A tRNA Val(GAC) gene of chloroplast origin in sunflower mitochondria is not transcribed

A tRNA^Val (GAC) gene is located in opposite orientation 552 nucleotides (nt) down-stream of the cytochrome oxidase subunit III (coxIII) gene in sunflower mitochondria. The comparison with the homologous chloroplast DNA revealed that the tRNA^Val gene is part of a 417 nucleotides DNA insertion of chloroplast origin in the mitochondrial genome. No tRNA^Val is encoded in monocot mitochondrial DNA (mtDNA), whereas two tRNA^Val species are coded for by potato mtDNA. The mitochondrial genomes of different plant species thus seem to encode unique sets of tRNAs and must thus be competent in importing the missing differing sets of tRNAs.     

3′-5′ tRNA guanylyltransferase in bacteria

The identity of the histidine specific transfer RNA (tRNA^His) is largely determined by a unique guanosine residue at position −1. In eukaryotes and archaea, the tRNA^His guanylyltransferase (Thg1) catalyzes 3′-5′ addition of G to the 5′-terminus of tRNA^His. Here, we show that Thg1 also occurs in bacteria. We demonstrate in vitro Thg1 activity for recombinant enzymes from the two bacteria Bacillus thuringiensis and Myxococcus xanthus and provide a closer investigation of several archaeal Thg1. The reaction mechanism of prokaryotic Thg1 differs from eukaryotic enzymes, as it does not require ATP. Complementation of a yeast thg1 knockout strain with bacterial Thg1 verified in vivo activity and suggests a relaxed recognition of the discriminator base in bacteria.     

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCA-DAGCGCAψUUGUUUUGGNψFACAAAAUmsu7GUCACGGGTψCAAAUCCUGUCAUCCUUACCA_OH. It shows 93% homology with spinach chloroplast tRNA^Pro (UGG) and 72% homology with bean mitochondrial tRNA^Pro (UGG), the other two known plant organellar tRNAs^Pro.     

Unlike in other monocotyledonous plants such as wheat and rice, the region containing the tRNA (UCC), tRNA (UCU) and CF1 ATPase α-subunit genes has not undergone recombination in the leek chloroplast DNA

The nucleotide sequence of a 1.1 kbp BamHI fragment of the leek chloroplast DNA (Allium porrum., fam. Liliaceae) has been determined. The fragment contains the 3' part of the tRNA^Gly (UCC) gene and the tRNA^Arg (UCU) gene on the same strand, and the 3' end of the atpA gene encoding the CF₁ ATPase α-subunit which is located on the opposite strand. The gene arrangement and nucleotide sequence of this fragment are similar to those of the corresponding region in the tobacco chloroplast DNA but differ significantly from what has been observed in other monocotyledonous plants such as wheat and rice, in which the region containing these genes has undergone intensive rearrangement.     

The chloroplast nucleoids of the bundle sheath and mesophyll cells of Zea mays

Dimorphic chloroplasts of Zea mays L. cv. GH5004 from bundle sheath and mesophyll cells contained similar amounts of DNA, while bundle sheath chloroplasts contained twice the number of nucleoids compared to mesophyll chloroplasts. On average bundle sheath nucleoids were half the size of mesophyll nucleoids and contained half as much DNA. Electron microscope autoradiography of the chloroplasts showed that the nucleoid DNA is associated with the thylakoids and in the case of mesophyll chloroplasts preferentially with the grana. These observations suggest that the differences in nucleoid distribution may be due to differences in membrane morphology, with the small nucleoids of agranal bundle sheath chloroplasts being widely dispersed.     

