Positive selection system for identification of recombinants using alpha-complementation plasmids

A number of selection systems have been developed for direct selection of recombinant plasmids in cloning experiments (positive selection). In this study, the Commonly used LacZ-based alpha-complementation plasmid vectors have been used for designing a positive selection system for the selection of recombinants. The basis for the Strategy is the phenomenon of galactose sensitivity exhibited by galactose epimerase (galE) mutants of Escherichia coli. It is known that lacZ+ galE, but not lacZ- galE cells are killed upon addition of lactose due to the accumulation of a toxic intermediate, UDP-galactose, by hydrolysis of lactose. Using a galE mutant strain of E. coli that carries the lacZAM15 allele, various alpha-complementation plasmids that vary in their copy number were examined for their ability to be killed following addition of lactose. The results show that some plasmids that exhibit relatively high beta-galactosidase enzyme activity can be used effectively for positive selection. This selection would be extremely useful during primary cloning experiments such as construction of genomic or cDNA libraries and also in instances involving selection for rare recombinants.     

Effect of plasmid copy number and lac operator sequence on antibiotic-free plasmid selection by operator-repressor titration in Escherichia coli

The Escherichia coli strain DH1lacdapD enables plasmid selection and maintenance that is free from antibiotics and selectable marker genes. This is achieved by using only the lac operator sequence as a selectable element. This strain is currently used to generate high copy number plasmids with no antibiotic resistance genes for use as DNA vaccines and for expression of recombinant proteins. Until now these have been limited to pUC-based plasmids containing a high copy number pMB1-derived origin of replication, and the principle lacO(1) and auxiliary lacO(3) operators. In this study we have shown that this system can also be used to select and maintain pBR322-based plasmids with the lower copy number pMB1 origin of replication, and that lacO(1) alone or a palindromic version of lacO(1) can provide a sufficient level of repressor titration for plasmid selection. This is advantageous for recombinant protein production, where low copy number plasmids are often used and plasmid maintenance is important. The degree of repressor titration due to these plasmids was measured using the natural lactose operon in E. coli DH1 as a model.     

Determination of the localization of the kcpA gene on the chromosome of E. coli O124. I. Use of the type F' plasmids of varying length]

The loss of virulence was observed in some of the transconjugates of E. coli O124 in the process of the transfer of the plasmids differing in length: F' 200 PS, F'x 573 and F'x 363, carrying the genes of the chromosome area lac--pur E. The genetic determinants contributing to the ability of E. coli O124 to produce keratoconjunctivitis seem to be localized near the lactose marker, and not near E as in Sh. flexneri. In E. coli O124 these genetic determinants are probably localized on both sides of the lactose operon.     

Molecular cloning and expression in E. coli of a yeast gene coding for beta-galactosidase.

The yeast Kluyveromyces lactis synthesizes a beta-galactosidase (EC 3.2.1.32) which is inducible by lactose. We have isolated the gene that codes for this enzyme using recombinant DNA techniques. K. lactis DNA was partially digested with the restriction endonuclease Eco R1 and joined to Eco R1-digested pBR322 plasmid DNA using DNA ligase. ligase. A lac-mutant of Escherichia coli lacking the structural gene for beta-galactosidase was transformed with ligated DNA. Three lac+ transformants containing recombinant plasmids were selected. Two of the plasmids (pK15 and pK17) contain four Eco R1-K. lactis DNA fragments having molecular weights of 2.2, 1.4, 0.55 and 0.5 x 10(6) daltons. The other plasmid (pK16) lacks the smallest fragment. E. coli carrying any of these plasmids produce beta-galactosidase activity that has a sedimentation coefficient and immunological determinants that are nearly identical to K. lactis beta-galactosidase and distinctly different from E. coli beta-galactosidase. DNA-DNA hybridization studies show that the four Eco R1 fragments in pK15 hybridize to K. lactis but not to E. coli DNA.     

Galactoside-dependent proton transport by mutants of the Escherichia coli lactose carrier: substitution of tyrosine for histidine-322 and of leucine for serine-306

The lac Y genes from two Escherichia coli mutants, MAB20 and AA22, have been cloned in a multicopy plasmid by a novel 'sucrose marker exchange' method. Characterization showed that the plasmids express a lactose carrier with poor affinity for lactose. Neither mutant carried out concentrative uptake with methyl beta-D-galactopyranoside, lactose, or melibiose as the substrate. Nor did the mutants catalyze counterflow or exchange with methyl beta-D-galactopyranoside. Both mutants did, however, retain the capacity to carry out facilitated diffusion with lactose or melibiose. DNA sequencing revealed that MAB20 (histidine-322 to tyrosine) and AA22 (serine-306 to leucine) have amino acid substitutions within the putative 'charge-relay' domain thought to be responsible for proton transport. Galactoside-dependent H+ transport was readily measured in both mutants. We conclude, therefore, that the presence of a histidine residue at position 322 of the lactose carrier is not obligatory for H+ transport per se.     

