Accumulation and regulation of elastin in the rat uterus

The relative levels of elastin-specific mRNA were used as a measure of tropoelastin expression in uteri from pregnant Sprague-Dawley rats. The levels of elastin-specific mRNA were also correlated with values for net tropoelastin production and net deposition of mature, crosslinked elastin. The total content of uterine elastin increased throughout gestation, reaching maximal levels at Day 19 of gestation, which were three times those of nongravid tissue. Following involution, the elastin content decreased rapidly to near baseline values by 5 days postpartum. The content of soluble elastin, estimated using an enzyme-linked immunosorbent assay, paralleled in part the increase in elastin deposition and elastin mRNA levels. Uterine elastin metabolism appears to be unlike that in other elastic tissues, e.g., lung and large blood vessels. In most elastin containing tissues, the protein is synthesized during discrete developmental periods and is not readily degraded. However, uterine elastin is continuously expressed, and appears to be in a continual cycle of degradation and replacement.     

Elastase activity of fungi with anamorphs similar to Coccidioides immitis

The elastin digestion assay was examined to determine if it would facilitate the identification of Coccidioides immitis when non-pathogenic fungi resembling C. immitis are encountered. Fungal isolants tested have anamorphs that closely resemble the macroscopic or microscopic morphology of C. immitis. Elastin hydrolysis was measured by elastin-agar plate assays. Approximately 80% of the isolants hydrolyzed elastin; thus, the elastin digestion assay as a differential test appears to have little value.     

Primary enzyme quantitation using substrates labeled with a second indicator enzyme. I. Elastase determination using peroxidase-labeled elastin

Quantitation of proteolytic enzyme concentration can be accomplished by measuring the release, due to primary enzyme catalysis, of a second enzyme bound to a particulate substrate. As the primary enzyme acts on the substrate, release of the indicator enzyme into the surrounding medium occurs, which in turn can be quantitated colorimetrically, and under suitable reaction conditions the amount of indicator enzyme released is directly proportional to the amount of primary enzyme present. A specific example of such an assay is that for elastolytic activity using powdered elastin labeled with horseradish peroxidase. The detection sensitivity of the system described is 1 ng/ml of pancreatic elastase, and the dynamic range of the assay is 2 orders of magnitude. The reaction time for optimal elastase detection sensitivity is 3 h. For the assay, horseradish peroxidase is coupled to insoluble elastin. Labeled elastin is incubated with varying amounts of pancreatic elastase. The elastase in the test sample solubilizes the elastin and the horseradish peroxidase bound to it. The amount of peroxidase released is then quantified using the colorimetic reaction produced by catalysis of 2,2′-azino-di-(3-ethyl-benzthiazoline-6-sulfonate)-H₂O₂. For a fixed, nonsaturating concentration of elastase, the amount of peroxidase released is proportional to the elastase concentration.     

Galectin-3 regulates the adhesive interaction between breast carcinoma cells and elastin.

Galectin-3 is a beta-galactoside binding lectin whose precise physiological role is not yet defined. In the present studies, we questioned whether galectin-3 plays a role in the adhesion of breast carcinoma cells to elastin. The impetus for this analysis was the initial observation that the cellular receptor for elastin, the 67 kDa elastin/laminin protein may have galectin-like properties (Mecham et al. [1989] J. Biol. Chem. 264:16652-16657). We therefore analyzed the adhesion of breast carcinoma cells to microtiter wells coated with elastin under conditions which eliminate integrin participation in adhesion. The adhesion assay was done in the absence and presence of purified recombinant galectin-3. We hereby demonstrate that high concentrations of galectin-3 ligate breast carcinoma cells to microtiter wells coated with elastin. Galectin-3 also demonstrated a specific binding interaction with purified elastin in a dose and lactose dependent manner. Furthermore we demonstrated by immunoprecipitation that endogenous galectin-3 in breast carcinoma cells is associated with tropoelastin. Lastly, the breast carcinoma cells which expressed galectin-3 on their surface, demonstrated enhanced cellular proliferation on elastin compared to galectin-3 null expressing cells. These studies suggest that galectin-3 is capable of regulating the interactions between cells and elastin.     

