New reagents for affinity modification of biopolymers. Photoaffinity modification of Tte-DNA polymerase]

Arylazides N-(4-azido-2,5-difluoro-3-chloropyridinyl-6)-beta-alanine (Ia) and N-(4-azido-2,5-difluoro-3-chloropyridinyl-6)-glycine (Ib) were synthesized and covalently attached to 5-(3-aminopropenyl-1)-dUTP through the amino group to give 5'-triphosphate (IIa) and 5'-triphosphate (IIb). The resulting azides were subjected to photolysis in aqueous solution. The spectral and photochemical characteristics of azides (I) and (II) imply that their use for the modification of biopolymers holds promise. Compounds (IIa, b) effectively substituted dTTP in DNA polymerization catalyzed by thermostable DNA polymerase from Thermus thermophilus B-35 (Tte DNA polymerase). Photoaffinity modification of Tte DNA polymerase was carried out by dTTP analogues (IIa, b) and by earlier obtained 5-[N-(5-azido-2-nitrobenzoyl)-trans-3-aminopropenyl-1]deoxyuridine 5'-triphosphate (III) and 5-[N-(4-azido-2,3,5,6-tetrafluorobenzyol)-trans-3- aminopropenyl-1]deoxyuridine 5'-triphosphate (IV) using two variants of labeling. All four dTTP analogues were shown to modify Tte DNA polymerase.     

E. coli DNA polymerase. A study of the mechanism of primer binding using oligothymidylate analogs with ethylated internucleotide phosphate groups

The following individual diastereomers of oligothymidylate ethyl esters (the alkyl phosphodiester group is asymmetric with R or S configuration) have been prepared: d[(Tr)8Tp'(Et)T] (I), d[(Tp)8Tp'(Et)T] (II), d[(Tp)8Tp'(Et)TpT] (III), d[(Tp)8Tp' X (Et)TpT] (IV). A totally esterified analogue d[[(Tp(Et)7]T] (V) was obtained as a diastereomeric mixture. All oligothymidylate derivatives revealed substrate activity as primers of DNA polymerase with poly(dA) as a template. The values of the maximal reaction rates were equal to 14; 2,6; 68; 24 and 0,1% for oligothymidylates (I)-(V) with respect to Vm value (100%) for (Tp)9T. Km values of oligothymidylates (I)-(V), 2,7; 2,5; 0,51; 7,2 microM, were obtained in relation to Km for d[(Tp)9T] (0,4 microM). Diastereomers (I) and (II) were not destroyed by Klenow fragment of DNA polymerase I which has only 3'----5' exonuclease activity. However, these derivatives were hydrolyzed by complete DNA polymerase I due to its 5'----3' exonuclease activity, the reaction rate being 3-10 times lower than in case of d[(Tp)9T]. The data suggest an essential contribution to the primer binding from the positive enzyme group interaction with the 3'-end negatively charged phosphate group of oligonucleotide, together with the primer complementary interaction with the template. At least two phosphodiester groups of the oligonucleotide primer are essential for the reaction of polymerization following the correct binding.     

A new highly efficient photoreactive analogue of dCTP. Synthesis, characterization, and application in photoaffinity modification of DNA binding proteins

A new base-substituted analogue of dCTP, exo-N-{2-[N-(4-azido-2,5-difluoro-3-chloropyridine-6-yl)-3-aminopropionyl]aminoethyl}-2'-deoxycytidine-5'-triphosphate (FAP-dCTP) has been synthesized and characterized. FAP-dCTP is an efficient substrate of mammalian DNA polymerase beta in the reaction of primer elongation displaying substrate properties as an analogue of dCTP and dTTP. FAP-dCTP was used for the photoaffinity modification of mammalian DNA polymerase beta. Two approaches to photoaffinity labeling were utilized. In one approach, photoreactive FAP-dCTP was first incorporated into radiolabeled primer-template, and photoreactive DNA was UV-irradiated in the presence of DNA polymerase beta, which resulted in the polymerase labeling by photoreactive primer. In an alternate approach, FAP-dCTP was first UV-cross-linked to the enzyme; subsequently, radiolabeled primer-template was added, and the enzyme-linked FAP-dCTP was incorporated into the 3'-end of radioactive primer. This "catalytic" modification pathway was shown to be less specific in recognition of FAP-dCTP as an analogue of dCTP than dTTP. FAP-dCTP was used as substrate of endogenous DNA polymerases of HeLa cell extract to synthesize photoreactive DNAs for photoaffinity modification of cell proteins. UV irradiation results in modification of DNA binding proteins of cell extract. The level of photoaffinity labeling of protein targets in the cell extract was strongly dependent on the efficiency of synthesis of photoreactive DNA.     