Cloning and expression of the beta-D-phosphogalactoside galactohydrolase gene of Lactobacillus casei in Escherichia coli K-12.

Lactose metabolism in Lactobacillus casei 64H is associated with the presence of plasmid pLZ64. This plasmid determines both phosphoenolpyruvate-dependent phosphotransferase uptake of lactose and beta-D-phosphogalactoside galactohydrolase. A shotgun clone bank of chimeric plasmids containing restriction enzyme digest fragments of pLZ64 DNA was constructed in Escherichia coli K-12. One clone contained the gene coding for beta-D-phosphogalactoside galactohydrolase on a 7.9-kilobase PstI fragment cloned into the vector pBR322 in E. coli strain chi 1849. The beta-D-phosphogalactoside galactohydrolase enzyme isolated from E. coli showed no difference from that isolated from L. casei, and specific activity of beta-D-phosphogalactoside galactohydrolase was stimulated 1.8-fold in E. coli by growth in media containing beta-galactosides. A restriction map of the recombinant plasmid was compiled, and with that information, a series of subclones was constructed. From an analysis of the proteins produced by minicells prepared from transformant E. coli cells containing each of the recombinant subclone plasmids, it was found that the gene for the 56-kilodalton beta-D-phosphogalactoside galactohydrolase was transcribed from an L. casei-derived promoter. The gene for a second protein product (43 kilodaltons) was transcribed in the opposite direction, presumably under the control of a promoter in pBR322. The relationship of this second product to the lactose metabolism genes of L. casei is at present unknown.     

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.     

Transforming activity of R- and Lac-plasmids of clinical strains of Gram-negative bacteria]

The isolated plasmid DNA of clinical strains of Gram-negative bacteria were shown to have transforming activity when E. coli strain 0600 and S. typhimurium strain LT-2 were used as recipients. The frequency of transformation depended on the recipient strain and the character of the plasmids. The presence of deletion mutants was revealed among the transformants. Such mutants occurred with varying frequency, most often in S. typhimurium strain LT-20; the reason for this phenomenon is at present under discussion. The transformation of plasmids controlling lactose splitting and their conjugation transfer into recipient S. typhimurium strain LT-2 is possible only under condition of using recipient (R+). The possibility of the formation of the cointegrate (R and lac plasmids) in recipient S. typhimurium strain LT-2 is discussed.     

Interaction of Shigella sonnei phase-I strains carrying F'- or R386 plasmids with continuous HeLa- and L-line cells

The region of S. sonnei chromosome, located to the left of the gene lac I, has been found to be linked with the capacity of these bacteria for penetrating epithelial cells: this capacity is sharply suppressed in transconjugates carrying plasmids F' which cover the above-mentioned chromosomal region in recipients. The loss of virulence by transconjugates with transferred plasmids F'lac is not linked with the transfer of F factor proper, as those transconjugates which have acquired plasmids F' from E. coli donor strains K = 12 X 363 or F'his 131, not covering the lactose region to the left of the gene lac I, retain their virulence. The transfer of plasmid R 386 having no analogs of bacterial chromosomal genes leads to the loss of virulence due to the oss of the invasive capacity of bacteria.     

Gene fusion vehicles for the analysis of gene expression in Rhizobium meliloti.

A set of plasmid cloning vehicles was developed to facilitate the construction of gene or operon fusions in Rhizobium meliloti. The vehicles also contain a broad-host-range replicon and could be introduced into bacteria either by transformation or by transduction, using bacteriophage P2. Insertion of foreign DNA into a unique restriction endonuclease cleavage site promotes the synthesis of either the Escherichia coli lactose operon or the kanamycin phosphotransferase gene from transposon Tn5. Expression of the lactose operon could be detected by observing the color of Rhizobium colonies on medium that contained a chromogenic indicator. We also determined the growth conditions that make it possible to select either for or against the expression of the E. coli lactose operon in R. meliloti. Recombinant plasmids were constructed by inserting MboI restriction fragments of R. meliloti DNA into one of the vehicles, pMK353 . Expression of beta-galactosidase by a number of these recombinants was measured in both R. meliloti and E. coli.     

Lactose metabolism in Lactobacillus bulgaricus: analysis of the primary structure and expression of the genes involved.

