共查询到20条相似文献,搜索用时 15 毫秒
1.
Kumkum Sharma Priyanka Yadav Bhawana Sharma Meenakshi Pandey Satish K. Awasthi 《Journal of molecular recognition : JMR》2020,33(6)
The interaction of triazole substituted 4‐methyl‐7‐hydroxycoumarin derivatives (CUM1‐4) with serum albumin (bovine serum albumin [BSA] and human serum albumin [HSA]) have been studied employing ultraviolet‐visible (UV‐Vis), fluorescence, circular dichroism (CD) spectroscopy, and molecular docking methods at physiological pH 7.4. The fluorescence quenching occurred with increasing concentration of CUMs, and the binding constant of CUM derivatives with BSA and HSA obtained from fluorescence quenching experiment was found to be ~ 104 L mol?1. CD study showed conformational changes in the secondary structure of serum albumin upon titration of CUMs. The observed experimental results were further validated by theoretical studies involving density functional theory (DFT) and molecular docking. 相似文献
2.
A. I. Vovk A. L. Chuiko L. A. Kononets V. Yu. Tanchuk I. V. Murav’eva M. O. Lozinsky V. P. Kukhar 《Russian Journal of Bioorganic Chemistry》2008,34(1):60-66
A series of thioureido derivatives of methylenebisphosphonic acid were synthesized by the reaction of aminomethylenebisphosphonic acid with the corresponding isothiocyanates, and their effect on the activity of alkaline phosphatases from bovine small intestine mucosa (BSIM) and human placenta was studied. It was found that (3-phenylthioureido)methylenebisphosphonate is approximately one order of magnitude more effective in inhibiting the activity of alkaline phosphatase from BSIM than the alkyl derivatives of thioureidomethylenebisphosphonic acid with methyl, ethyl, tert-butyl, or cyclohexyl substituents. The introduction of substituents into the benzene ring of (3-phenylthioureido)methylenebisphosphonate decreased the effect of the inhibitor on the activity of the enzyme. The affinity of (3-phenylureido)methylenebisphosphonate to the alkaline phosphatase of BSIM was also weaker as compared with the corresponding thioureidomethylenebisphosphonate. The insertion of thioureidobisphosphonates into the active site of alkaline phosphatase of human placenta by the method of molecular docking indicated that the methylenebisphosphonate residue and the substituted amino groups of the inhibitor are involved in the mechanisms of complex formation with the enzyme. It is supposed that the improvement of the inhibitory activity of (3-phenylthioureido)methylenebisphosphonate toward alkaline phosphatase of BSIM is due to the additional fixation of the phenyl substituent in the active site of the enzyme. 相似文献
3.
The current study deals with the synthesis of urea and thiourea derivatives 1–37 which were characterized by various spectroscopic techniques including FAB-MS, 1H-, and 13C NMR. The synthetic compounds were subjected to urease inhibitory activity and compounds exhibited good to moderate urease inhibitory activity having IC50 values in range of 10.11–69.80 µM. Compound 1 (IC50 = 10.11 ± 0.11 µM) was found to be most active and even better as compared to the standard acetohydroxamic acid (IC50 = 27.0 ± 0.5 µM). A limited structure–activity relationship (SAR) was established and the compounds were also subjected to docking studies to confirm the binding interactions of ligands (compounds) with the active site of enzyme. 相似文献
4.
Substituted phenyl[(5-benzyl-1,3,4-oxadiazol-2-yl)sulfanyl]acetates/acetamides 9a-j were synthesized as alkaline phosphatase inhibitors. Phenyl acetic acid 1 through a series of reactions was converted into 5-benzyl-1,3,4-oxadiazole-2-thione 4. The intermediate oxadiazole 4 was then reacted with chloroacetyl derivatives of phenols 6a-f and anilines derivatives 8a-d to afford the title oxadiazole derivatives 9a-j. All of the title compounds 9a-j were evaluated for their inhibitory activity against human alkaline phosphatise (ALP). It was found that compounds 9a-j exhibited good to excellent alkaline phosphatase inhibitory activity especially 9h displayed potent activity with IC50 value 0.420 ± 0.012 µM while IC50 value of standard (KH2PO4) was 2.80 µM. The enzyme inhibitory kinetics of most potent inhibitor 9h was determined by Line-weaever Burk plots showing non-competitive mode of binding with enzyme. Molecular docking studies were performed against alkaline phosphatase enzyme (1EW2) to check the binding affinity of the synthesized compounds 9a-j against target protein. The compound 9h exhibited excellent binding affinity having binding energy value (−7.90 kcal/mol) compared to other derivatives. The brine shrimp viability assay results proved that derivative 9h was non-toxic at concentration used for enzyme assay. The lead compound 9h showed LD50 106.71 µM while the standard potassium dichromate showed LD50 0.891 µM. The DNA binding interactions of the synthesized compound 9h was also determined experimentally by spectrophotometric and electrochemical methods. The compound 9h was found to bind with grooves of DNA as depicted by both UV–Vis spectroscopy and cyclic voltammetry with binding constant values 7.83 × 103 and 7.95 × 103 M−1 respectively revealing significant strength of 9h-DNA complex. As dry lab and wet lab results concise each other it was concluded that synthesized compounds, especially compound 9h may serve as lead compound to design most potent inhibitors of human ALP. 相似文献
5.
