Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Design,synthesis, and biological activity of new endomorphin analogs with multi-site modifications

Endomorphin (EM)-1 and EM-2 are the most effective endogenous analgesics with efficient separation of analgesia from the risk of adverse effects. Poor metabolic stability and ineffective analgesia after peripheral administration were detrimental for the use of EMs as novel clinical analgesics. Therefore, here, we aimed to establish new EM analogs via introducing different bifunctional d-amino acids at position 2 of [(2-furyl)Map⁴]EMs. The combination of [(2-furyl)Map⁴]EMs with D-Arg² or D-Cit² yielded analogs with enhanced binding affinity to the μ-opioid receptor (MOR) and increased stability against enzymatic degradation (t_1/2 > 300 min). However, the agonistic activities of these analogs toward MOR were slightly reduced. Similar to morphine, peripheral administration of the analog [D-Cit², (2-furyl)Map⁴]EM-1 (10) significantly inhibited the pain behavior of mice in multiple pain models. In addition, this EM-1 analog was associated with reduced tolerance, less effect on gastrointestinal mobility, and no significant motor impairment. Compared to natural EMs, the EM analogs synthesized herein had enhanced metabolic stability, bioavailability, and analgesic properties.     

Structure-function studies on gastrointestinal hormones: I. Synthesis of secretin analogs and their biological and immunological properties

Syntheses by conventional procedures of the three analogs corresponding to the porcine secretin sequence crossed at position 6 by the N-terminal hexapeptide sequences of VIP, GIP, and glucagon are described, viz., Ala⁴,Val⁵-, Tyr¹,Ala²,Glu³-, and Gln³-secretin (VIP-SN, GIP-SN, and GLU-SN). The analog Phe¹,Phe²,Trp³,Lys⁴-secretin (SOMA-SN), designed on the basis of the surprising homology of the sequence portions 10–13 of somatostatin and 5–8 of secretin, was also prepared. Finally, the synthesis of N^α-3-(4-hydroxyphenyl)propionyl-β-alanyl-secretin (DATA-SN), a tracer suitable for secretin radioimmunoassay and as an N-terminus modified secretin analog, is reported. The analogs are compared, in terms of their biological and immunological properties in different assay systems, with pure synthetic secretin.     

Human somatotropin: semisynthesis of the hormone by noncovalent interaction of the natural NH2-terminal fragment with a synthetic analog of the COOH-terminal fragment

Complementation of the natural [Cys (Cam)⁵³]-HGH-(1–134) fragment with synthetic analogs of COOH-terminal fragments of human somatotropin (HGH), namely [Nle¹⁷⁰, Ala^165,182]-HGH-(140–182) and [Nle¹⁷⁰,Ala^165,182]-HGH-(140–187) has been investigated. It was found that the synthetic fragment, [Nle¹⁷⁰,Ala^165,182]-HGH-(140–187), gave a recombinant with about 40% HGH radioreceptor-binding activity. When compared with the natural recombinant, the semisynthetic hormone exhibited similar receptor-binding activities. The natural and semisynthetic recombinants were indistinguishable in radioimmunoassay. The α-helical content of the semisynthetic recombinant was completely restored in comparison with that of the native hormone as revealed by circular dichroism spectra. On the other hand, attempts to obtain a recombinant with the synthetic [Nle¹⁷⁰,Ala^165,182]-HGH-(140–182) were unsuccessful. The synthesis of [Nle¹⁷⁰,Ala^165,182]-HGH-(140–182) and [Nle¹⁷⁰,Ala^165,182]-HGH-(140–187) is herein described.     

Specificity of Pyrrolysyl-tRNA Synthetase for Pyrrolysine and Pyrrolysine Analogs

