Equilibrium unfolding pathway of an H-type RNA pseudoknot which promotes programmed -1 ribosomal frameshifting.

The equilibrium unfolding pathway of a 41-nucleotide frameshifting RNA pseudoknot from the gag-pro junction of mouse intracisternal A-type particles (mIAP), an endogenous retrovirus, has been determined through analysis of dual optical wavelength, equilibrium thermal melting profiles and differential scanning calorimetry. The mIAP pseudoknot is an H-type pseudoknot proposed to have structural features in common with the gag-pro frameshifting pseudoknots from simian retrovirus-1 (SRV-1) and mouse mammary tumor virus (MMTV). In particular, the mIAP pseudoknot is proposed to contain an unpaired adenosine base at the junction of the two helical stems (A15), as well as one in the middle of stem 2 (A35). A mutational analysis of stem 1 hairpins and compensatory base-pair substitutions incorporated into helical stem 2 was used to assign optical melting transitions to molecular unfolding events. The optical melting profile of the wild-type RNA is most simply described by four sequential two-state unfolding transitions. Stem 2 melts first in two closely coupled low-enthalpy transitions at low tmin which the stem 3' to A35, unfolds first, followed by unfolding of the remainder of the helical stem. The third unfolding transition is associated with some type of stacking interactions in the stem 1 hairpin loop not present in the pseudoknot. The fourth transition is assigned to unfolding of stem 1. In all RNAs investigated, DeltaHvH approximately DeltaHcal, suggesting that DeltaCpfor unfolding is small. A35 has the thermodynamic properties expected for an extrahelical, unpaired nucleotide. Deletion of A15 destabilizes the stem 2 unfolding transition in the context of both the wild-type and DeltaA35 mutant RNAs only slightly, by DeltaDeltaG degrees approximately 1 kcal mol-1(at 37 degrees C). The DeltaA15 RNA is considerably more susceptible to thermal denaturation in the presence of moderate urea concentrations than is the wild-type RNA, further evidence of a detectable global destabilization of the molecule. Interestingly, substitution of the nine loop 2 nucleotides with uridine residues induces a more pronounced destabilization of the molecule (DeltaDeltaG degrees approximately 2.0 kcal mol-1), a long-range, non-nearest neighbor effect. These findings provide the thermodynamic basis with which to further refine the relationship between efficient ribosomal frameshifting and pseudoknot structure and stability.     

A Characteristic Bent Conformation of RNA Pseudoknots Promotes –1 Frameshifting during Translation of Retroviral RNA

The structures of four different RNA pseudoknots that provide one of the signals required for ribosomal frameshifting in mouse mammary tumor virus have been determined by NMR. The RNA pseudoknots have similar sequences and assume similar secondary structures, but show significantly different frameshifting efficiencies. The three-dimensional structures of one frameshifting and one non-frameshifting RNA pseudoknot had been determined previously by our group. Here we determine the structures of two new RNA pseudoknots, and relate the structures of all four pseudoknots to their frameshifting abilities. The two efficient frameshifting pseudoknots adopt characteristic bent conformations with stem 1 bending towards the major groove of stem 2. In contrast, the two poor frameshifting pseudoknots have structures very different from each other and from the efficient frameshifters. One has linear, coaxially stacked stems, the other has stems twisted and bent, but in the opposite direction to the efficient frameshifters. Changes in loop size that favor bending (shorter loops) increase frameshifting efficiency; longer loops that allow linear arrangement of the stems decrease frameshifting. Frameshifting pseudoknots in feline immunodeficiency virus and simian retrovirus have different loop sequences, but the sequences at their stem junctions imply the same bent conformation as in the mouse mammary tumor viral RNA. The requirement for a precise pseudoknot conformation for efficient frameshifting strongly implies that a specific interaction occurs between the viral RNA pseudoknot and the host protein-synthesizing machinery.     

The role of RNA pseudoknot stem 1 length in the promotion of efficient -1 ribosomal frameshifting.