《Bioorganic & medicinal chemistry letters》2020,30(13):127238
We developed a simple and robust method for synthesis of 1,3-oxathiol-2-ylidene benzamides (4a–m) a sporadic class of heterocycles, by reacting freshly prepared aroyl isothiocyanates, with ethyl 2-chloroacetoacetate in presence of N-methylimidazole in dry acetonitrile. The synthesized compounds were explored for their inhibition against alkaline phosphatases and HeLa cancer cell lines. The results suggest that almost all the compounds possess good % inhibition against both enzymes, with compound 4m showing dual inhibition while 4g and 4i as potent and selective inhibitors of TNAP and c-IAP respectively. Structure activity relationship for the active members of series has been carried out based on molecular docking studies. The result of SAR shows the involvement of active inhibitors in H-bonding at various sites with different amino acid residues in addition to secondary metal ion interactions with Zn ions inside the active pocket of the enzyme. The π-π interactions between the 1,3-oxathiole ring and imidazole ring of His321 and His 317 further defines the dual mode of inhibition by compound 4m. These compounds also possess inhibition potential against cervical cell lines in the range of 2.42–69.03% with the maximum inhibition shown by the unsubstituted member 4a compared to the reference drug cisplatin. 相似文献
6.
Zeynep Soyer Sirin Uysal Sulunay Parlar Ayse Hande Tarikogullari Dogan Vildan Alptuzun 《Journal of enzyme inhibition and medicinal chemistry》2017,32(1):13-19
A series of 4-phthalimidobenzenesulfonamide derivatives were designed, synthesized and evaluated for the inhibitory activities against acetylcholinesterase (AChE) and butyrylcholinesterase (BuChE). Structures of the title compounds were confirmed by spectral and elemental analyses. The cholinesterase (ChE) inhibitory activity studies were carried out using Ellman’s colorimetric method. The biological activity results revealed that all of the title compounds (except for compound 8) displayed high selectivity against AChE. Among the tested compounds, compound 7 was found to be the most potent against AChE (IC50=?1.35?±?0.08?μM), while compound 3 exhibited the highest inhibition against BuChE (IC50=?13.41?±?0.62?μM). Molecular docking studies of the most active compound 7 in AChE showed that this compound can interact with both the catalytic active site (CAS) and the peripheral anionic site (PAS) of AChE. 相似文献
7.
Chang L Duy do L Mébarek S Popowycz F Pellet-Rostaing S Lemaire M Buchet R 《Bioorganic & medicinal chemistry letters》2011,21(8):2297-2301
Pathological calcifications induced by deposition of basic phosphate crystals or hydroxyapatite (HA) on soft tissues are a large family of diseases comprising of ankylosing spondylitis (AS), end-stage osteoarthritis (OA) and vascular calcification. High activity of tissue non-specific alkaline phosphatase (TNAP) is a hallmark of pathological calcifications induced by HA deposition. The use of TNAP inhibitor is a possible therapeutic option to address calcific diseases produced by HA deposition on soft tissues. We report the synthesis of a series of thiopheno-imidazo[2,1-b]thiazole derivatives which were evaluated as potential inhibitors of TNAP displaying a large range of IC50 at pH 10.4 (from 42 ± 13 μM to more than 800 μM). 相似文献
8.