pGp as the main product of bovine tRNA kinase

One of the Ser-tRNAs, Ser-tRNA^Sec, is converted to Sec-tRNA^Sec by Sec synthase. This Ser-tRNA^Sec is also converted to phosphoser-tRNA^Sec by tRNA kinase. In this study, we analyzed of the products of phosphorylation with tRNA kinase. [³H]Ser-tRNA^Sec purified on Sephacryl S-200 was phosphorylated with [-³²P]ATP by tRNA kinase. The product [³²P][³H]phosphoser-tRNA was purified on Sephacryl S-200 and hydrolyzed with ribonuclease T2. The chromatogram of this hydrolyzate on DEAE-cellulose in 7M urea buffer showed four peaks. The first peak of the pass-through fraction was seryl-adenosine liberated from the 3-terminal of the tRNA. The second peak, eluted before the third peak containing inorganic phosphate, was phosphoseryl-adenosine. The major compound in the fourth peak was pGp. As a control experiment, non-acylated tRNA^Sec was used as a substrate of phosphorylation and the product was analyzed. The chromatogram of the digest with ribonuclease T2 showed no peak of phosphoseryl-adenosine, but a peak of pGp was seen with the peak of inorganic phosphate. Thus, the major product in the presence of tRNA kinase was pGp, and a small but significant proportion of the radioactivity was found as phosphoserine in the presence of seryl residue on the 3-CCA terminal of tRNA^Sec. These results indicated that tRNA kinase phosphorylates not only Ser-tRNA to phosphoser-tRNA but also Gp of the 5-termini of tRNA to pGp. This study gives a new role to mammalian tRNA kinase.     

Variations during leaf development of the relative amounts of two bean (Phaseolus vulgaris) chloroplast tRNAsPhe which differ in their minor nucleotide content

Bean (Phaseolus vulgaris cv. Saxa) chloroplasts contain two tRNA^Phe species, namely tRNA^Phe1 and tRNA^Phe2. By sequence determination, we show that tRNA^Phe2 is identical to the previously sequenced tRNA^Phe1 except for two undermodified nucleotides. By reversed-phase chromatography analyses, we demonstrate that the relative amounts of these two chloroplast tRNAs^Phe vary during leaf development: in etiolated leaves the undermodified tRNA^Phe2 only represents 15% of total chloroplast tRNA^Phe, during development and greening it increases to reach 60% in 8-day-old leaves, and it then decreases to 9% in senescing leaves.     

Rodent type 2 Alu family,rat identifier sequence,rabbit C family,and bovine or goat 73-bp repeat may have evolved from tRNA genes

Summary Close structural resemblances between several mammalian highly or moderately repetitive families and some specific tRNAs were detected. The rodent type 2 Alu family, rat identifier (ID) sequences, rabbit C family, and bovine or goat 73-bp repeat are most homologous with lysine tRNA₅, phenylalanine tRNA, glycine tRNA, and glycine tRNA, respectively. The homologies extend to secondary structures, and the homologous nucleotides are located on nearly the same secondary structures. The repetitive families mentioned have a common structural organization, with a tRNA-like sequence devoid of an aminoacyl stem region. These features suggest that these repetitive families may be generated by nonhomologous recombination between a tRNA gene and a tRNA-unrelated block.     

New mitochondrial tRNA HIS mutation in a family with lactic acidosis and stroke-like episodes (MELAS)

We report a new mutation in m.12146 A > G in the mt-tRNA^His in a family with a remarkable clinical history having different degrees of lactic acidosis and stroke-like episodes. Biochemical measurements of a muscle biopsy established an isolated complex IV deficiency, while similar analysis of fibroblasts showed a combined complex I,III and IV deficiency. Transmitochondrial cybrid analysis proved that this tRNA^His mutation causes the enzymatic deficiency. This family illustrates the complexity of the clinical, biochemical and genetic characteristics of a novel mtDNA encoded disorder, as well as the challenge to prove its pathogenicity.     

Sequence analysis of three tRNAPhe nuclear genes and a mutated gene,and one gene for tRNAAla from Arabidopsis thaliana

Three genes and one mutant gene for tRNA^Phe (GAA) and one gene for tRNA^Ala (UGC) were isolated from a whole-cell DNA library of Arabidopsis thaliana. All three tRNA^Phe genes are identical in their nucleotide sequence, but differ in their 5 and 3 flanking regions. The mutant tRNA^Phe (GAA) gene differs from the other three genes by one nucleotide change from highly conserved G to C at the 57th nucleotide position. The primary structure of the first tRNA^Ala gene was also determined in this experiment.     