Base-pairing properties of N4-methoxydeoxycytidine 5'-triphosphate during DNA synthesis on natural templates, catalyzed by DNA polymerase I of Escherichia coli

N4-Methoxydeoxycytidine 5'-triphosphate (mo4dCTP) was synthesized by reaction of dCTP with methoxyamine and then purified by high-performance liquid chromatography (HPLC) and used to analyze the specificity of mo4dCMP incorporation during polymerization on natural templates, catalyzed by DNA polymerase I of Escherichia coli. Elongation of synthetic 5'-32P-labeled primers, annealed to single-stranded DNA of bacteriophage M13, was carried out in the presence of only three of the four normal dNTPs; then, reaction products were displayed by high-resolution gel electrophoresis and visualized by autoradiography. By measuring primer elongation in each of the four "minus" reactions with and without added mo4dCTP, we examined the specificity of mo4dCMP incorporation at different positions along the M13 template. The results of this experimental approach indicated that (i) mo4dCTP is utilized most readily (although at low efficiency) in place of dTTP during DNA synthesis, (ii) the analogue can also replace dCTP during primer elongation, although at barely detectable efficiency, and (iii) the ease at which both mo4C.A and mo4C.G pairs are formed during DNA synthesis on natural templates is markedly influenced by the nucleotide sequence of the template.     

Reagents for modification of protein-nucleic complexes. III. Site-specific photomodification of elongation complex of DNA polymerase beta with arylazide derivatives of primers sensitized with fluorescent ATP gamma-amide

ATP gamma-amides containing in gamma-N-position 1-methylpyrene, 9-methylanthracene, 10-chloro-9-methylanthracene, and 3-methylperylene residues were synthesized and characterized. These compounds were used as sensitizers of site-specific photomodification of the reconstituted elongating complex of the mammalian DNA polymerase beta. The photomodification was carried out with the use of photoaffine reagents, which were synthesized in situ by the 5'-(32)P-labeled primers extension with photoactive analogues of dCTP containing in the exo-N-position of cytosine various perfluoroarylazide groups. The effect of structures of the sensitizers and photoactive reagents on the efficiency and selectivity of photolinking of primers to the enzyme and template, as well as formation of a number of other photomodification products was studied. It was shown that the sensitizers containing 10-chloro-9-methylanthracene and 3-methylperylene residues allow preparation of photolinks in such irradiation conditions when photomodification in their absence is not essentially observed.     

Comparative study of the efficacy of modifying DNA polymerase and DNA matrix by different photoactive groups at the 3'-end of the DNA primer

The dependence of the modification efficiency of DNA polymerases and DNA template on the nature of photoactivatable group and the length of the linker that joins the group with the heterocyclic base of the primer 3'-terminal nucleotide was studied. The primers that contained the photoreactive groups at their 3'-termini were obtained using the rat DNA polymerase beta or the DNA polymerase from Thermus thermophilus in the presence of one of the dTTP analogues carrying the photoreactive group in position 5 of thymidine residue. After irradiating the reaction mixture with UV light and separating the modification products, the level of covalent binding of the [5'-32P]primer to DNA polymerases and template was determined. The primers containing 4-azido-2,5-difluoro-3-chloropyridyl group were shown to be the most effective in the modification of DNA polymerases.     

Recognition of sugar moieties on substrate analogues by DNA polymerase alpha 2-primase from developing cherry salmon (Oncorhynchus masou) testes

Several dCTP or dATP analogues, bearing an azido or amino group on 2'- or 3'-position of its sugar moiety, were examined for their inhibitory effects on DNA polymerase alpha 2-primase from developing cherry salmon (Oncorhynchus masou) testes, and the recognition of sugar moieties of the analogues by primase and related nucleic acid polymerases were compared. Among the dCTP analogues tested, 2'-azido-2',3'-dideoxy CTP inhibited primase strongly and RNA polymerases I and II to lesser extent. Although, the Ki value for primase was larger than those of RNA polymerases, the Ki/Km value for primase was smaller. In contrast, 3'-amino-2',3'-dideoxy CTP selectively inhibited DNA polymerase beta. In dATP analogue series, 3'-amino-3'-deoxy ATP inhibited RNA polymerases I and II very strongly to the same extent as 3'-deoxy ATP. This analogues was a more selective inhibitor for RNA polymerases I and II than 3'-dATP itself.     