The ribosomal frameshifting signal present in the genomic RNA of the coronavirus infectious bronchitis virus (IBV) contains a classic hairpin-type RNA pseudoknot that is believed to possess coaxially stacked stems of 11 bp (stem 1) and 6 bp (stem 2). We investigated the influence of stem 1 length on the frameshift process by measuring the frameshift efficiency in vitro of a series of IBV-based pseudoknots whose stem 1 length was varied from 4 to 13 bp in single base-pair increments. Efficient frameshifting depended upon the presence of a minimum of 11 bp; pseudoknots with a shorter stem 1 were either non-functional or had reduced frameshift efficiency, despite the fact that a number of them had a stem 1 with a predicted stability equal to or greater than that of the wild-type IBV pseudoknot. An upper limit for stem 1 length was not determined, but pseudoknots containing a 12 or 13 bp stem 1 were fully functional. Structure probing analysis was carried out on RNAs containing either a ten or 11 bp stem 1; these experiments confirmed that both RNAs formed pseudoknots and appeared to be indistinguishable in conformation. Thus the difference in frameshifting efficiency seen with the two structures was not simply due to an inability of the 10 bp stem 1 construct to fold into a pseudoknot. In an attempt to identify other parameters which could account for the poor functionality of the shorter stem 1-containing pseudoknots, we investigated, in the context of the 10 bp stem 1 construct, the influence on frameshifting of altering the slippery sequence-pseudoknot spacing distance, loop 2 length, and the number of G residues at the bottom of the 5'-arm of stem 1. For each parameter, it was possible to find a condition where a modest stimulation of frameshifting was observable (about twofold, from seven to a maximal 17 %), but we were unable to find a situation where frameshifting approached the levels seen with 11 bp stem 1 constructs (48-57 %). Furthermore, in the next smaller construct (9 bp stem 1), changing the bottom four base-pairs to G.C (the optimal base composition) only stimulated frameshifting from 3 to 6 %, an efficiency about tenfold lower than seen with the 11 bp construct. Thus stem 1 length is a major factor in determining the functionality of this class of pseudoknot and this has implications for models of the frameshift process.     

Crystal structure of a luteoviral RNA pseudoknot and model for a minimal ribosomal frameshifting motif

To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter. Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.     

Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those pseudoknots with a short loop 2.     

Ribosomal Pausing at a Frameshifter RNA Pseudoknot Is Sensitive to Reading Phase but Shows Little Correlation with Frameshift Efficiency

Here we investigated ribosomal pausing at sites of programmed -1 ribosomal frameshifting, using translational elongation and ribosome heelprint assays. The site of pausing at the frameshift signal of infectious bronchitis virus (IBV) was determined and was consistent with an RNA pseudoknot-induced pause that placed the ribosomal P- and A-sites over the slippery sequence. Similarly, pausing at the simian retrovirus 1 gag/pol signal, which contains a different kind of frameshifter pseudoknot, also placed the ribosome over the slippery sequence, supporting a role for pausing in frameshifting. However, a simple correlation between pausing and frameshifting was lacking. Firstly, a stem-loop structure closely related to the IBV pseudoknot, although unable to stimulate efficient frameshifting, paused ribosomes to a similar extent and at the same place on the mRNA as a parental pseudoknot. Secondly, an identical pausing pattern was induced by two pseudoknots differing only by a single loop 2 nucleotide yet with different functionalities in frameshifting. The final observation arose from an assessment of the impact of reading phase on pausing. Given that ribosomes advance in triplet fashion, we tested whether the reading frame in which ribosomes encounter an RNA structure (the reading phase) would influence pausing. We found that the reading phase did influence pausing but unexpectedly, the mRNA with the pseudoknot in the phase which gave the least pausing was found to promote frameshifting more efficiently than the other variants. Overall, these experiments support the view that pausing alone is insufficient to mediate frameshifting and additional events are required. The phase dependence of pausing may be indicative of an activity in the ribosome that requires an optimal contact with mRNA secondary structures for efficient unwinding.     