The genes coding for the lactose permease and beta-galactosidase, two proteins involved in the metabolism of lactose by Lactobacillus bulgaricus, have been cloned, expressed, and found functional in Escherichia coli. The nucleotide sequences of these genes and their flanking regions have been determined, showing the presence of two contiguous open reading frames (ORFs). One of these ORFs codes for the lactose permease gene, and the other codes for the beta-galactosidase gene. The lactose permease gene is located in front of the beta-galactosidase gene, with 3 bp in the intergenic region. The two genes are probably transcribed as one operon. Primer extension studies have mapped a promoter upstream from the lactose permease gene but not the beta-galactosidase gene. This promoter is similar to those found in E. coli with general characteristics of GC-rich organisms. In addition, the sequences around the promoter contain a significantly higher number of AT base pairs (80%) than does the overall L. bulgaricus genome, which is rich in GC (GC content of 54%). The amino acid sequences obtained from translation of the ORFs are found to be highly homologous (similarity of 75%) to those from Streptococcus thermophilus. The first 460 amino acids of the lactose permease shows homology to the melibiose transport protein of E. coli. Little homology was found between the lactose permease of L. bulgaricus and E. coli, but the residues which are involved in the binding and the transport of lactose are conserved. The carboxy terminus is similar to that of the enzyme III of several phosphoenolpyruvate-dependent phosphotransferase systems.     

Cloning of Escherichia coli lacZ and lacY genes and their expression in Gluconobacter oxydans and Acetobacter liquefaciens

An efficient transformation protocol for Gluconobacter oxydans and Acetobacter liquefaciens strains was developed by preparation of electrocompetent cells grown on yeast extract-ethanol medium. Plasmid pBBR122 was used as broad-host-range vector to clone the Escherichia coli lacZY genes in G. oxydans and A. liquefaciens. Although both lac genes were functionally expressed in both acetic acid bacteria, only a few transformants were able to grow on lactose. However, this ability strictly depended on the presence of a plasmid expressing both lac genes. Mutations in the plasmids and/or in the chromosome were excluded as the cause of growth ability on lactose.     

Conversion of pBR322-based plasmids into broad-host-range vectors by using the Tn3 transposition mechanism.

We constructed a series of transposon vectors which allow efficient in vitro gene manipulation and subsequent introduction of cloned DNA into a variety of gram-negative bacteria. Transfer of the cloned fragment from these multicopy plasmids into self-transmissible broad-host-range vectors is achieved in vivo, using the Tn3 transposition mechanism. Transposition into a variety of broad-host-range plasmids proceeds efficiently, and the resulting recombinant plasmids can be readily transferred and maintained in a variety of gram-negative bacteria. The utility of the transposable vectors was demonstrated by the introduction and expression of the lacIPOZY sequences of Escherichia coli into Pseudomonas putida strains, allowing them to utilize lactose as a sole source of carbon and energy.     

Sugar transport by the bacterial phosphotransferase system. In vivo regulation of lactose transport in Escherichia coli by IIIGlc, a protein of the phosphoenolpyruvate:glycose phosphotransferase system

Escherichia coli and Salmonella typhimurium preferentially utilize sugar substrates of the phosphoenol-pyruvate:glycose phosphotransferase system (PTS) when the growth medium also contains other sugars. This phenomenon, diauxic growth, is regulated by the crr gene, which encodes the PTS protein IIIGlc (Saffen, D.W., Presper, K.A., Doering, T.L., and Roseman, S. (1987) J. Biol. Chem. 16241-16253). We have proposed that non-PTS permeases are regulated by their interaction with IIIGlc, and in vitro studies from other laboratories have provided support for this model, but the in vivo effects of excess IIIGlc are not known. In the present studies, transformed cells that overproduced IIIGlc 2- and 10-fold, respectively, were constructed from a pts+ strain of E. coli and plasmids containing the crr gene. In the 2-fold overproducer, fermentation of, and growth on the non-PTS carbohydrates glycerol, lactose, maltose, and melibiose was generally more sensitive to the glucose analogue methyl-alpha-D-glucopyranoside than in a control strain containing normal levels of IIIGlc. In addition, inhibition of lactose permease activity by methyl-alpha-glucoside (inducer exclusion) was more effective in the 2-fold overproducer than in the control strain, particularly when the permease activity was high. The 10-fold IIIGlc overproducing strain had a requirement for the amino acids methionine, isoleucine, leucine, and valine that may or may not be related to the increased concentration of IIIGlc. Fermentation of non-PTS carbohydrates was also poor in the latter strain. Finally, lactose permease activity was 50% of that in control cells containing the same levels of beta-galactosidase, and the lactose permease activity in the IIIGlc overproducer was reduced to an extremely low level in the presence of methyl alpha-glucoside. Thus there is an inverse relationship between the cellular concentration of IIIGlc and the ability to metabolize non-PTS substrates. The results are consistent with the model where inducer exclusion is affected by a direct interaction between IIIGlc and a non-PTS transport system.     