The DNA sequence specificity of stimulation of DNA polymerases by factor D

The mechanism of enhancement of DNA polymerase activity by the murine DNA-binding protein factor D was investigated. Extension by Escherichia coli DNA polymerase I and calf thymus DNA polymerase-alpha of 5'-32P-labeled oligodeoxynucleotide primers that are complementary to poly(dT) or to bacteriophage M13 DNA was measured in the absence or presence of factor D. With 5'-[32P](dA)9.poly(dT), factor D enables E. coli polymerase I to fill approximately 15-nucleotide gaps between adjacent primers; whereas in the absence of the stimulatory protein, poly(dT) is not copied significantly. In order to study the nucleotide specificity of synthesis enhancement, we used M13mp10 DNA containing 4 consecutive thymidine residues downstream from the 3-hydroxyl terminus of an oligonucleotide primer. Upon addition of factor D, both polymerase I and polymerase-alpha can traverse this sequence more efficiently and thus generate longer DNA products. Densitometric analysis of nonextended and elongated 5'-32P-labeled M13 primer indicates that, without changing the frequency of primer utilization, factor D enhances the activity of these DNA polymerases by increasing their apparent processivity. By positioning oligonucleotide primers 4, 8, and 12 bases upstream from the (dT)4 template sequence, we show that the enhancement of synthesis by factor D is independent of the position of the oligothymidine cluster. We hypothesize that factor D interacts with oligo(dT).oligo(dA) domains in DNA to alter their conformation, which may normally obstruct the progression of DNA polymerases.     

Preparation of photoreactive oligonucleotide duplexes and their application for photoaffinity modification of DNA-binding proteins]

To introduce photoreactive dNTP residues to the 3'-end of a mononucleotide gap, base-substituted photoreactive deoxynucleoside triphosphate derivatives, (5-[N-(2,3,5,6-tetrafluoro-4-azidobenzoyl)-trans-3-aminopropenyl-1]- and 5-(N-[N-(4-azido-2,5-difluoro-3-chloropyridine-6-yl)-3-aminopropionyl]- trans-3-aminopropenyl-1)-2'-deoxyuridine 5'-triphosphates, were used as substrates in the DNA polymerase beta-catalyzed reaction. The resulting nick, containing a modified base at the 3'-end, was sealed by T4 phage DNA ligase. This approach enables the preparation of DNA duplexes bearing photoreactive groups at predetermined position(s) of the nucleotide chain. Using the generated photoreactive DNA duplexes, the photoaffinity modifications of DNA polymerase beta and human replicative protein A (hRPA) were carried out. It was shown that DNA polymerase beta and hRPA subunits were modified with the photoreactive double-stranded DNA considerably less effectively than by the nicked DNA. In the case of double-stranded DNA, the hRPA p70 subunit was preferentially labeled, implying a crucial role of this subunit in the protein-DNA interaction.     

5-[3-(E)-(4-azido-2,3,5,6-tetrafluorobenzamido)propenyl-1]-2'-deoxy- uridine-5'-triphosphate substitutes for thymidine-5'-triphosphate in the polymerase chain reaction.

The DNA targets may be labeled and simultaneously amplified in the polymerase chain reaction (PCR) using a pair of respective primers after elongation with nucleoside-5'-triphosphates carrying photoreactive groups. The amplified DNA may be subsequently photoactivated by irradiation above 300 nm, resulting in photo-cross-linking of the strands. For this goal 5-[3-(E)-(4-azido-2,3,5,6-tetrafluorobenzamido)propenyl-1]-, 5-{N-[N'-(4-azido-2,3,5, 6-tetrafluorobenzoyl)-3-aminopropionyl]aminomethyl}-, and 5-{N-[N'-(2-nitro-5-azidobenzoyl)-3-aminopropionyl]aminomethyl}-2'-de oxyuridine-5'-triphosphate (VII, VIa, and VIb) derivatives have been synthesized. It was found that VII is capable of efficiently elongating DNA primers with both Klenow fragment DNA polymerase I and Thermus aquaticus DNA polymerase. Thereto, it turned out to provide quantitative incorporation in DNA as revealed by the formation of the full-length amplificate by PCR in the presence of this photoreactive analogue without any dilution with natural dTTP. On the contrary, it was found, that incorporation of VIa and VIb do not permit further DNA replication.     