《Journal of enzyme inhibition and medicinal chemistry》2013,28(4):528-532
Two mononuclear copper(II) complexes, [Cu(C15H16NO2)2] (1) and [Cu(C6H9N2O4)2·3H2O] (2·3H2O), were synthesised and structurally characterised by single-crystal X-ray analysis. The copper(II) atom adopts a square-planar environment in complex 1, while the geometry in 2·3H2O could be described as the distorted square pyramidal. Complexes 1 and 2·3H2O were evaluated for their inhibitory activities against Helicobacter pylori (H. pylori) urease in vitro. They both were found to have strong inhibitory activities against H. pylori urease comparable to that of acetohydroxamic acid (AHA). A docking simulation was performed to position 2 into the H. pylori urease active site to determine the probable binding conformation. 相似文献
9.
Hao Zhou Tao Deng Ran Tao Wenjun Li 《Journal of biomolecular structure & dynamics》2018,36(8):1966-1978
Three series of novel urushiol derivatives were designed by introducing a hydroxamic acid moiety into the tail of an alkyl side chain and substituents with differing electronic properties or steric bulk onto the benzene ring and alkyl side chain. The compounds’ binding affinity toward HDAC8 was screened by Glide docking. The highest-scoring compounds were processed further with molecular docking, MD simulations, and binding free energy studies to analyze the binding modes and mechanisms. Ten compounds had Glide scores of ?8.2 to ?10.2, which revealed that introducing hydroxy, carbonyl, amino, or methyl ether groups into the alkyl side chain or addition of –F, –Cl, sulfonamide, benzamido, amino, or hydroxy substituents on the benzene ring could significantly increase binding affinity. Molecular docking studies revealed that zinc ion coordination, hydrogen bonding, and hydrophobic interactions contributed to the high calculated binding affinities of these compounds toward HDAC8. MD simulations and binding free energy studies showed that all complexes possessed good stability, as characterized by low RMSDs, low RMSFs of residues, moderate hydrogen bonding and zinc ion coordination and low values of binding free energies. Hie147, Tyr121, Phe175, Hip110, Phe119, Tyr273, Lys21, Gly118, Gln230, Leu122, Gly269, and Gly107 contributed favorably to the binding; and Van der Waals and electrostatic interactions provided major contributions to the stability of these complexes. These results show the potential of urushiol derivatives as HDAC8 binding lead compounds, which have great therapeutic potential in the treatment of various malignancies, neurological disorders, and human parasitic diseases. 相似文献
10.
Kali Charan Gulipalli Srinu Bodige Parameshwar Ravula Srinivas Endoori Nareshvarma Seelam 《Bioorganic & medicinal chemistry letters》2017,27(15):3558-3564
A series of novel methyl 4-(4-amidoaryl)-3-methoxythiophene-2-carboxylate derivatives were designed against the active site of protein tyrosine phosphatise 1B (PTP1B) enzyme using MOE.2008.10. These molecules are also subjected for in silico toxicity prediction studies and considering their corresponding drug scores, it implied that, the molecules are promising as anticancer agents. The designed compounds were synthesized by using suitable methods and characterized. They were subjected to inhibitory activity against PTP1B and in vitro anticancer activity by MTT assay. Most of the tested compounds showed potent inhibitory activity against PTP1B, among the compounds tested, compound 5b exhibited the highest activity (IC50 = 5.25 µM) and remarkable cytotoxic activity at 0.09 µM of IC50 against the MCF-7 cell line. In addition to this, compound 5c also showed potential anticancer activity at 2.22 µM of IC50 against MCF-7 and 0.72 µM against HepG2 cell lines as well as PTP1B inhibitory activity at IC50 of 6.37 µM. 相似文献
11.
《Bioorganic & medicinal chemistry letters》2014,24(2):571-575
The regulations of NO and PGE2 productions are research topics of interest in the field of antiinflammatory drug development. In the present study, a series of tricyclic fused coumarin sulfonate derivatives was synthesized and evaluated for their abilities to inhibit NO and PGE2 productions in LPS-induced RAW 264.7 macrophages. Among all the target compounds, compound 1g possessing p-(trifluoromethyl)phenyl and fused cycloheptane moieties showed the highest inhibitory effects on NO and PGE2 productions. Compound 1g not only inhibited COX-2 activity but also reduced expressions of COX-2 and iNOS. Furthermore, ADME profiling showed that compounds 1g, 1j, 1m, and 1n are estimated to be orally bioavailable. 相似文献
12.