A Versatile Microassay for Elastase Using Succinylated Elastin

We have developed a rapid, versatile, and sensitive elastase assay that is based on the measurement of primary amines that are exposed due to enzymatic degradation of proteins, using succinylated elastin as the substrate for elastase. After incubation with elastase the degree of digestion is determined with trinitrobenzene sulfonic acid. The assay is rapid and sensitive, detecting elastase down to 1 ng/ml, and is linear up to enzyme concentrations of 10 μg/ml. The assay is carried out in microtiter plate wells and therefore offers the potential for assaying numerous samples of small volume. The use of succinylated elastin shows specificity for elastase over the control protease, trypsin. This assay is also versatile because it can be applied to samples such as cell culture supernatants, blood plasma, tissue biopsies, and tissue homogenates.     

Effects of amiodarone on elastin biosynthesis in primary hamster lung cell cultures

Amiodarone is a Class III antiarrhythmic agent that has been implicated as a cause of human pulmonary fibrosis. Pulmonary fibrosis is associated with increased levels of connective tissue proteins such as collagen and elastin. The purpose of this investigation was to determine whether elastin synthesis would be altered by in vitro amiodarone administration. Primary hamster lung cell cultures were utilized. Cultures were treated with 2, 10, and 20 micrograms/ml amiodarone. Following treatment, elastin synthesis was monitored by a biochemical tracer assay based on the presence of the cross-linking amino acids: desmosine/isodesmosine. These cross-links are found only in elastin. Addition of [14C] lysine to cultures results in uptake of the radiolabel into the cross-links. Cross-links were isolated and identified using chromatography and electrophoresis. At all doses of amiodarone, elastin synthesis was seen to increase above control levels. Light and electron microscopy confirmed the presence of an extracellular matrix. The morphologic studies also revealed the presence of cytoplasmic inclusion bodies and vacuoles that are often associated with cationic, amphiphilic drugs such as amiodarone.     

In vitro assay of extracellular matrix elastin degradation

This report describes a method for determining specifically and sensitively the degradation of the elastin component within complicated extracellular matrices in vitro. Extracellular matrices rich in elastin were metabolically labeled with [3H]lysine during 3 week cultures of smooth muscle cells under ascorbate-free conditions in vitro. Elastin was quantitated on the basis of labeled desmosine/isodesmosine in the matrices as determined by a cation-exchange HPLC program utilizing a Beckman 6300 amino acid analyzer. The net loss of desmosine/isodesmosine during co-culture of human macrophages with the matrices was then used to assay cellular elastin degradation. This method allows for the production of reproducibly labeled matrices and compares favorably with previously described techniques of elastin degradation by live cells in vitro.     

The use of tritiated elastin for the determination of subnanogram amounts of elastase

A procedure to quantitate trace amounts of elastase in tissue or cell homogenate preparations is described. The procedure is a modification of a method employing NaB³H₄-reduced elastin and it does not restrict assay volume. The assay is specific and can distinguish between pancreatic elastase and trypsin or chymotrypsin, both of which solubilize small amounts of the substrate. Pancreatic elastase remains active in this assay system for at least 4 weeks.     