Characterization of a chloroplast DNA sequence from Chlorella ellipsoidea that promotes autonomous replication in yeast

Summary An EcoRI 2.7 kbp fragment from Chlorella ellipsoidea chloroplast DNA (cpDNA) cloned in YIp5 was shown to promote autonomous replication in Saccharomyces cerevisiae. The fragment was localized in the small single copy region close to the inverted repeat. The ARS activity (autonomously replicating sequences in yeast) was found to be confined within a subclone of a ca. 300 bp HindIII fragment. Sequence analysis of this fragment revealed its high AT content and the presence of several direct and inverted repeats and a few elements that were related to the yeast ARS consensus sequence. Electron microscopic studies revealed that this sequence did not coincide with the primary replication origin of chloroplast DNA. The functioning of this sequence as a possible origin of plasmid replication in vivo is discussed. This is the first report on Chlorella cpDNA sequence. re]19850821 rv]19851211 ac]19851216     

Essential sulfhydryl groups in the catalytic center of the tonoplast H+-ATPase from coleoptiles ofZea mays L. as demonstrated by the biotin-streptavidin-peroxidase system

Functional properties and the localization of essential SH-groups of the tonoplast H⁺-ATPase fromZea mays L. were studied. In contrast to the pyrophosphate-dependent H⁺-translocation activity of the tonoplast, the H⁺-ATPase activity was inhibited by SH-blocking agents, such as N-ethylmaleimide and iodoacetic acid. In the case ofp-hydroxymercuribenzoate, HgCl₂ and oxidized glutathione, the inhibition could be reversed by adding reduced glutathione or dithiothreitol. Incubation of tonoplast vesicles with oxidized glutathione or N-ethylmaleimide in the presence of Mg·ADP—a competitive inhibitor of the ATP-dependent H⁺ pump—avoided the inhibition of the H⁺-pumping activity. This effect is an indication for the occurrence of essential SH-groups at the catalytic site of the H⁺-ATPase. In order to characterize the active center these thiols were specifically labeled with maleimidobutyrylbiocytin. Subsequently, the membrane proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to an immobilizing membrane. The maleimidobutyrylbiocytin-labeled active-center protein was detected by a biotin-streptavidin-peroxidase staining system and was shown to be a 70-kDa subunit of the tonoplast H⁺-ATPase. It is suggested that the oxidation state of the critical sulfhydryl groups within the active center of the enzyme and their reversible blocking by endogenous compounds might be of great importance for the regulation of the enzyme activity in vivo.     

Sequence of two genes in pea chloroplast DNA coding for 84 and 82 kD polypeptides of the photosystem I complex

Summary The genes encoding the two P700 chlorophyll a-apoproteins of the photosystem I complex were localized on the pea (Pisum sativum) chloroplast genome. The nucleotide sequence of the genes and the flanking regions has been determined. The genes are separated by 25 bp and are probably cotranscribed. The 5 terminal gene (psaA1) codes for a 761-residue protein (MW 84.1 kD) and the 3 terminal gene (psaA2) for a 734-residue protein (MW 82.4 kD). Both proteins are highly hydrophobic and contain eleven putative membrane-spanning domains. The homology to the corresponding polypeptides from maize are 89% and 95% for psaA1 and psaA2, respectively. A putative promoter has been identified for the psaA1 gene, and potential ribosome binding sites are present before both genes.     

The consensus land plant chloroplast gene order is present, with two alterations, in the moss Physcomitrella patens

Summary A restriction endonuclease cleavage site map for the enzymes ClaI and BglII, and a partial map for SacI, has been constructed for the chloroplast genome of the moss Physcomitrella patens (Hedw.) BSG. The plastid chromosome contains approximately 122 kb organized into small (21 kb) and large (82 kb) single-copy regions separated by two copies of a repeat sequence (9.4 kb) oriented in an inverted arrangement. Genes for 17 proteins and 2 ribosomal RNAs have been mapped using heterologous probes from corn, spinach, pea, and petunia. The general order and arrangement of the moss chloroplast genes are similar to the consensus land plant genome typified by that of spinach, with two major exceptions. First, there is an inversion of approximately 20 kb, bordered internally by psbA and atpH, and also containing the genes atpF and atpA. Second, rpl2 and rps19 have been relocated to a different position within the large single-copy region, adjacent to the 20 kb inversion.     