Pyrrolysine, the 22nd amino acid, is encoded by amber (TAG = UAG) codons in certain methanogenic archaea and bacteria. PylS, the pyrrolysyl-tRNA synthetase, ligates pyrrolysine to tRNA^Pyl for amber decoding as pyrrolysine. PylS and tRNA^Pyl have potential utility in making tailored recombinant proteins. Here, we probed interactions necessary for recognition of substrates by archaeal PylS via synthesis of close pyrrolysine analogs and testing their reactivity in amino acid activation assays. Replacement of the methylpyrroline ring of pyrrolysine with cyclopentane indicated that solely hydrophobic interactions with the ring-binding pocket of PylS are sufficient for substrate recognition. However, a 100-fold increase in the specificity constant of PylS was observed with an analog, 2-amino-6-((R)-tetrahydrofuran-2-carboxamido)hexanoic acid (2Thf-lys), in which tetrahydrofuran replaced the pyrrolysine methylpyrroline ring. Other analogs in which the electronegative atom was moved to different positions suggested PylS preference for a hydrogen-bond-accepting group at the imine nitrogen position in pyrrolysine. 2Thf-lys was a preferred substrate over a commonly employed pyrrolysine analog, but the specificity constant for 2Thf-lys was 10-fold lower than for pyrrolysine itself, largely due to the change in K_m. The in vivo activity of the analogs in supporting UAG suppression in Escherichia coli bearing genes for PylS and tRNA^Pyl was similar to in vitro results, with l-pyrrolysine and 2Thf-lys supporting the highest amounts of UAG translation. Increasing concentrations of either PylS substrate resulted in a linear increase in UAG suppression, providing a facile method to assay bioactive pyrrolysine analogs. These results illustrate the relative importance of the H-bonding and hydrophobic interactions in the recognition of the methylpyrroline ring of pyrrolysine and provide a promising new series of easily synthesized pyrrolysine analogs that can serve as scaffolds for the introduction of novel functional groups into recombinant proteins.     

Conformational constraints in angiotensin IV to probe the role of Tyr2, Pro5 and Phe6

The aromatic amino acids Tyr and Phe in angiotensin IV (Ang IV) were conformationally constrained by the use of β‐Me substituted analogs, or cyclic constrained analogs. None of these modifications was allowed for Tyr¹, while only e‐β‐MePhe⁶ substitution resulted in an AngIV analog with high IRAP potency and selectivity versus AP‐N or the AT₁ receptor. This indicates an important role of the orientation of the Phe⁶ for inducing selectivity. Pro⁵ replacement with 2‐aminocyclopentanecarboxylic acid maintained IRAP potency and abolished AT₁ affinity. These results confirm the importance of conformational constrained amino acids to generate selectivity in bioactive peptides. Copyright © 2011 European Peptide Society and John Wiley & Sons, Ltd.     

In vitro stability of growth hormone releasing factor (GRF) analogs in porcine plasma.

The stability of growth-hormone releasing factor (growth regulating factor; GRF) analogs in porcine plasma was examined. GRF analogs were incubated in porcine plasma at 37 degrees C, extracted and subsequently analyzed using high performance liquid chromatography (HPLC). GRF(1-29)-NH2 was rapidly broken down in the plasma with a degradation rate of t1/2 = 13 min. The primary degradation product was identified as GRF(3-29)-NH2. Substitution of Gly15 by Ala15 slightly prolonged the plasma half-life (t1/2 = 17 min) and the major degradative fragment was found to be [Ala15]GRF(3-29)-NH2. The cleavage between the 2 and 3 position of the peptide was not inhibited by trasylol at a concentration of 1,000 KIU/ml but was dramatically reduced by the combined use of diprotin A and trasylol. Absence of the free amino group at the N-terminus and/or substitution of a D-amino acid residue at the penultimate position completely prevented cleavage between the 2 and 3 position in the structural linear GRF analogs. Side-chain to side-chain cyclization between Asp8 and Lys12 amino acid residues significantly improved the stability of GRF in plasma with t1/2 greater than 2 hr. An additional stability was provided by substitution of D-Ala2 for Ala2 in the structural cyclic analog. Cyclization between Lys21 and Asp25 also improved the stability of the GRF peptide in the plasma. Stability was further enhanced by the presence of D-Ala2 or by forming a dicyclic analog through an additional linkage between Asp8 and Lys12.     

Synthesis and bioactivity of a side chain bridged paclitaxel: A test of the T-Taxol conformation

A knowledge of the bioactive tubulin-binding conformation of paclitaxel (Taxol^?) is crucial to a full understanding of the bioactivity of this important anticancer drug, and potentially also to the design of simplified analogs. The bioactive conformation has been shown to be best approximated by the T-Taxol conformation. As a further test of this conclusion, the paclitaxel analog 4 was designed as a compound which has all the chemical functionality necessary for activity, but which cannot adopt the T-Taxol conformation. The synthesis and bioassay of 4 confirmed its lack of activity, and thus provided further support for the T-Taxol conformation as the bioactive tubulin-binding conformation.     