A Fluorometric Assay for Detection of Lysyl Oxidase Enzyme Activity in Biological Samples

Lysyl oxidase catalyzes the final known enzymatic step required for collagen and elastin cross-linking in the biosynthesis of normal mature functional insoluble extracellular matrices. In addition, lysyl oxidase has been identified as a possible tumor suppressor. Lysyl oxidase activity in biological samples is traditionally and most reliably assessed by tritium release end-point assays using radiolabeled collagen or elastin substrates involving laborious vacuum distillation of the released tritiated water. In addition, a less sensitive fluorometric method exists that employs nonpeptidyl amine lysyl oxidase substrates and measures hydrogen peroxide production with horseradish peroxidase coupled to homovanillate oxidation. The present study describes a more sensitive fluorescent assay for lysyl oxidase activity that utilizes 1,5-diaminopentane as substrate, and released hydrogen peroxide is detected using Amplex red in horseradish peroxidase-coupled reactions. This method allows the detection of 40 ng of enzyme per 2 ml assay at 37 degrees C and is 7.5 times more sensitive than the currently available fluorometric assay for enzyme activity. This method eliminates the interference that occurs in some biological samples and can be successfully used to detect lysyl oxidase activity in cell culture experiments.     

Pseudomonas aeruginosa protease IV enzyme assays and comparison to other Pseudomonas proteases

Pseudomonas aeruginosa secretes multiple proteases that have been implicated as virulence factors and the detection of each specific enzyme can be difficult to determine. Unlike the three Pseudomonas enzymes that have been well characterized (elastase A, elastase B, and alkaline protease), the activity of protease IV in multiple assays has yet to be described. This study defines new assays for Pseudomonas proteases and compares protease IV activity to the activities of elastase A, elastase B, and alkaline protease. Six in vitro assays were studied: zymography, elastin congo red assay, staphylolytic assay, colorimetric peptide assay, solid-phase colorimetric peptide assay, and poly-l-lysine degradation. Casein zymography distinguished protease IV from elastase B and alkaline protease, and gelatin zymography differentiated all four proteases. The elastin congo red assay detected mainly elastase B while the staphylolytic assay was specific for elastase A. Protease IV activity was assayed specifically by the colorimetric assay and two new assays, the solid-phase colorimetric assay and degradation of poly-L-lysine in the presence of EDTA. Alkaline protease could be specifically assayed by poly-L-lysine degradation in the presence of N-alpha-p-tosyl-L-lysine chloromethyl ketone. The results identified three specific assays for protease IV, a new assay specific for alkaline protease, and showed that protease IV has a distinct enzymatic specificity relative to the three other Pseudomonas proteases.     

Immunochemical and immunohistochemical studies on distribution of elastin fibres in human atherosclerotic lesions using a polyclonal antibody to elastin-derived hexapeptide repeat

A polyclonal antibody to elastin-derived hexapeptide repeat, H-(Val-Gly-Val-Ala-Pro-Gly)(3)-NH(2), was prepared in order to investigate the differences between elastin fibres in intimal hyperplasia and media in human atheroscleroic lesions. The hexapeptide repeat and alpha-elastin were recognized by this polyclonal antibody in enzyme-linked immunosorbent assay (ELISA), but other elastin-derived peptides such as tetrapeptide repeat, pentapeptide repeat and nonapeptide were not. In the series of hexapeptide repeats, H-(VGVAPG)(n)-NH(2) where n is 1-7, the polyclonal antibody reacted strongly with oligomers (n = 3-7) and weakly with dimer (n = 2), but not with monomer (n = 1). CD measurements suggested that the beta-turn structure is important for recognition by the polyclonal antibody. In an immunohistochemical study, elastin was stained more strongly in intimal hyperplasia than in media, suggesting that newly synthesized elastin in intimal hyperplasia is morphologically distinct from that in media.     

Vascular smooth muscle cell detachment from elastin and migration through elastic laminae is promoted by chondroitin sulfate-induced “shedding” of the 67-kDa cell surface elastin binding protein