Tehreem Tahir Mirza Imran Shahzad Rukhsana Tabassum Muhammad Rafiq Muhammad Ashfaq Mubashir Hassan Katarzyna Kotwica-Mojzych Mariusz Mojzych 《Journal of enzyme inhibition and medicinal chemistry》2021,36(1):1509
In the present study, a series of azo derivatives (TR-1 to TR-9) have been synthesised via the diazo-coupling approach between substituted aromatic amines with phenol or naphthol derivatives. The compounds were evaluated for their therapeutic applications against alpha-glucosidase (anti-diabetic) and pathogenic bacterial strains E. coli (gram-negative), S. aureus (gram-positive), S. aureus (gram-positive) drug-resistant strain, P. aeruginosa (gram-negative), P. aeruginosa (gram-negative) drug-resistant strain and P. vulgaris (gram-negative). The IC50 (µg/mL) of TR-1 was found to be most effective (15.70 ± 1.3 µg/mL) compared to the reference drug acarbose (21.59 ± 1.5 µg/mL), hence, it was further selected for the kinetic studies in order to illustrate the mechanism of inhibition. The enzyme inhibitory kinetics and mode of binding for the most active inhibitor (TR-1) was performed which showed that the compound is a non-competitive inhibitor and effectively inhibits the target enzyme by binding to its binuclear active site reversibly. 相似文献
13.
Poonam Kanta Tulikalipi Ghosh Anit Kaur Thungapathra Muthukumarappa 《International Journal of Biochemistry and Molecular Biology》2021,12(1):1
Alkaline phosphatase is an enzyme that converts para-nitrophenyl phosphate to para-nitrophenol (yellow coloured) in 2-amino, 2-methyl, 1-propanol buffer at pH 10.5. However, when this protocol is applied to the in vitro cellular model systems to estimate alkaline phosphatase activity, it tends to generate clumps of genomic DNA, leading to inaccurate pipetting for protein estimation. The aim of the study was to introduce minor modifications in the existing protocol to make it simple, cost-effective, with minimal labor-intensive procedures while estimating alkaline phosphatase activity in cellular model systems. The genomic DNA clumps were dissolved by depurination (adding 0.2 N HCl) and fragmentation (adding 0.2 N NaOH) during enzyme estimation. Moreover, these minor modifications have been standardized and optimized extensively by using serum samples (rich source of alkaline phosphatase), hFOB/ER9 (human Fetal osteoblastic cell) and HepG2 cells. Our results suggest that the modification incorporated in previously published method was robust enough to estimate ALP activity and protein concentration accurately. There was no significant variation in ALP activity estimated after modification (P > 0.05). This innovative approach could be beneficial for a researcher by providing an easy, cost effective and less labor-intensive solution for estimation of enzymatic activity in cellular model systems. 相似文献
14.
Ajayrajsinh R. Zala Dhanji P. Rajani Premlata Kumari 《Journal of biochemical and molecular toxicology》2023,37(1):e23231
A series of novel piperazine based cinnamic acid bearing coumarin derivatives were designed and synthesized by piperazine based cinnamic acids esterification with 4-hydroxycoumarin and characterized by various spectral techniques like infrared, 1H nuclear magnetic resonance (NMR), 13C NMR, and mass. The novel bioactive compounds (7a-7m) screen their potential against different bacterial and fungal strains. Compound 7g (minimum inhibitory concentration [MIC] = 12.5 µg/ml) exhibited potent antibacterial activity against Escherichia coli strain. Compounds 7d, 7f, 7g, 7k, 7l , and 7m showed potent antibacterial activity against all bacterial strains. Compounds 7a, 7g, 7h, 7k, 7l , and 7m exhibited potent antifungal activity against all fungal strains. Furthermore, a molecular docking study revealed that compounds 7d, 7f, 7g , and 7k could bind to the active site of E. coli DNA gyrase subunit B protein and form hydrogen bonding with crucial amino acid residues Arg136 in the active sites. Comprehensively, our study recommends that 7d, 7f, 7g , and 7k could be a promising lead for developing more efficient antimicrobial drug candidates and DNA gyrase inhibitors. 相似文献
15.
Chandra Kallimeledoddi B Puttaraju Sankanahally Srinivasshetty Mahesh Kalegowda Shivashankar Neratur Krishnappagowda Lokanath Mahendra Madegowda 《Bioinformation》2014,10(5):288-292
Protein kinases are important drug targets in human cancers, inflammation and metabolic diseases. Docking studies was
performed for all the benzimidazopyrimidine and coumarin substituted benzimidazopyridimine derivatives with human Aurora A
kinase target (3FDN) employing flexible ligand docking approach by using AutoDock 4.2. All the compounds were found to have
minimum binding energy ranging from -6.26 to -9.29 kJ/mol. Among the molecules tested for docking study, 10-(6-Bromo-2-oxo-
2H-chromen-4-ylmethyl)-2-isopropyl-10H-benzo[4,5]imidazo[1,2-a]pyrimidin-4-one (2k) showed minimum binding energy (-9.29
kJ/mol) with ligand efficiency of -0.31. All the ligands were docked deeply within the binding pocket region of 3FDN showing
hydrogen bonds with Ala 213 and Asn 261. The docking study results showed that these derivatives are excellent inhibitor of
human Aurora A kinase target; and also all these docked compounds have good inhibition constant, vdW + Hbond + desolv
energy with best RMSD value. 相似文献
16.
