Replication analysis of plasmid DNAs injected into Drosophila embryos

From a shotgun collection of DNA fragments, isolated from Drosophila melanogaster, we selected sequences that function as autonomously replicating sequences (ARS) in the yeast Saccharomyces cerevisiae. To investigate the replicative potential of such sequences in Drosophila, five of these ARS elements and also the Adh gene of D. melanogaster, which has been described earlier to have ARS function in yeast, were microinjected into developing Drosophila eggs and analysed after reisolation from first instar larvae. As an assay for DNA replication, we determined the sensitivity of recovered plasmid DNA to restriction enzymes that discriminate between adenine methylation and nonmethylation. within the limits of detection our results show that none of the plasmids replicated two or more rounds. However, a fraction of all injected plasmid DNAs, including vector DNA, seems to replicate once. The same result was obtained for a DNA sequence from mouse that had been reported to have replication origin function in mouse tissue culture cells. We excluded the possibility that methylation of the plasmids is the reason for their inability to replicate. These results demonstrate that homologous and heterologous DNA sequences that drive replication of plasmids in cells of other species are not sufficient to fulfil this function in Drosophila embryos.by J.A. Huberman     

Molecular relationships among plasmids of Bacillus thuringiensis: conserved sequences through 11 crystalliferous strains

Summary Screening for the plasmid content of 11 strains belonging to nine different serotypes ofB. thuringiensis was carried out by electron microscope examination and electrophoresis in agarose gels. All the strains contained at least two covalently closed, circular (CCC) DNA species. In one strain (berliner 1715), 17 extrachromosomal elements could be distinguished with regard to their size, ranging from 3.9 to 180 Mdal. Southern hybridisation experiments showed that most of these plasmids fell into two categories (inferior to 15 Mdal and superior to 15 Mdal) which have no homology between them. Within these two size groups there is partial conservation of DNA sequences through various serotypes. Further relationships among the plasmids were investigated by a two dimensional version of the Southern's blotting technique.Possible homology between plasmids and the chromosomal DNA was studied. It was shown that the smaller plasmids from the berliner 1715 and kurstaki HD₁ strains contained no sequence related to chromosomal DNA, whereas among the larger plasmids a few showed homologous sequences.Abbreviations cry^- tacrystalliferous mutant - GCC covalently closed circular DNA - OC open circular DNA - Mdal megadalton - kb 1,000 base pairs     

Nucleotide sequence of the region of the origin of replication of the broad host range plasmid RK2

Summary A DNA sequence cosisting of 617 base pairs (bp) from the region of the origin of replication of the broad-host range plasmid RK2 has been determined. Included within this sequence is a 393 bp HpaII restriction fragment that provides a functional origin or replication when other essential RK2 specified functions are provided in trans. Also contained in this sequence is a region, distinguished functionally from the replication origin, which is involved in the expression of inc ₂ incompatibility, i.e., the ability of derivatives of RK2 to eliminate a resident RK2 plasmid. The 617 bp sequence includes eight 17 base pair direct repeats with 5 located within the region required for a functional replication origin and 3 within the region involved in inc ₂ incompatibility. In addition, a 40 bp region rich in A-T followed by a 60 bp stretch having a high G+C content is present. Deletion evidence indicates that the A-T rich and possibly the G+C regions are required for a functional replication origin. Based on the evidence contained in this and the preceding paper (Thomas et al. 1980 b) a model will be presented for the involvement of these specific sequences in the initiation of RK2 DNA replication, plasmid maintenance and plasmid incompatibility.     

Molecular studies of FIme resistance plasmids, particularly in epidemic Salmonella typhimurium.

