajas Maninder Malik Michelle Taylor Kim A. Neve Robert H. Mach Robert R. Luedtke 《Journal of neurochemistry》2014,131(4):418-431
LS‐3‐134 is a substituted N‐phenylpiperazine derivative that has been reported to exhibit: (i) high‐affinity binding (Ki value 0.2 nM) at human D3 dopamine receptors, (ii) > 100‐fold D3 versus D2 dopamine receptor subtype binding selectivity, and (iii) low‐affinity binding (Ki > 5000 nM) at sigma 1 and sigma 2 receptors. Based upon a forskolin‐dependent activation of the adenylyl cyclase inhibition assay, LS‐3‐134 is a weak partial agonist at both D2 and D3 dopamine receptor subtypes (29% and 35% of full agonist activity, respectively). In this study, [3H]‐labeled LS‐3‐134 was prepared and evaluated to further characterize its use as a D3 dopamine receptor selective radioligand. Kinetic and equilibrium radioligand binding studies were performed. This radioligand rapidly reaches equilibrium (10–15 min at 37°C) and binds with high affinity to both human (Kd = 0.06 ± 0.01 nM) and rat (Kd = 0.2 ± 0.02 nM) D3 receptors expressed in HEK293 cells. Direct and competitive radioligand binding studies using rat caudate and nucleus accumbens tissue indicate that [3H]LS‐3‐134 selectively binds a homogeneous population of binding sites with a dopamine D3 receptor pharmacological profile. Based upon these studies, we propose that [3H]LS‐3‐134 represents a novel D3 dopamine receptor selective radioligand that can be used for studying the expression and regulation of the D3 dopamine receptor subtype. 相似文献
16.
Aaron P. Yamniuk John A. Newitt Michael L. Doyle Fumio Arisaka Anthony M. Giannetti Preston Hensley David G. Myszka Fred P. Schwarz James A. Thomson Edward Eisenstein 《Journal of biomolecular techniques》2015,26(4):125-141
A significant challenge in the molecular interaction field is to accurately determine the stoichiometry and stepwise binding affinity constants for macromolecules having >1 binding site. The mission of the Molecular Interactions Research Group (MIRG) of the Association of Biomolecular Resource Facilities (ABRF) is to show how biophysical technologies are used to quantitatively characterize molecular interactions, and to educate the ABRF members and scientific community on the utility and limitations of core technologies [such as biosensor, microcalorimetry, or analytic ultracentrifugation (AUC)]. In the present work, the MIRG has developed a robust model protein interaction pair consisting of a bivalent variant of the Bacillus amyloliquefaciens extracellular RNase barnase and a variant of its natural monovalent intracellular inhibitor protein barstar. It is demonstrated that this system can serve as a benchmarking tool for the quantitative analysis of 2-site protein-protein interactions. The protein interaction pair enables determination of precise binding constants for the barstar protein binding to 2 distinct sites on the bivalent barnase binding partner (termed binase), where the 2 binding sites were engineered to possess affinities that differed by 2 orders of magnitude. Multiple MIRG laboratories characterized the interaction using isothermal titration calorimetry (ITC), AUC, and surface plasmon resonance (SPR) methods to evaluate the feasibility of the system as a benchmarking model. Although general agreement was seen for the binding constants measured using solution-based ITC and AUC approaches, weaker affinity was seen for surface-based method SPR, with protein immobilization likely affecting affinity. An analysis of the results from multiple MIRG laboratories suggests that the bivalent barnase-barstar system is a suitable model for benchmarking new approaches for the quantitative characterization of complex biomolecular interactions. 相似文献
17.
Scanning electrochemical microscopy (SECM) combined with surface plasmon resonance (SPR), SECM-SPR, was applied for real-time detection of the incorporation of Cu(2+) by apo-metallothionein (apo-MT) immobilized on the SPR substrate and release of Cu(2+) from surface-confined metallothionein (MT). Cu(2+) anodically stripped from a Cu-coated SECM Au tip was sequestered by apo-MT upon its diffusion to the SPR substrate, and release of Cu(2+) by MT was accomplished by generating protons via oxidation of hydroquinone at the tip. The high sensitivity of the SPR instrument is capable of following the structural and compositional changes of MT molecules during the metal sequestration and release processes. Due to the enhanced mass transfer rate at the SECM tip, the complication of mass transfer limitation on kinetic measurements, commonly encountered in flow injection SPR, is circumvented. The time-resolved SPR response reveals stepwise changes among three stable MT structures and allows the number of copper ions coordinated in each structure to be determined. The numbers of copper ions incorporated by each MT molecule in the three structures were determined to be 5, 9, and 12. This work expands the SECM-SPR approach to assessments of the dynamics and affinity of binding of small ions to surface-confined proteins and to studies of proteins that do not undergo facile electron transfer reactions. 相似文献
18.