Identification of novel ligands for the RNA pseudoknot that regulate -1 ribosomal frameshifting

In many viruses, -1 ribosomal frameshifting (-1RF) regulates synthesis of proteins and is crucial for virus production. An RNA pseudoknot is one of the essential components of the viral -1RF system. Thermodynamic or kinetic control of pseudoknot folding may be important in regulating the efficiency of -1RF. Thus, small molecules that interact with viral RNA pseudoknots may disrupt the -1RF system and show antiviral activity. In this study, we conducted virtual screening of a chemical database targeting the X-ray crystal structure of RNA pseudoknot complexed with biotin to identify ligands that may regulate an -1RF system containing biotin-aptamer as an RNA pseudoknot component. After docking screening of about 80,000 compounds, 58 high-ranked hits were selected and their activities were examined by in vitro and cell-based -1 frameshifting assays. Six compounds increased the efficiency of -1 frameshifting, and these are novel small molecule compounds that regulate the -1RF.     

Stem-loop structures can effectively substitute for an RNA pseudoknot in -1 ribosomal frameshifting

-1 Programmed ribosomal frameshifting (PRF) in synthesizing the gag-pro precursor polyprotein of Simian retrovirus type-1 (SRV-1) is stimulated by a classical H-type pseudoknot which forms an extended triple helix involving base-base and base-sugar interactions between loop and stem nucleotides. Recently, we showed that mutation of bases involved in triple helix formation affected frameshifting, again emphasizing the role of the triple helix in -1 PRF. Here, we investigated the efficiency of hairpins of similar base pair composition as the SRV-1 gag-pro pseudoknot. Although not capable of triple helix formation they proved worthy stimulators of frameshifting. Subsequent investigation of ～30 different hairpin constructs revealed that next to thermodynamic stability, loop size and composition and stem irregularities can influence frameshifting. Interestingly, hairpins carrying the stable GAAA tetraloop were significantly less shifty than other hairpins, including those with a UUCG motif. The data are discussed in relation to natural shifty hairpins.     

Heuristic RNA pseudoknot prediction including intramolecular kissing hairpins

Pseudoknots are an essential feature of RNA tertiary structures. Simple H-type pseudoknots have been studied extensively in terms of biological functions, computational prediction, and energy models. Intramolecular kissing hairpins are a more complex and biologically important type of pseudoknot in which two hairpin loops form base pairs. They are hard to predict using free energy minimization due to high computational requirements. Heuristic methods that allow arbitrary pseudoknots strongly depend on the quality of energy parameters, which are not yet available for complex pseudoknots. We present an extension of the heuristic pseudoknot prediction algorithm DotKnot, which covers H-type pseudoknots and intramolecular kissing hairpins. Our framework allows for easy integration of advanced H-type pseudoknot energy models. For a test set of RNA sequences containing kissing hairpins and other types of pseudoknot structures, DotKnot outperforms competing methods from the literature. DotKnot is available as a web server under http://dotknot.csse.uwa.edu.au.     

Single-Molecule Measurements of the CCR5 mRNA Unfolding Pathways

Secondary or tertiary structure in an mRNA, such as a pseudoknot, can create a physical barrier that requires the ribosome to generate additional force to translocate. The presence of such a barrier can dramatically increase the probability that the ribosome will shift into an alternate reading frame, in which a different set of codons is recognized. The detailed biophysical mechanism by which frameshifting is induced remains unknown. Here we employ optical trapping techniques to investigate the structure of a −1 programmed ribosomal frameshift (−1 PRF) sequence element located in the CCR5 mRNA, which encodes a coreceptor for HIV-1 and is, to our knowledge, the first known human −1 PRF signal of nonviral origin. We begin by presenting a set of computationally predicted structures that include pseudoknots. We then employ what we believe to be new analytical techniques for measuring the effective free energy landscapes of biomolecules. We find that the −1 PRF element manifests several distinct unfolding pathways when subject to end-to-end force, one of which is consistent with a proposed pseudoknot conformation, and another of which we have identified as a folding intermediate. The dynamic ensemble of conformations that CCR5 mRNA exhibits in the single-molecule experiments may be a significant feature of the frameshifting mechanism.     