Puerarin belongs to one of the most familiar tradition medicines of China, but adverse effects of puerarin during the clinical treatment have been found for years, the mechanisms of which remain unclear. In this study, toxic mechanisms of puerarin on the structure and function of catalase were studied by multiple spectroscopic techniques, isothermal titration calorimetric measurement, and molecular docking methods in vitro. Results showed puerarin could inhibit the activity of catalase due to direct interactions between puerarin and catalase, resulting in conformational and functional changes of the enzyme. To be specific, puerarin statically quenched catalase fluorescence, bound into the active site channel of catalase, hindered the path of the catalytic substrate (H2O2), affected its skeleton conformation and secondary structure, and interacted with the enzymatically related residues through hydrophobic interactions (ΔH > 0 and ΔS > 0) spontaneously (ΔG < 0). This study illustrates potential adverse effects of puerarin, which should catch more attentions during the clinical diagnosis. 相似文献
17.
Katarzyna Jakimiuk Suat Sari Robert Milewski Claudiu T. Supuran Didem hretolu Micha Tomczyk 《Journal of enzyme inhibition and medicinal chemistry》2022,37(1):421
Flavonoids are widely distributed in plants and constitute the most common polyphenolic phytoconstituents in the human diet. In this study, the in vitro inhibitory activity of 44 different flavonoids (1–44) against mushroom tyrosinase was studied, and an in silico study and type of inhibition for the most active compounds were evaluated too. Tyrosinase inhibitors block melanogenesis and take part in melanin production or distribution leading to pigmentation diseases. The in vitro study showed that quercetin was a competitive inhibitor (IC50=44.38 ± 0.13 µM) and achieved higher antityrosinase activity than the control inhibitor kojic acid. The in silico results highlight the importance of the flavonoid core with a hydroxyl at C7 as a strong contributor of interference with tyrosinase activity. According to the developed statistical model, the activity of molecules depends on hydroxylation at C3 and methylation at C8, C7, and C3 in the benzo-γ-pyrane ring of the flavonoids. 相似文献
18.
Urmila Saha Asma Yasmeen Khan Sutanwi Bhuiya Suman Das Gaetano Fiorillo Paolo Lombardi 《Journal of biomolecular structure & dynamics》2019,37(6):1375-1389
Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M?1, and that of BER was (0.98 ± 0.03) × 105 M?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands. 相似文献
19.
《Bioorganic & medicinal chemistry letters》2014,24(15):3278-3284
A novel series of 2-pyrazoline and hydrazone derivatives were synthesized and investigated for their human monoamine oxidase (hMAO) inhibitory activity. All compounds inhibited the hMAO isoforms (MAO-A or MAO-B) competitively and reversibly. With the exception of 5i, which was a selective MAO-B inhibitor, all derivatives inhibited hMAO-A potently and selectively. According to the experimental Ki values, compounds 6e and 6h exhibited the highest inhibitory activity towards the hMAO-A, whereas compound 5j, which carries a bromine atom at R4 of the A ring of the pyrazoline, appeared to be the most selective MAO-A inhibitor. Tested compounds were docked computationally into the active site of the hMAO-A and hMAO-B isozymes. The computationally obtained results were in good agreement with the corresponding experimental values. 相似文献
20.
We have synthesized oxadiazole derivatives (1–16), characterized by 1H NMR, 13C NMR and HREI-MS and screened for thymidine phosphorylase inhibitory potential. All derivatives display varied degree of thymidine phosphorylase inhibition in the range of 1.10 ± 0.05 to 49.60 ± 1.30 μM when compared with the standard inhibitor 7-Deazaxanthine having an IC50 value 38.68 ± 1.12 μM. Structure activity relationships (SAR) has been established for all compounds to explore the role of substitution and nature of functional group attached to the phenyl ring which applies imperious effect on thymidine phosphorylase activity. Molecular docking study was performed to understand the binding interaction of the most active derivatives with enzyme active site. 相似文献