Yasuo Inoshima Masayuki Oda Takahiro Maruno Yuji Kobayashi Naotaka Ishiguro 《Protein science : a publication of the Protein Society》2014,23(8):1050-1059
We previously generated a monoclonal antibody (mAb), G2, by immunizing mice with Residues 174–247 of the chicken prion protein (ChPrPC). In this study, we found that G2 possessed an extremely unusual characteristic for a mAb; in particular, it could react with at least three proteins other than ChPrPC, the original antigenic protein. We immunoscreened a complementary DNA library from chicken brain DNA and found three proteins (SEPT3, ATP6V1C1, and C6H10orf76) that reacts with G2. There were no regions of amino acid sequence similarity between ChPrPC and SEPT3, ATP6V1C1, or C6H10orf76. We selected ATP6V1C1 as a representative of the three proteins and identified the epitope within ATP6V1C1 that reacts with G2. The amino acid sequence of the G2 epitope within ATP6V1C1 (Pep8) was not related to the G2 epitope within ChPrPC (Pep18mer). However, enzyme-linked immunosorbent assay, surface plasmon resonance (SPR), and isothermal titration calorimetry (ITC) experiments indicated that these two peptides have similar binding affinity for G2. The apparent KD values of Pep18mer and Pep8 obtained from SPR experiments were 2.9 × 10−8 and 1.6 × 10−8
M, respectively. Antibody inhibition test using each peptide indicated that the binding sites of the two different peptides overlapped each other. We observed that these two peptides substantially differed in several binding characteristics. Based on the SPR experiments, the association and dissociation rate constants of Pep18mer were higher than those of Pep8. A clear difference was also observed in ITC experiments. These differences may be explained by G2 adopting different binding conformations and undergoing different binding pathways. 相似文献
19.
Investigation of the enzymatic activity of the Na,K-ATPase via isothermal titration microcalorimetry
Isothermal titration microcalorimetry (ITC) is shown here to be a sensitive and accurate method for assaying the steady-state enzyme activity of the Na+,K+-ATPase. Single ATP injection experiments yield an apparent enthalpy change for the ATP hydrolysis reaction catalyzed by the enzyme of −51 (± 1) kJ mol−1. This value is independent of the amount of ADP accumulated in the sample cell, which indicates that under the experimental conditions studied here (saturating Na+ and K+ concentrations) ADP does not inhibit enzyme activity by reversal of the phosphorylation reaction and resynthesizing ATP. Multiple ATP injection titration experiments in which varying concentrations of ADP were initially included in the sample cell could be adequately explained by a Michaelis-Menten kinetic model incorporating noncompetitive inhibition. This suggests that ADP inhibits the enzyme by binding to more than one enzyme intermediate and inhibiting forward reactions of the enzyme. Values of Km and KI obtained for the fits agree with literature values obtained by other methods. Because ITC is a direct method of continually monitoring enzyme activity, it is a valuable supplement to less direct or noncontinuous methods such as colorimetric, enzyme-coupled or radioactivity-based assays. 相似文献
20.
A novel and convenient immunosensor, based on the electrostatic adsorption characteristics between the positively charged
MnO2 nanoparticles (nano-MnO2) and chitosan (CS) composite membrane (nano-MnO2 + CS) and the negatively charged prussian blue (PB), was prepared for the detection of carcinoembryonic antigen (CEA). Firstly,
PB was electro-deposited on the surface of the gold electrode in the constant potential, and then nano-MnO2 + CS was adsorbed onto PB-modified electrode surface. Subsequently, Gold nanoparticles (nano-Au) were electro-deposited on
the nano-MnO2 + CS-modified electrode to immobilize antibody CEA (anti-CEA). Finally, bovine serum albumin (BSA) was employed to block
sites against nonspecific binding. In our study, cyclic voltammetry (CV) and scanning electron microscopy (SEM) were used
to characterize the fabricated process of the immunosensor. The immunosensor put up a rapid response time, high sensitivity
and stability. Under the optimized conditions, cyclic voltammograms(CVs) determination of CEA displayed a broader linear response
to CEA in two ranges, from 0.25 to 8.0 ng/mL, and from 8.0 to 100 ng/mL, with a relative low-detection limit of 0.083 ng/mL
at three times the background and noise. The originality of the preparation of the immunosensor lies in not only using the
synergistic effect of two kinds of nanomaterials (nano-MnO2 and nano-Au) to immobilize anti-CEA, but also using nano-MnO2 + CS to furnish a media transferring electron path. What is more, the researched methodology was efficient and potentially
attractive for clinical immunoassays. 相似文献