Regulation of DNA metabolic enzymes upon induction of preB cell development and V(D)J recombination: up-regulation of DNA polymerase delta.

Withdrawal of interleukin-7 from cultured murine preB lymphocytes induces cell differentiation including V(D)J immunoglobulin gene rearrangements and cell cycle arrest. Advanced steps of the V(D)J recombination reaction involve processing of coding ends by several largely unidentified DNA metabolic enzymes. We have analyzed expression and activity of DNA polymerases alpha, beta, delta and epsilon, proliferating cell nuclear antigen (PCNA), topoisomerases I and II, terminal deoxynucleotidyl transferase (TdT) and DNA ligases I, III and IV upon induction of preB cell differentiation. Despite the immediate arrest of cell proliferation, DNA polymerase delta protein levels remained unchanged for approximately 2 days and its activity was up-regulated several-fold, while PCNA was continuously present. Activity of DNA polymerases alpha,beta and epsilon decreased. Expression and activity of DNA ligase I were drastically reduced, while those of DNA ligases III and IV remained virtually constant. No changes in DNA topoisomerases I or II expression and activity occurred and TdT expression was moderately increased early after induction. Our results render DNA polymerase delta a likely candidate acting in DNA synthesis related to V(D)J recombination in lymphocytes.     

Inhibition of primase, the dnaG protein of Escherichia coli by 2'-deoxy-2'-azidocytidine triphosphate.

2'-Deoxy-2'-azidocytidine-5'-triphosphate was investigated as an inhibitor in two reconstructed enzyme systems which catalyze the replication of two viral DNAs. During replication of the duplex replicative form of phiX174 DNA, DNA polymerase III holoenzyme was weakly inhibited and inhibition was reversed by dCTP. A more pronounced inhibition, not reversed by either dCTP or CTP, was observed during replication of the single-stranded DNA of the bacteriophage G4, a close relative of phiX174. This effect depended on the incorporation of 2'-deoxy-2'-azidocytidine-5'-triphosphate by primase (dnaG protein) which synthesizes a 29-residue RNA primer at the unique origin of bacteriophage G4 DNA replication. Extension of the primer strand, terminated by 2'-deoxy-2'-azidocytidine-5'-triphosphate is then severely inhibited. Primase was also inhibited by the 2'-deoxy-2'-azido derivatives of ATP, GTP, and UTP.     

Cytotoxic activity of 4'-hydroxychalcone derivatives against Jurkat cells and their effects on mammalian DNA topoisomerase I

Chalcones (1,3-diaryl-2-propen-1-ones) are alpha, beta-unsaturated ketones with cytotoxic and anticancer properties. Several reports have shown that compounds with cytotoxic properties may also interfere with DNA topoisomerase functions. Five derivatives of 4'-hydroxychalcones were examined for cytotoxicity against transformed human T (Jurkat) cells as well as plasmid supercoil relaxation experiments using mammalian DNA topoisomerase I. The compounds were 3-phenyl-1-(4'-hydroxyphenyl)-2-propen-1-one (I), 3-(p-methylphenyl)-1-(4'-hydroxyphenyl)-2-propen-1-one (II), 3-(p-methoxyphenyl)-1-(4'-hydroxyphenyl)-2-propen-1-one (III), 3-(p-chlorophenyl)-1-(4'-hydroxyphenyl)-2-propen-1-one (IV), and 3-(2- thienyl)-1-(4'-hydroxyphenyl)-2-propen-1-one (V). The order of the cytotoxicity of the compounds was; IV > III > II > I > V. Compound IV, had the highest Hammett and log P values (0.23 and 4.21, respectively) and exerted both highest cytotoxicity and strongest DNA topoisomerase I inhibition. Compounds I and II gave moderate interference with the DNA topoisomerase I while III & V did not interfere with the enzyme.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

In vitro synthesis of short DNA pieces by DNA polymerase alpha from mouse myeloma