A three-stemmed mRNA pseudoknot in the SARS coronavirus frameshift signal

A wide range of RNA viruses use programmed −1 ribosomal frameshifting for the production of viral fusion proteins. Inspection of the overlap regions between ORF1a and ORF1b of the SARS-CoV genome revealed that, similar to all coronaviruses, a programmed −1 ribosomal frameshift could be used by the virus to produce a fusion protein. Computational analyses of the frameshift signal predicted the presence of an mRNA pseudoknot containing three double-stranded RNA stem structures rather than two. Phylogenetic analyses showed the conservation of potential three-stemmed pseudoknots in the frameshift signals of all other coronaviruses in the GenBank database. Though the presence of the three-stemmed structure is supported by nuclease mapping and two-dimensional nuclear magnetic resonance studies, our findings suggest that interactions between the stem structures may result in local distortions in the A-form RNA. These distortions are particularly evident in the vicinity of predicted A-bulges in stems 2 and 3. In vitro and in vivo frameshifting assays showed that the SARS-CoV frameshift signal is functionally similar to other viral frameshift signals: it promotes efficient frameshifting in all of the standard assay systems, and it is sensitive to a drug and a genetic mutation that are known to affect frameshifting efficiency of a yeast virus. Mutagenesis studies reveal that both the specific sequences and structures of stems 2 and 3 are important for efficient frameshifting. We have identified a new RNA structural motif that is capable of promoting efficient programmed ribosomal frameshifting. The high degree of conservation of three-stemmed mRNA pseudoknot structures among the coronaviruses suggests that this presents a novel target for antiviral therapeutics.     

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.     

NMR structure of the Aquifex aeolicus tmRNA pseudoknot PK1: new insights into the recoding event of the ribosomal trans-translation

The transfer-messenger RNA (tmRNA) pseudoknot PK1 is essential for bacterial trans-translation, a ribosomal rescue mechanism. We report the solution structure of PK1 from Aquifex aeolicus, which despite an unprecedented small number of nucleotides and thus an unprecented compact size, displays a very high thermal stability. Several unusual structural features account for these properties and indicate that PK1 belongs to the class of ribosomal frameshift pseudoknots. This suggests a similarity between the mechanism of programmed ribosomal frameshifting and trans-translation.     

Biphasic folding kinetics of RNA pseudoknots and telomerase RNA activity

Using a combined master equation and kinetic cluster approach, we investigate RNA pseudoknot folding and unfolding kinetics. The energetic parameters are computed from a recently developed Vfold model for RNA secondary structure and pseudoknot folding thermodynamics. The folding kinetics theory is based on the complete conformational ensemble, including all the native-like and non-native states. The predicted folding and unfolding pathways, activation barriers, Arrhenius plots, and rate-limiting steps lead to several findings. First, for the PK5 pseudoknot, a misfolded 5' hairpin emerges as a stable kinetic trap in the folding process, and the detrapping from this misfolded state is the rate-limiting step for the overall folding process. The calculated rate constant and activation barrier agree well with the experimental data. Second, as an application of the model, we investigate the kinetic folding pathways for human telomerase RNA (hTR) pseudoknot. The predicted folding and unfolding pathways not only support the proposed role of conformational switch between hairpin and pseudoknot in hTR activity, but also reveal molecular mechanism for the conformational switch. Furthermore, for an experimentally studied hTR mutation, whose hairpin intermediate is destabilized, the model predicts a long-lived transient hairpin structure, and the switch between the transient hairpin intermediate and the native pseudoknot may be responsible for the observed hTR activity. Such finding would help resolve the apparent contradiction between the observed hTR activity and the absence of a stable hairpin.     