Summary The molecular sizes of F₁ me resistance plasmids from strains of Salmonella typhimurium, S. wien and S. typhi were within the range 87.9–102.6×10⁶ daltons. DNA reassociation studies indicated that the plasmids from these hosts had at least 80% of their nucleotide sequences in common. A high proportion of F₁ me plasmids cannot mediate their own transfer. The non-autotransferring property of such plasmids is the result of DNA deletion; a non-autotransferring F₁ me plasmid was about 10×10⁶ daltons shorter than autotransferring representatives of the group, and its DNA showed 100% homology with them. Plasmids of the F₁ me group are incompatible with the F factor and with F₁R factors. F₁ me plasmids are incompatible with the fi ⁺ MP10 plasmid of S. typhimurium, whereas F and F₁ factors are compatible with MP10 (Anderson et al., 1977). There was no significant DNA homology between members of the F₁ me group and MP10, and these plasmids may share only a small region of DNA responsible for their incompatibility. The F₁ me R factors examined had 29–37% DNA homology with the F factor, and 50–58% homology with the F₁ resistance plasmid, R162. Molecular examination therefore supports the genetic differentiation of members of the F₁ me group from other F-like plasmids. Both types of investigation can thus be used in epidemiological studies of bacterial strains carrying resistance or other plasmids.     

Transposition of mini-Mu containing only one of the ends of bacteriophage Mu.

Transposition of mini-Mu containing only one of the ends of bacteriophage Mu was studied. Transposition was observed when plasmids containing this mini-Mu were used as the donor in a mating-out assay with the F factor POX38, which lacks all known transposable elements, as the target. Analysis of the plasmids isolated from the recipient strain showed that in most cases the mini-Mu containing plasmid and POX38 were fused and that a part of the plasmid had been duplicated, indicating the formation of co-integrates. To obtain the DNA sequences of the junctions between donor and recipient DNA, an F factor was constructed that made it possible to analyse these junctions directly. The results showed that several sequences can be used as an alternative end in transposition and that these alternative ends show homology with the consensus for a strong A binding site. Moreover, the first base pair at the junction was always a (TA) base pair. This base pair is situated at exactly the same position with respect to the sequence which has homology with the consensus for a strong A binding site as in the ends of Mu.     

Localization of the start sites of lagging-strand replication of rolling-circle plasmids from Gram-positive bacteria

A number of small, multicopy plasmids from Gram-positive bacteria replicate by an asymmetric rolling-circle mechanism. Previous studies with several of these plasmids have identified a palindromic sequence, SSO_A, that acts as the single-strand origin (SSO) for the replication of the lagging-strand DNA. Although not all the SSO_A sequences share ONA sequence homology, they are structurally very similar. We have used an in vitro system to study the lagging-strand replication of several plasmids from Gram-positive bacteria using the SSO_A sequences of pT181, pE194 and pSN2 as representative of three different groups of Staphylococcus aureus plasmids. In addition, we have investigated the lagging-strand replication of the pUB110 plasmid that contains an alternative single-strand origin, sso_u. Our results confirm that RNA polymerase is involved in lagging-strand synthesis from both SSO_A and ssou-type lagging-strand origins. Interestingly, while initiation of lagging-strand DNA synthesis of pUB110 occurred predominantly at a single position within sso_u, replication of pT181, pSN2 and pE194 plasmids initiated at multiple positions from SSO_A.     

A comparison of the origin of replication of pSa with R6K

Summary The plasmid pOri3 is a derivative of the origin of replication of pSa. Replication is defective as a result of a truncated repA gene, the product of which is required for plasmid replication. The defective replication is complemented by the presence of the intact repA gene of pSa, or by the presence of the plasmid R6K. The basis of this complementation has been examined by comparing the nucleotide sequence of the origin of pSa with that of R6K. A 13 base pair sequence present twice in the origin of pSa has homology with a 13 base pair sequence that is present fourteen times in the origin of R6K. These sequences may be the binding sites for the initiator proteins of these two plasmids. The location of these binding sites relative to the genes for the initiator proteins suggests that an autoregulatory control mechanism for the synthesis of the initiator proteins may also play a role in the control of plasmid copy number.     

Anisotropic elastic bending models of DNA

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)_n, (tctctaaaaaatatataaaaa)_n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)_n, (atctaatctaacacaacaca)_n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.     