The DNA chain elongation mechanisms of mouse DNA polymerases alpha and beta have been analyzed by using denatured DNA with a (dT)n block at the 3'-end as a template in combination with RNA ((rA)12-20)primer. The (rA)12-20-primed DNA product synthesized by DNA polymerase alpha was 3-5 s in size even after prolonged reaction; instead of a size increase, the number of 3-5 s molecules increased with the reaction time. The size of products was not affected by differences in 3H-labeled substrate (dATP or dTTP), enzyme amount, KCl concentration, or the length of 3'-(dT)n blocks. On the other hand, DNA polymerase beta synthesized long DNA products by a highly distributive reaction mechanism. 3-5 sDNA pieces synthesized by DNA polymerase alpha were not elongated any further by DNA polymerase alpha, but were converted into long DNA chains by DNA polymerase beta. The results imply that DNA polymerase alpha recognizes the size of the product DNA, and shuts off further elongation.     

A photoreactive analogue of 2'3'-dideoxyuridine 5'-triphosphate: preparation and use for photoaffinity modification of human replication protein A

A new reagent for photoaffinity modification of biopolymers, 5-[E-N-(2-nitro-5-azidobenzoyl)-3-amino-1-propen-1-yl]-2',3'-dideoxyuridine 5'-triphosphate (NAB-ddUTP), was synthesized. Like a similar derivative of 2'-deoxyuridine 5'-triphosphate (NAB-dUTP), it was shown to be able to effectively substitute for dTTP in the synthesis of DNA catalyzed by eukaryotic DNA polymerase beta and to terminate DNA synthesis. A 5'-32P-labeled primer with a photoreactive group at the 3'-terminus was derived from NAB-ddUTP and used for photoaffinity labeling of the human replication protein A (RPA). The covalent attachment of RPA p32 and p70 subunits to the labeled primers was demonstrated. NAB-ddUTP is a promising tool for studying the interaction of proteins of the replicative complex with NA in cellular extracts and living cells during the termination of DNA synthesis.     

Inhibition of DNA polymerase reactions by pyrimidine nucleotide analogues lacking the 2-keto group.

To investigate the influence of the pyrimidine 2-keto group on selection of nucleotides for incorporation into DNA by polymerases, we have prepared two C nucleoside triphosphates that are analogues of dCTP and dTTP, namely 2-amino-5-(2'-deoxy-beta-d-ribofuranosyl)pyridine-5'-triphosphate (d*CTP) and 5-(2'-deoxy- beta-d-ribofuranosyl)-3-methyl-2-pyridone-5'-triphosphate (d*TTP) respectively. Both proved strongly inhibitory to PCR catalysed by Taq polymerase; d*TTP rather more so than d*CTP. In primer extension experiments conducted with either Taq polymerase or the Klenow fragment of Escherichia coli DNA polymerase I, both nucleotides failed to substitute for their natural pyrimidine counterparts. Neither derivative was incorporated as a chain terminator. Their capacity to inhibit DNA polymerase activity may well result from incompatibility with the correctly folded form of the polymerase enzyme needed to stabilize the transition state and catalyse phosphodiester bond formation.     

Pharmacological properties of new 1,2-benzisothiazolyloxypropanolamines on cardiac and tracheal beta-receptors.

This paper reports the pharmacological assessment of beta-blocking properties of new benzisothiazole and benzisoxazole derivatives, substituted in position 3-, 5- or 7- with the oxypropanolaminic side chain (I-VI), to of which contain the -OCH3 group in position 3- (III, V) in comparison with propranolol. The results, obtained on isoprenaline-induced chronotropic response of rat isolated atria and on isoprenaline-induced relaxation of guinea-pig tracheal strips precontracted by carbachol, suggest that the compounds (I, II, IV, VI), at variance with the methoxy-substituted (III, V), possess a beta 1-blocking activity 4-300 times lower than propranolol. pA2 values drop from 8.36 to 7.56 and 7.04 from the relative compounds substituted in position 7- (IV), 3- (I) and 5- (II), thus indicating that the position of the oxypropanolaminic chain in the benzisothiazole ring affects the ability of the molecules to interact with the beta 1-adrenoceptor. Furthermore, benzisothiazole rather than benzisoxazole ring seems to facilitate the drug-beta 1 adrenoceptor interaction, the compound (I) displaying a 10-fold higher affinity than compound (VI).