RNA dimerization plays a role in ribosomal frameshifting of the SARS coronavirus

Messenger RNA encoded signals that are involved in programmed -1 ribosomal frameshifting (-1 PRF) are typically two-stemmed hairpin (H)-type pseudoknots (pks). We previously described an unusual three-stemmed pseudoknot from the severe acute respiratory syndrome (SARS) coronavirus (CoV) that stimulated -1 PRF. The conserved existence of a third stem–loop suggested an important hitherto unknown function. Here we present new information describing structure and function of the third stem of the SARS pseudoknot. We uncovered RNA dimerization through a palindromic sequence embedded in the SARS-CoV Stem 3. Further in vitro analysis revealed that SARS-CoV RNA dimers assemble through ‘kissing’ loop–loop interactions. We also show that loop–loop kissing complex formation becomes more efficient at physiological temperature and in the presence of magnesium. When the palindromic sequence was mutated, in vitro RNA dimerization was abolished, and frameshifting was reduced from 15 to 5.7%. Furthermore, the inability to dimerize caused by the silent codon change in Stem 3 of SARS-CoV changed the viral growth kinetics and affected the levels of genomic and subgenomic RNA in infected cells. These results suggest that the homodimeric RNA complex formed by the SARS pseudoknot occurs in the cellular environment and that loop–loop kissing interactions involving Stem 3 modulate -1 PRF and play a role in subgenomic and full-length RNA synthesis.     

Functional analysis of the SRV-1 RNA frameshifting pseudoknot

Simian retrovirus type-1 uses programmed ribosomal frameshifting to control expression of the Gag-Pol polyprotein from overlapping gag and pol open-reading frames. The frameshifting signal consists of a heptanucleotide slippery sequence and a downstream-located 12-base pair pseudoknot. The solution structure of this pseudoknot, previously solved by NMR [Michiels,P.J., Versleijen,A.A., Verlaan,P.W., Pleij,C.W., Hilbers,C.W. and Heus,H.A. (2001) Solution structure of the pseudoknot of SRV-1 RNA, involved in ribosomal frameshifting. J. Mol. Biol., 310, 1109–1123] has a classical H-type fold and forms an extended triple helix by interactions between loop 2 and the minor groove of stem 1 involving base–base and base–sugar contacts. A mutational analysis was performed to test the functional importance of the triple helix for −1 frameshifting in vitro. Changing bases in L2 or base pairs in S1 involved in a base triple resulted in a 2- to 5-fold decrease in frameshifting efficiency. Alterations in the length of L2 had adverse effects on frameshifting. The in vitro effects were well reproduced in vivo, although the effect of enlarging L2 was more dramatic in vivo. The putative role of refolding kinetics of frameshifter pseudoknots is discussed. Overall, the data emphasize the role of the triple helix in −1 frameshifting.     

Mutational analysis of the RNA pseudoknot involved in efficient ribosomal frameshifting in simian retrovirus-1.

Mutational effects on frameshifting efficiency of the RNA pseudoknot involved in ribosomal frameshifting in simian retrovirus-1 (SRV-1) have been investigated. The primary sequence and the proposed secondary structure of the SRV-1 pseudoknot are similar to those of other efficient frameshifting pseudoknots in mouse mammary tumor virus (MMTV) and feline immunodeficiency virus (FIV), where an unpaired adenine nucleotide intercalates between stem 1 and stem 2. In SRV-1 pseudoknot, the adenine nucleotide in between stem 1 and stem 2 has a potential to form an A*U base pair with the last uridine nucleotide in the loop 2, resulting in a continuous A-form helix with coaxially stacked stem 1 and stem 2. To test whether this A*U base pairing and coaxial stacking of stem 1 and stem 2 is absolutely required for efficient frameshifting in SRV-1, a series of mutants changing this potential A.U base pair to either G.C base pair or A.A, A.G, A.C, G.A, G.G mismatch is generated, and their frameshifting efficiencies are investigated in vitro using rabbit reticulocyte lysate translation assay. The frameshifting abilities of these mutant pseudoknots are similar to that of the wild-type pseudoknot, suggesting that the A*U base pair in between stem 1 and stem 2 is not necessary to promote efficient frameshifting in SRV-1. These results reveal that coaxial stacking of stem 1 and stem 2 with a Watson-Crick A.U base pair in between two stems is not a required structural feature of the pseudoknot for promoting efficient frameshifting in SRV-1. Our mutational data suggest that SRV-1 pseudoknot adopts similar structural features common to other efficient frameshifting pseudoknots as observed in MMTV and FIV.     