The plasmids of Acetobacter xylinum and their interaction with the host chromosome

Summary Acetobacter xylinum contains a complex system of plasmid DNA molecules. Plasmids of molecular weights or copy numbers different from the original wild-type, are found in different types of mutants. Restriction endonuclease digestion and DNA/DNA hybridization analysis, showed that the plasmids often contained partly, but not completely the same DNA sequences. Two of these plasmid classes were analysed in more detail, and could be shown to differ in size by about 5 kb. Hybridization analysis using cloned DNA fragments as probes, showed that sequences lacking in the smallest plasmid were still present in a DNA fraction co-migrating with linearized chromosomal DNA. In addition, at least part of the DNA in the smallest plasmid was present both in the plasmid and chromosomal DNA fraction. Analysis of a particular strain containing an insertion of transposon Tn1, also indicated the existence of complex interactions between plasmids and chromosomal DNA. Together with experiments on conjugative transfer and curing of the plasmids, the results indicate that at least part of the genetic system of A. xylinum is unusual when compared to that of other genetically characterized bacteria.     

Isolation of physarum DNA segments that support autonomous replication in yeast

Summary Hybrid plasmids containing the bacterial resistance-transfer factor pBR322 and the yeast leu2 ⁺gene have been used to isolate DNA fragments of Physarum that are capable of initiating DNA replication in a yeast host. Five of forty hybrid plasmids containing Physarum sequences transform leu2 ^-yeast to Leu⁺ at high frequency. The resulting Leu⁺ transformants are characterized by phenotypic instability. Supercoiled plasmid molecules containing pBR322 sequences can be detected in the transformed yeast, indicating that the transforming DNA replicates autonomously. Plasmid DNA isolated from Leu⁺ yeast can transform leuB bacteria. The hybrid plasmid recovered from the Leu⁺ bacterial transformants is identical to the original plasmid, indicating structural integrity is maintained during passage through the yeast host. These hybrid plasmids containing Physarum sequences have the same characteristics as those containing autonomously replicating yeast chromosomal sequences. As the temporal sequence of DNA replication is particularly accessible to study in Physarum plasmodia, the functional significance of these segments should be amenable to study.     

Plasmid profiles ofLegionella species

Forty-six strains ofLegionella species were assayed for plasmid DNA content using routine laboratory procedures. Large-molecular-weight cryptic plasmids were detected inLegionella pneumophila serogroups 2, 3, and 4,L. bozemanii, L. dumoffii, L. micdadei, L. gormanii, L. longbeachae, and as yet unclassifiedLegionella-like organisms. No plasmids were found in strains ofL. pneumophila serogroups 1, 5, and 6. No correlations could be made between the possession of a specific plasmid profile, or lack of one, and any phenotypic markers such as virulence or antibiotic resistance. Several parameters were identified in this study as critical to the isolation of plasmid DNA fromLegionella: (i) DNA preparations obtained from frozen egg or animal materials had a higher incidence of detectable plasmid DNA than subcultures on bacteriologic media. (ii) A newly formulated broth supported exponential growth in all of the 46 strains; one strain required the addition of CO₂. (iii) Considerable heterogeneity was seen in cell susceptibility to various detergents. Since no single lytic agent was suitable for all strains, both ionic and noninic lysis methods were used with each strain. Within the limitations of both crude lysate preparations and the agarose gel electrophoresis method, this study identified a large 60–80 megadalton plasmid species in over 50% of the plasmid-containing strains.     

A Model for the Evolution of Biological Specificity: a Cross-Reacting DNA-Binding Protein Causes Plasmid Incompatibility