Impaired elastin fiber assembly is observed in the fetal ductus arteriosus (DA), associated with a reduced concentration of elastin binding protein (EBP), a 67-kDa galactolectin. It is also seen in cultured aortic (Ao) smooth muscle cells (SMC) following the release of the EBP by glycosaminoglycans rich in AN-acetylgalactosamine, such as chondroitin sulfate (CS). In the DA, impaired elastin fiber assembly is observed in conjunction with intimal thickening associated with increased migration of SMC into the subendothelium, a feature we previously related to increased production of fibronectin. In this report, we determined whether SMC use the EBP to attach to an elastin substrate, whether shedding of the EBP promotes SMC migration through a threedimensional network of pure elastic laminae prepared from sheep aorta, and whether the latter is associated with increased production of fibronectin. We observed reduced attachment to elastin-coated surfaces of DA SMC deficient in EBP compared to Ao SMC. Addition of CS but not heparan sulfate (a glycosaminoglycan which does not induce EBP shedding) decreased Ao SMC attachment to elastin, as did preincubation with VGVAPG elastin-derived peptides which saturate the EBP. The immunolocalization of cell surface EBP suggested that cells can quickly replace EBP released from their surfaces by CS treatment. The magnitude of CS-induced impaired attachment of SMC to elastin was dose dependent and could be further increased by the administration of cyclohexamide and sodium azide. Also, the reversibility of CS-induced detachment was prevented by monensin. This suggests that a process of new synthesis and intracellular transport of the EBP was necessary to replace the EBP molecules released from the cell surface by CS treatment. In the migration assay, both DA and Ao SMC attached to the top of an elastin membrane, but only DA SMC deficient in EBP migrated through the laminae. Addition of CS, which induced shedding of EBP, resulted in Ao SMC migration associated with increased synthesis of fibronectin. We postulate that CS-induced release of EBP from SMC surfaces causes cell detachment from elastin and an increase in fibronectin synthesis, processes which may be critical in promoting SMC migration associated with intimal thickening developmentally in the DA and perhaps also in vascular disease.     

Vascular smooth muscle cell detachment from elastin and migration through elastic laminae is promoted by chondroitin sulfate-induced "shedding" of the 67-kDa cell surface elastin binding protein.

Impaired elastin fiber assembly is observed in the fetal ductus arteriosus (DA), associated with a reduced concentration of elastin binding protein (EBP), a 67-kDa galactolectin. It is also seen in cultured aortic (Ao) smooth muscle cells (SMC) following the release of the EBP by glycosaminoglycans rich in N-acetylgalactosamine, such as chondroitin sulfate (CS). In the DA, impaired elastin fiber assembly is observed in conjunction with intimal thickening associated with increased migration of SMC into the subendothelium, a feature we previously related to increased production of fibronectin. In this report, we determined whether SMC use the EBP to attach to an elastin substrate, whether shedding of the EBP promotes SMC migration through a three-dimensional network of pure elastic laminae prepared from sheep aorta, and whether the latter is associated with increased production of fibronectin. We observed reduced attachment to elastin-coated surfaces of DA SMC deficient in EBP compared to Ao SMC. Addition of CS but not heparan sulfate (a glycosaminoglycan which does not induce EBP shedding) decreased Ao SMC attachment to elastin, as did preincubation with VGVAPG elastin-derived peptides which saturate the EBP. The immunolocalization of cell surface EBP suggested that cells can quickly replace EBP released from their surfaces by CS treatment. The magnitude of CS-induced impaired attachment of SMC to elastin was dose dependent and could be further increased by the administration of cyclohexamide and sodium azide. Also, the reversibility of CS-induced detachment was prevented by monensin. This suggests that a process of new synthesis and intracellular transport of the EBP was necessary to replace the EBP molecules released from the cell surface by CS treatment. In the migration assay, both DA and Ao SMC attached to the top of an elastin membrane, but only DA SMC deficient in EBP migrated through the laminae. Addition of CS, which induced shedding of EBP, resulted in Ao SMC migration associated with increased synthesis of fibronectin. We postulate that CS-induced release of EBP from SMC surfaces causes cell detachment from elastin and an increase in fibronectin synthesis, processes which may be critical in promoting SMC migration associated with intimal thickening developmentally in the DA and perhaps also in vascular disease.     