Exploring tryptamine conjugates as pronucleotides of phosphate-modified 7-methylguanine nucleotides targeting cap-dependent translation

Eukaryotic translation initiation factor 4E (eIF4E) is overexpressed in many cancers deregulating translational control of the cell cycle. mRNA 5′ cap analogs targeting eIF4E are small molecules with the potential to counteract elevated levels of eIF4E in cancer cells. However, the practical utility of typical cap analogs is limited because of their reduced cell membrane permeability. Transforming the active analogs into their pronucleotide derivatives is a promising approach to overcome this obstacle. 7-Benzylguanosine monophosphate (bn⁷GMP) is a cap analog that has been successfully transformed into a cell-penetrating pronucleotide by conjugation of the phosphate moiety with tryptamine. In this work, we explored whether a similar strategy is applicable to other cap analogs, particularly phosphate-modified 7-methylguanine nucleotides. We report the synthesis of six new tryptamine conjugates containing N⁷-methylguanosine mono- and diphosphate and their analogs modified with thiophosphate moiety. These new potential pronucleotides and the expected products of their activation were characterized by biophysical and biochemical methods to determine their affinity towards eIF4E, their ability to inhibit translation in vitro, their susceptibility to enzymatic degradation and their turnover in cell extract. The results suggest that compounds containing the thiophosphate moiety may act as pronucleotides that release low but sustainable concentrations of 7-methylguanosine 5′-phosphorothioate (m⁷GMPS), which is a translation inhibitor with in vitro potency higher than bn⁷GMP.     

Liquid chromatography of pyridine nucleotides and associated compounds and isolation of several analogs of nicotinamide adenine dinucleotide phosphate.

A single-column technique is described for separating the naturally occurring nicotinic acid- and nicotinamide-containing nucleosides and nucleotides. A unique feature of the system is the use of conductivity measurements as a reproducible means of peak identification. The chromatographic system has been used to isolate a number of NADP⁺ analogs and to characterize their enzymatic hydrolysis products. These analogs include the α-anomer of NADP⁺, the nicotinic acid analog of NADP⁺, and a series of NADP⁺ derivatives that contain phosphate in the 3′-position.     

Synthesis and biological activity of lipophilic analogs of the cationic antimicrobial active peptide anoplin

Anoplin is a short natural cationic antimicrobial peptide which is derived from the venom sac of the solitary wasp, Anoplius samariensis. Due to its short sequence G¹LLKR⁵IKT⁸LL‐NH₂, it is ideal for research tests. In this study, novel analogs of anoplin were prepared and examined for their antimicrobial, hemolytic activity, and proteolytic stability. Specific substitutions were introduced in amino acids Gly¹, Arg⁵, and Thr⁸ and lipophilic groups with different lengths in the N‐terminus in order to investigate how these modifications affect their antimicrobial activity. These cationic analogs exhibited higher antimicrobial activity than the native peptide; they are also nontoxic at their minimum inhibitory concentration (MIC) values and resistant to enzymatic degradation. The substituted peptide GLLKF⁵IKK⁸LL‐NH₂ exhibited high activity against Gram‐negative bacterium Zymomonas mobilis (MIC = 7 µg/ml), and the insertion of octanoic, decanoic, and dodecanoic acid residues in its N‐terminus increased the antimicrobial activity against Gram‐positive and Gram‐negative bacteria (MIC = 5 µg/ml). The conformational characteristics of the peptide analogs were studied by circular dichroism. Structure activity studies revealed that the substitution of specific amino acids and the incorporation of lipophilic groups enhanced the amphipathic α‐helical conformation inducing better antimicrobial effects. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.     

Total synthesis,structural, and biological evaluation of stylissatin A and related analogs