Possible involvement of coaxially stacked double pseudoknots in the regulation of −1 programmed ribosomal frameshifting in RNA viruses

?1 programmed ribosomal frameshifting (PRF) in viruses is often stimulated by a pseudoknot downstream from the slippery sequence. At the PRF junction of HIV-1, transmissible gastroenteritis virus (TGEV), Barmah Forest virus (BFV), Fort Morgan virus (FMV), and Equine arteritis virus (EAV), we identified potential double pseudoknots in either a tandem mode or embedded mode. In viruses with tandem pseudoknots (5′PK & 3′PK), the slippery sequence is encompassed in the 5′PK. The ribosome needs to unwind the 5′PK to get to the slippery sequence. In HIV-1, the 3′PK and several alternative structures are mutually exclusive. Disruption of the tandem pseudoknots may enable one of the alternative structures to form as the effective frameshift stimulator. In TGEV/BFV/FMV, the 3′PK is a conventional frameshift stimulator. In all cases, the tandem pseudoknots may slow down the ribosome before it reaches the conventional PRF signals. In EAV, a compact pseudoknot is embedded within loop2 of the otherwise conventional frameshift-stimulating pseudoknot. All double pseudoknots have the potential to stack their stems coaxially. We built structural models of the HIV-1 and EAV double pseudoknots to show that both the tandem and embedded modes are feasible and reasonable. We hypothesize that the fundamental reason for the viruses to utilize coaxially stacked double pseudoknots is to increase the overall stability of the frameshift regulating structure, and avoid an ultra-stable single pseudoknot which may become a ribosomal roadblock. Our results significantly expand the repertoire of RNA structures and dynamics that may potentially involve in ?1 PRF regulation.     

mRNA pseudoknot structures can act as ribosomal roadblocks

Several viruses utilize programmed ribosomal frameshifting mediated by mRNA pseudoknots in combination with a slippery sequence to produce a well defined stochiometric ratio of the upstream encoded to the downstream-encoded protein. A correlation between the mechanical strength of mRNA pseudoknots and frameshifting efficiency has previously been found; however, the physical mechanism behind frameshifting still remains to be fully understood. In this study, we utilized synthetic sequences predicted to form mRNA pseudoknot-like structures. Surprisingly, the structures predicted to be strongest lead only to limited frameshifting. Two-dimensional gel electrophoresis of pulse labelled proteins revealed that a significant fraction of the ribosomes were frameshifted but unable to pass the pseudoknot-like structures. Hence, pseudoknots can act as ribosomal roadblocks, prohibiting a significant fraction of the frameshifted ribosomes from reaching the downstream stop codon. The stronger the pseudoknot the larger the frameshifting efficiency and the larger its roadblocking effect. The maximal amount of full-length frameshifted product is produced from a structure where those two effects are balanced. Taking ribosomal roadblocking into account is a prerequisite for formulating correct frameshifting hypotheses.     

Annexin A2 binds RNA and reduces the frameshifting efficiency of infectious bronchitis virus

Annexin A2 (ANXA2) is a protein implicated in diverse cellular functions, including exocytosis, DNA synthesis and cell proliferation. It was recently proposed to be involved in RNA metabolism because it was shown to associate with some cellular mRNA. Here, we identified ANXA2 as a RNA binding protein (RBP) that binds IBV (Infectious Bronchitis Virus) pseudoknot RNA. We first confirmed the binding of ANXA2 to IBV pseudoknot RNA by ultraviolet crosslinking and showed its binding to RNA pseudoknot with ANXA2 protein in vitro and in the cells. Since the RNA pseudoknot located in the frameshifting region of IBV was used as bait for cellular RBPs, we tested whether ANXA2 could regulate the frameshfting of IBV pseudoknot RNA by dual luciferase assay. Overexpression of ANXA2 significantly reduced the frameshifting efficiency from IBV pseudoknot RNA and knockdown of the protein strikingly increased the frameshifting efficiency. The results suggest that ANXA2 is a cellular RBP that can modulate the frameshifting efficiency of viral RNA, enabling it to act as an anti-viral cellular protein, and hinting at roles in RNA metabolism for other cellular mRNAs.