Few biological systems permit rigorous testing of how changes in DNA sequence give rise to adaptive phenotypes. In this study, we sought a simplified experimental system with a detailed understanding of the genotype-to-phenotype relationship that could be altered by environmental perturbations. We focused on plasmid fitness, i.e., the ability of plasmids to be stably maintained in a bacterial population, which is dictated by the plasmid''s replication and segregation machinery. Although plasmid replication depends on host proteins, the type II plasmid partitioning (Par) machinery is entirely plasmid encoded and relies solely on three components: parC, a centromere-like DNA sequence, ParR, a DNA-binding protein that interacts with parC, and ParM, which forms actin-like filaments that push two plasmids away from each other at cell division. Interactions between the Par operons of two related plasmids can cause incompatibility and the reduced transmission of one or both plasmids. We have identified segregation-dependent plasmid incompatibility between the highly divergent Par operons of plasmids pB171 and pCP301. Genetic and biochemical studies revealed that the incompatibility is due to the functional promiscuity of the DNA-binding protein ParR_pB171, which interacts with both parC DNA sequences to direct plasmid segregation, indicating that the lack of DNA binding specificity is detrimental to plasmid fitness in this environment. This study therefore successfully utilized plasmid segregation to dissect the molecular interactions between genotype, phenotype, and fitness.     

An efficient bipartite PCR technique to introduce specific changes in large plasmids

Amplifying an entire double-stranded plasmid by an inverse polymerase chain reaction (PCR) using a pair of tail-to-tail primers is a particularly efficient approach for introducing changes into DNA sequences. However, the approach generally works best for plasmids less than 5 Kb and it can be difficult to amplify the large multicomponent vectors that are used for protein expression in various eukaryotic cells. We have therefore adopted an alternative approach in which two smaller PCR products are generated and then ligated to produce the complete plasmid. A mutagenic primer is used to introduce the desired change and each reaction includes one of a pair of tail-to-tail primers from within an antibiotic resistance gene contained on the plasmid so that the two PCR products contain complementing parts of the complete gene. Ligating the two products generates various combinations but only the correctly ligated molecules recreate the antibiotic resistance gene and are able to replicate in Escherichia coli. When combined with methods to minimize the carryover of template plasmid, this can be an efficient way of introducing mutations into large plasmids.     

Plasmid transformation of Streptococcus sanguis (Challis) occurs by circular and linear molecules

Summary Transformation of Streptococcus sanguis (Challis) by antibiotic resistance plasmids has shown that (a) competente developed with identical kinetics for chromosomal and plasmid DNA; (b) dependence of transformant yield on plasmid DNA concentration was second order; (c) open circular plasmid DNA transformed Challis, although at reduced frequency; (d) linearization of plasmid DNA by restriction enzymes cutting at unique sites inactivated the transforming capacity; (e) transforming activity was restored when linear plasmid molecules generated by different restriction enzymes were mixed; (f) restoration of transforming activity depended on the distance between the linearizing cuts, i.e. on the presence of sufficiently long overlapping homologous sequences; (g) when linear deletion mutants were mixed with linear parental plasmids the smaller plasmid was restored with significantly higher frequency.Based on these data, a model for plasmid transformation of Challis is proposed according to which circular plasmid is linearized during binding and uptake. One DNA strand enters the cell and restoration of circular plasmids inside the cell occurs by annealing of complementary single strands from two different donor molecules. Implications of this model for recombinant DNA experiments in streptococci are discussed.     

Progressive rearrangement of telomeric sequences added to both the ITR ends of the yeast linear pGKL plasmid

Relocation into the nucleus of the yeast cytoplasmic linear plasmids was studied using a monitor plasmid pCLU1. InSaccharomyces cerevisiae, the nuclearly-relocated pCLU1 replicated in a linear form (termed pTLU-type plasmid) which carried the host telomeric repeats TG_1–3 of 300–350 bp at both ends. The telomere sequences mainly consisted of a major motif TGTGTGGGTGTGG which was complementary to part of the RNA template of yeast telomerase and were directly added to the very end of the pCLU1-terminal element ITR (inverted terminal repeat), suggesting that the ITR end played a role as a substrate of telomerase. The telomere sequences varied among isolated pTLU-type plasmids, but the TG_1–3 organization was symmetrically identical on both ends of any one plasmid. During cell growth under non-selective condition, the telomeric repeat sequences were progressively rearranged on one side, but not on the opposite side of pTLU plasmid ends. This indicates that the mode of telomeric DNA replication or repair differed between both ends. Clonal analysis showed that the intense rearrangement of telomeric DNA was closely associated with extreme instability of pTLU plasmids. Published: February 17, 2003     