The natural product cyclic peptide stylissatin A ( 1a ) was reported to inhibit nitric oxide production in LPS‐stimulated murine macrophage RAW 264.7 cells. In the current study, solid‐phase total synthesis of stylissatin A was performed by using a safety‐catch linker and yielded the peptide with a trans‐Phe⁷‐Pro⁶ linkage, whereas the natural product is the cis rotamer at this position as evidenced by a marked difference in NMR chemical shifts. In order to preclude the possibility of 1b being an epimer of the natural product, we repeated the synthesis using d ‐allo‐Ile in place of l ‐Ile and a different site for macrocyclization. The resulting product (d ‐allo‐Ile²)‐stylissatin A ( 1c ) was also found to have the trans‐Phe⁷‐Pro⁶ peptide conformations like rotamer 1b . Applying the second route to the synthesis of stylissatin A itself, we obtained stylissatin A natural rotamer 1a accompanied by rotamer 1b as the major product. Rotamers 1a , 1b , and the epimer 1c were separable by HPLC, and 1a was found to match the natural product in structure and biological activity. Six related analogs 2–7 of stylissatin A were synthesized on Wang resin and characterized by spectral analysis. The natural product ( 1a ), the rotamer ( 1b ), and (d ‐allo‐Ile²)‐stylissatin A ( 1c ) exhibited significant inhibition of NO^.. Further investigations were focused on 1b , which also inhibited proliferation of T‐cells and inflammatory cytokine IL‐2 production. The analogs 2–7 weakly inhibited NO^. production, but strongly inhibited IL‐2 cytokine production compared with synthetic peptide 1b . All analogs inhibited the proliferation of T‐cells, with analog 7 having the strongest effect. In the analogs, the Pro⁶ residue was replaced by Glu/Ala, and the SAR indicates that the nature of this residue plays a role in the biological function of these peptides. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.     

Studies on photophosphorylation utilizing methylene diphosphonate analogs of ADP and ATP

Spinach chloroplasts were able to photophosphorylate the ADP analog α,β-methylene adenosine 5′-diphosphate (AOPCP). Phosphorylation of AOPCP was catalyzed by chloroplasts that were washed or dialyzed to remove free endogenous nucleotides. In the presence of glucose, hexokinase, AOPCP and ³²P_i, the ³²P label was incorporated into α,β-methylene adenosine 5′-triphosphate (AOPCPOP).In contrast to photophosphorylation of AOPCP, the ATP analog AOPCPOP was a poor substrate for the ATP-P_i exchange reaction and its hydrolysis was neither stimulated by light and dithiothreitol nor inhibited by Dio-9.Photophosphorylation of AOPCP was inhibited by the α,β- and β,γ-substituted methylene analogs of ATP, while phosphorylation of ADP was unaffected by them. The ATP-P_i exchange was also unaffected by both ATP analogs, while the weak AOPCPOP-P_i exchange was inhibited by the β,γ-methylene analog of ATP.Direct interaction of methylene analogs with the chloroplast coupling factor ATPase was indicated by the enzymatic hydrolysis of AOPCPOP on polyacrylamide gels.     

Cytotoxic Peptides: Naphthoquinonyl Derivatives of Luteinizing Hormone-Releasing Hormone

Summary In an attempt to produce efficient cytotoxic derivatives of luteinizing hormone-releasing hormone (LH-RH), two novel 1,4-naphthoquinone derivatives of [d-Lys⁶]-LH-RH were synthesized primarily by solid-phase peptide synthesis, in good yield and high purity. The ability of each analog to produce reactive oxygen species using enzymatic reduction, i.e. NADPH-cytochrome P-450 reductase, was evaluated employing electron spin resonance (ESR) spectroscopy and spin-trapping techniques. The ESR results suggest that the novel cytotoxic analogs are extremely effective in generating oxygen radicals.     

Synthesis and biochemical evaluation of Aminopropanolyl-Thymine tri-Phosphate (ap-TTP)

Abstract

Deoxyribonucleoside triphosphates (dNTPs) are building blocks for the biosynthesis of DNA. Various modified dNTPs’ analogs have synthesized by structural changes of nucleoside’s susgar and nucleobases and employed for synthesis of modified DNA. A very few modified dNTPs have prepared from non-sugar nucleoside analogs. This report describes the synthesis of acyclic nucleoside triphosphate (NTP) analog from amino acid L-Serine as aminopropanolyl-thymine triphosphate (ap-TTP) and demonstrate its biochemical evaluation as enzymatic incorporation of ap-TTP into DNA with DNA polymerases with primer extension methods. Alanyl peptide nucleicacids (Ala-PNA) are the analogs of DNA which contains alanyl backbone. Aminopropanolyl – analogs are derivatives of alanyl back bone. Ap-TTP analog is nucleoside triphosphate analog derived from Ala-PNA. Importantly, this report also sheds light on the crystal packing arrangement of alaninyl thymine ester derivative in solid-state and reveals the formation of self-duplex assembly in anti-parallel fashion via reverse Watson-Crick hydrogen bonding and π–π interactions. Hence, ap-TTP is a useful analog which also generates the free amine functional group at the terminal of DNA oligonucleotide after incorporation.     