High-frequency, site-specific recombination between lactococcal and pAM beta 1 plasmid DNAs.

In vivo recombination events involving the 75-kilobase lactose proteinase plasmid pCI301 of Lactococcus lactis subsp. lactis UC317 and the conjugative enterococcal plasmid pAM beta 1 were analyzed. A fragment, identified as containing the pCI301 recombination site, mediated greatly elevated levels of mobilization and recombination with pAM beta 1 when cloned in a nonmobilizable L. lactis-Escherichia coli shuttle vector. This latter recombination event was site and orientation specific on both plasmids. Recombination on pAM beta 1 was within the region associated with plasmid replication, but no effect on pAM beta 1 replication functions was detected. Resolution of recombinant plasmids generated derivatives indistinguishable from the parental plasmids.     

Study of the transmissibility of multiple drug resistance and the capacity to ferment lactose in a clinical strain of Kl. pneumoniae]

The donor properties of K. pneumoniae PI 220 with multiple drug resistance were studied. It was shown that the above strain carried 2 plasmids, i.e. R-plasmid pPI 220 controling resistance to ampicillin, streptomycin, tetracycline, chloramphenicol, kanamycin and sulphanylamides and plasmid pPI 221 controlling lactose fermentation. Both plasmids can be transfered on conjugation to strain E. coli P678 at a temperture of 28 degrees C at a rate of 10(-5) for pPI 220 and 10(-4) for pPI 221. The drug resistance controlled by pPI 221 was transfered mainly in a "blocks" simultaneously to 6 drugs. Deletion of plasmid pPI 220 was observed rarely. The donor properties of the strain were defined by the conjugative plasmid pPI 220 controlling the self-transfer and mobilization of plasmid pPI 221 incapable of the self-transfer. E. coli P678 (pPI 220) (PPI 221) acquired the donor properties and transfered both plasmids to E. coli J62 on crossing simultaneously at a rate of 10(-2), as well as to S. typhimurium LT2 and P. rettgeri at a rate of 10(-5). In all the recipient strains studied the transfered plasmids were unstable and segregated also simultaneously at a rate being the highest for P. retgari PI 230. The clones with stable preservation of the plasmids could be obtained by selection.     

Characterization and molecular cloning of cryptic plasmids isolated from Lactobacillus casei

Four small cryptic plasmids were isolated from Lactobacillus casei strains, and restriction endonuclease maps of these plasmids were constructed. Three of the small plasmids (pLZ18C, pLZ19E, and pLZ19F1; 6.4, 4.9, and 4.8 kilobase pairs, respectively) were cloned into Escherichia coli K-12 by using pBR322, pACYC184, and pUC8 as vectors. Two of the plasmids, pLZ18C and pLZ19E, were also cloned into Streptococcus sanguis by using pVA1 as the vector. Hybridization by using nick-translated cloned 32P-labeled L. casei plasmid DNA as the probe revealed that none of the cryptic plasmids had appreciable DNA-DNA homology with the large lactose plasmids found in the L. casei strains, with chromosomal DNAs isolated from these strains. Partial homology was detected among several plasmids isolated from different strains, but not among cryptic plasmids isolated from the same strain.     

Homologous recombination and mutagenesis of gamma-irradiated plasmid DNA in Escherichia coli host cells

Plasmid DNA was used to study gamma-radiation-induced recombination and mutagenesis in Escherichia coli host cells. Plasmid pBRP1, a derivative of pBR322 containing the lac operon of E. coli, was irradiated with 60Co gamma rays prior to transformation into E. coli strains of different recA and lac genotypes. Plasmid-chromosome recombination was assayed in lacY1 host cells, whereas plasmid mutagenesis was assayed in delta lac host cells lacking chromosomal sequences homologous to the plasmid. Both recombinant and mutant plasmids were identified by the phenotypic changes in lactose utilization, and confirmed by restriction analysis of isolated plasmids. Plasmid-chromosome recombination was induced to high levels (about 20% of survivors at 700 Gy) and was dependent on the host recA gene. Plasmid mutagenesis occurred at lower levels (about 1.5% of survivors at 600 Gy) and was relatively independent of the recA gene. Plasmid survival was unaffected by the presence or absence of host recA mutations or the potential for plasmid-chromosome recombination.