Characterization of the trnL-trnF spacer sequence of the chloroplast tRNA genes in Spirodela species

The trnL-trnF spacer region of the chloroplast tRNA genes was sequenced and characterized in 14 accessions of the genus Spirodela (Lemnaceae). Only a low intraspecific variation of the spacer was observed in geographically isolated and morphologically different accessions of S. polyrrhiza, the most widespread Spirodela species. Five haplotypes of the spacer were identified, differing in mono-and oligonucleotide repeats and extended indels, specific to S. polyrrhiza, Landoltia punctata, and Lemna sp. The result supported the isolation of Landoltia from Spirodela.     

Heteroplasmy of chloroplast DNA in Medicago

Two chloroplast DNA (cpDNA) regions exhibiting a high frequency of intra- or inter-species variation were identified in 12 accessions of the genus Medicago. Restriction maps of both regions were prepared for alfalfa, and the probable nature of the events causing the DNA differences was identified. Specific DNA fragments were then cloned for use in identification of variants in each region. Two each of M. sativa ssp. varia and ssp. caerulea and one of six M. sativa ssp. sativa single plants examined possessed cpDNA heterogeneity as identified by screening extracts for fragments generated by the presence and absence of a specific Xba I restriction site. Three plants of M. sativa ssp. sativa, two of each of sspp. varia and caerulea, and three M. scutellata were also examined for single-plant cpDNA heterogeneity at a hypervariable region where differences resulted from small insertion-deletion events. A single M. scutellata plant with mixed cpDNAs was identified. Sorting out was seen when one spp. sativa plant with mixed plastid types identifiable by the Xba I restriction site difference was vegetatively propagated. This indicated that the initial stock plant was heteroplastidic. Controlled crosses will be required in order to test whether heteroplasmy results from chloroplast transmission in the pollen and to examine the dynamic of sorting out. However, heteroplasmy is apparently not a rare situation in Medicago.Contribution No 88-547-J from the Kansas Agricultural Experiment Station, Manhattan.     

The Seryl-tRNA synthetase/tRNA acceptor stem interface is mediated via a specific network of water molecules

tRNAs are aminoacylated by the aminoacyl-tRNA synthetases. There are at least 20 natural amino acids, but due to the redundancy of the genetic code, 64 codons on the mRNA. Therefore, there exist tRNA isoacceptors that are aminoacylated with the same amino acid, but differ in their sequence and in the anticodon. tRNA identity elements, which are sequence or structure motifs, assure the amino acid specificity. The Seryl-tRNA synthetase is an enzyme that depends on rather few and simple identity elements in tRNA^Ser. The Seryl-tRNA-synthetase interacts with the tRNA^Ser acceptor stem, which makes this part of the tRNA a valuable structural element for investigating motifs of the protein–RNA complex. We solved the high resolution crystal structures of two tRNA^Ser acceptor stem microhelices and investigated their interaction with the Seryl-tRNA-synthetase by superposition experiments. The results presented here show that the amino acid side chains Ser151 and Ser156 of the synthetase are interacting in a very similar way with the RNA backbone of the microhelix and that the involved water molecules have almost identical positions within the tRNA/synthetase interface.     

Maternally transmitted diabetes mellitus associated with the mitochondrial tRNA(Leu(UUR)) A3243G mutation in a four-generation Han Chinese family

We report here the characterization of a four-generation Han Chinese family with maternally transmitted diabetes mellitus. Six (two males/four females) of eight matrilineal relatives in this family exhibited diabetes. The age of onset in diabetes varies from 15 years to 33 years, with an average of 26 years. Two of affected matrilineal relatives also exhibited hearing impairment. Molecular analysis of mitochondrial DNA (mtDNA) showed the presence of heteroplasmic tRNA(Lue(UUR)) A3243G mutation, ranging from 35% to 58% of mutations in blood cells of matrilineal relatives. The levels of heteroplasmic A3243G mutation seem to be correlated with the severity and age-at-onset of diabetes in this family. Sequence analysis of the complete mitochondrial genome in this pedigree revealed the presence of the A3243G mutation and 38 other variants belonging to the Eastern Asian haplogroup M7C. However, none of other mtDNA variants are evolutionarily conserved and implicated to have significantly functional consequence. Thus, the A3243G mutation is the sole pathogenic mtDNA mutation associated with diabetes in this Chinese family.