Prosystemin,a prohormone that modulates plant defense barriers,is an intrinsically disordered protein

Prosystemin, originally isolated from Lycopersicon esculentum, is a tomato pro‐hormone of 200 aminoacid residues which releases a bioactive peptide of 18 aminoacids called Systemin. This signaling peptide is involved in the activation of defense genes in solanaceous plants in response to herbivore feeding damage. Using biochemical, biophysical and bioinformatics approaches we characterized Prosystemin, showing that it is an intrinsically disordered protein possessing a few secondary structure elements within the sequence. Plant treatment with recombinant Prosystemin promotes early and late plant defense genes, which limit the development and survival of Spodoptera littoralis larvae fed with treated plants.     

Biological activity of endomorphin and [Dmt1]endomorphin analogs with six-membered proline surrogates in position 2

Endogenous μ-opioid receptor (MOR) selective peptides, endomorphin-1 (EM-1) and endomorphin-2 (EM-2), unlike so called ‘typical opioids’, are characterized by the presence of Pro² residue, which is a spacer connecting aromatic pharmacophoric residues. In order to investigate structural requirements for position 2, we synthesized endomorphin analogs incorporating, instead of Pro, unnatural amino acids with six-membered heterocyclic rings, such as piperidine 2-, 3- or 4-carboxylic acids (Pip, Nip and Inp, respectively). (R)-Nip residue turned out to be favourable for improving MOR affinity. Introduction of 2′,6′-dimethyltyrosine (Dmt) instead of Tyr¹ led to obtaining [Dmt¹, (R)-Nip²]EM-2 which showed exceptional MOR affinity and high stability against enzymatic degradation in rat brain homogenate. In in vivo hot-plate test in mice, this analog given intracerebroventicularly (i.c.v.), produced profound supraspinal analgesia, being much more potent than EM-2. The antinociceptive effect of this analog lasted about 170 min and was almost completely reversed by β-funaltrexamine (β-FNA), a selective MOR antagonist.     

Peptidase-resistant peptide inhibitors of myosin light chain kinase

Myosin light chain kinase (MLCK) is a key regulator of various forms of cellular mobility, in particular, endothelial and epithelial permeability. The membrane-penetrative peptide (H-RKKYKYRRK-NH₂, L-PIK) is one of the potential MLCK inhibitors for use in humans. Five analogs of L-PIK were synthesized by the solid phase method of peptide synthesis using Fmoc technology. According to ¹H NMR, these analogs exhibited increased stability towards degradation in blood plasma. One of the synthesized peptides, L-[MeArg¹]PIK, inhibited MLCK activity in vitro, and the inhibition efficacy of L-[MeArg¹]PIK was equal to that of L-PIK. The inhibitory effect of the other analogs was lower than that of L-PIK. The L-PIK analog that consisted of D-amino acids was the least active. Thus, we demonstrated the possibility of creating an effective peptide inhibitor of MLCK with increased stability against biodegradation. Such a peptide inhibitor is a promising compound for further pharmacological studies.     

Cytotoxic Peptides: Naphthoquinonyl Derivatives of Luteinizing Hormone-Releasing Hormone

In an attempt to produce efficient cytotoxic derivatives of luteinizing hormone-releasing hormone (LH-RH), two novel 1,4-naphthoquinone derivatives of [D-Lys⁶]-LH-RH were synthesized primarily by solid-phase peptide synthesis, in good yield and high purity. The ability of each analog to produce reactive oxygen species using enzymatic reduction, i.e. NADPH-cytochrome P-450 reductase, was evaluated employing electron spin resonance (ESR) spectroscopy and spin-trapping techniques. The ESR results suggest that the novel cytotoxic analogs are extremely effective in generating oxygen radicals.     

Cyclic enkephalin analogs containing a cystine bridge

Two conformationally constrained enkephalin analogs were synthesized by substitution of cysteines in positions 2 and 5 and oxidative disulfide bond formation. In the guinea pig ileum assay the obtained cyclic analogs, [D-Cys²-L-Cys⁵]enkephalinamide and [D-Cys²-D-Cys⁵]enkephalinamide, showed potency ratios of 37.9 ± 0.8 and 73.3 ± 0.9, respectively, relative to [Met⁵]enkephalin. The extremely high potency of the analogs was shown to be a consequence of the conformational restrictions introduced by cyclization. Rat brain membrane binding studies with [³H]naloxone and [³H](D-Ala², D-Leu⁵)enkephalin as radiolabels revealed a moderate preference of both analogs for μ-receptors over δ-receptors. Furthermore, the cystine-containing analogs were shown to be highly resistant to enzymatic degradation.