Characterization of eight excision plasmids of Pseudomonas syringae pv. phaseolicola

Summary Pseudomonas syringae pv. phaseolicola strain LR719 contains a 150 kilobase pair (kb) plasmid pMC7105, stably integrated into its chromosome. Occasionally, single colony isolates of this strain contain an excision plasmid. Eight unique excision plasmids were selected and characterized by BamHI restriction endonuclease and blot hybridization analyses. These plasmids ranged in size from 35 to 270 kb; the largest contained approximately 130 kb of chromosomal DNA sequences. Restriction maps of pMC7105 were developed to deduce the site of integration and to identify the fragments in which recombination occurred to produce each excision plasmid. The eight excision plasmids were arranged into five classes based on the sites where excision occurs. A 20 kb region of pMC7105, which includes BamHI fragment 9 and portions of adjacent fragments, is present in all excision plasmids and thought to contain the origin of replication. The site of integration on pMC7105 maps within BamHI fragment 8. This fragment shows homology with seven other BamHI fragments of pMC7105 and with five chromosomal fragments identified among the excision plasmids. The data strongly suggest that the integration of pMC7105 may have occurred at a repetitive sequence present on the chromosome and on the plasmid.     

DNA curvature influences the internal motions of supercoiled DNA.

We present evidence that short curved DNA segments can act as mediators for the ordering of large domains in superhelical DNA. Using a non-invasive solution method (dynamic light scattering), we investigated the effect of permanently curved inserts on the solution structure and on the internal motions of superhelical plasmid DNA. We find that the dynamics of superhelical DNA are strongly influenced by sequence- or protein-induced bending: in superhelical plasmids containing curved inserts the amplitude of the internal motion is lower than that of non-curved controls. Furthermore, the relative arrangement of curved sequences in the plasmids can influence the overall shape of the superhelical DNA. On linearized forms of the plasmids, these effects are not observed.     

Plasmid multimerization is dependent on RAD52 activity in Saccharomyces cerevisiae

Summary A mutant plasmid, pX, derived from the 1453 base pair small plasmid, YARp1 (or TRP1 RI circle), consists of 849 base pairs of DNA bearing the TRP1 gene and the ARS1 sequence of Saccharomyces cerevisiae and, unlike YARp1 and other commonly used yeast plasmids, highly multimerizes in a S. cerevisiae host. The multimerization of pX was dependent on RAD52, which is known to be necessary for homologous recombination in S. cerevisiae. Based upon this observation, a regulated system of multimerization of pX with GAL1 promoter-driven RAD52 has been developed. We conclude that the regulated multimerization of pX could provide a useful model system to study genetic recombination in the eukaryotic cell, in particular to investigate recombination intermediates and the effects of various trans-acting mutations on the multimerization and recombination of plasmids.     

Estimation of the diversity between DNA calorimetric profiles,differential melting curves and corresponding melting temperatures

The Poland–Fixman–Freire formalism was adapted for modeling of calorimetric DNA melting profiles, and applied to plasmid pBR 322 and long random sequences. We studied the influence of the difference (H_GC?H_AT) between the helix‐coil transition enthalpies of AT and GC base pairs on the calorimetric melting profile and on normalized calorimetric melting profile. A strong alteration of DNA calorimetrical profile with H_GC?H_AT was demonstrated. In contrast, there is a relatively slight change in the normalized profiles and in corresponding ordinary (optical) normalized differential melting curves (DMCs). For fixed H_GC?H_AT, the average relative deviation (S) between DMC and normalized calorimetric profile, and the difference between their melting temperatures (T_cal?T_m) are weakly dependent on peculiarities of the multipeak fine structure of DMCs. At the same time, both the deviation S and difference (T_cal?T_m) enlarge with the temperature melting range of the helix‐coil transition. It is shown that the local deviation between DMC and normalized calorimetric profile increases in regions of narrow peaks distant from the melting temperature.