Development of a peroxidase-coupled fluorometric assay for lysyl oxidase

Lysyl oxidase catalyzes the oxidation of peptidyl lysine in elastin and collagen and also acts upon nonpeptidyl amines, although the enzyme becomes slowly inactivated while processing nonpeptidyl substrates. In spite of this complexity, it has been possible to devise a continuously monitored peroxidase-coupled fluorometric assay for the oxidation of simple amines by lysyl oxidase. In the present study, optimal assay conditions have been explored and found to include assay temperatures of 50 to 60°C, the presence of urea in the assay, and the use of diaminopentane as substrate. Although the assay is subject to interference by contaminating macromolecules in enzyme fractions, a linear assay response to enzyme concentration is obtained with highly purified lysyl oxidase with a limiting sensitivity of 0.3 μg of enzyme per assay.     

A sensitive and specific enzyme assay for elastase activity using α-[3H]elastin as substrate

A method for the determination of elastase activity is described which uses soluble α-[³H]elastin as substrate. Soluble α-elastin was shown to have the same substrate specificity as natural insoluble elastin. At a substrate concentration of 1 mg/ml, approximately three times half-saturating substrate concentration, the assay is rapid, 1 h, sensitive, 10 ng/ml elastase, and linear up to an enzyme concentration of 250 ng/ml. The addition of 1000 μ/ml Trasylol or 10^?4mN-α-tosyl-l-lysyl chloromethane and 10^?4m tosyl-l-phenylalanyl chloromethane allowed the specific measurement of elastase activity in the presence of trypsin and chymotrypsin activity.     

A comparative analysis of the amino acid and cDNA sequences of bovine elastin a and chick elastin

A comparative analysis of the amino acid and cDNA sequences of bovine elastin a and chick elastin shows that there are considerable differences between these proteins. There is evidence that duplication of segments of DNA and gene rearrangement have occurred in the gene for chick elastin as compared with the gene for bovine elastin. The length of the polypeptide chain of elastin in both species is similar. Therefore, the duplications are compensated for by deletions in the gene for chick elastin.     

Immunochemical and mechanical characterization of cartilage subtypes in rabbit.

Cartilage is categorized into three general subgroups, hyaline, elastic, and fibrocartilage, based primarily on morphologic criteria and secondarily on collagen (Types I and II) and elastin content. To more precisely define the different cartilage subtypes, rabbit cartilage isolated from joint, nose, auricle, epiglottis, and meniscus was characterized by immunohistochemical (IHC) localization of elastin and of collagen Types I, II, V, VI, and X, by biochemical analysis of total glycosaminoglycan (GAG) content, and by biomechanical indentation assay. Toluidine blue staining and safranin-O staining were used for morphological assessment of the cartilage subtypes. IHC staining of the cartilage samples showed a characteristic pattern of staining for the collagen antibodies that varied in both location and intensity. Auricular cartilage is discriminated from other subtypes by interterritorial elastin staining and no staining for Type VI collagen. Epiglottal cartilage is characterized by positive elastin staining and intense staining for Type VI collagen. The unique pattern for nasal cartilage is intense staining for Type V collagen and collagen X, whereas articular cartilage is negative for elastin (interterritorially) and only weakly positive for collagen Types V and VI. Meniscal cartilage shows the greatest intensity of staining for Type I collagen, weak staining for collagens V and VI, and no staining with antibody to collagen Type X. Matching cartilage samples were categorized by total GAG content, which showed increasing total GAG content from elastic cartilage (auricle, epiglottis) to fibrocartilage (meniscus) to hyaline cartilage (nose, knee joint). Analysis of aggregate modulus showed nasal and auricular cartilage to have the greatest stiffness, epiglottal and meniscal tissue the lowest, and articular cartilage intermediate. This study illustrates the differences and identifies unique characteristics of the different cartilage subtypes in rabbits. The results provide a baseline of data for generating and evaluating engineered repair cartilage tissue synthesized in vitro or for post-implantation analysis.     

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.