Determination of thermodynamic parameters for HIV DIS type loop-loop kissing complexes

The HIV-1 type dimerization initiation signal (DIS) loop was used as a starting point for the analysis of the stability of Watson–Crick (WC) base pairs in a tertiary structure context. We used ultraviolet melting to determine thermodynamic parameters for loop–loop tertiary interactions and compared them with regular secondary structure RNA helices of the same sequences. In 1 M Na⁺ the loop–loop interaction of a HIV-1 DIS type pairing is 4 kcal/mol more stable than its sequence in an equivalent regular and isolated RNA helix. This difference is constant and sequence independent, suggesting that the rules governing the stability of WC base pairs in the secondary structure context are also valid for WC base pairs in the tertiary structure context. Moreover, the effect of ion concentration on the stability of loop–loop tertiary interactions differs considerably from that of regular RNA helices. The stabilization by Na⁺ and Mg²⁺ is significantly greater if the base pairing occurs within the context of a loop–loop interaction. The dependence of the structural stability on salt concentration was defined via the slope of a T_m/log [ion] plot. The short base-paired helices are stabilized by 8°C/log [Mg²⁺] or 11°C/log [Na⁺], whereas base-paired helices forming tertiary loop–loop interactions are stabilized by 16°C/log [Mg²⁺] and 26°C/log [Na⁺]. The different dependence on ionic strength that is observed might reflect the contribution of specific divalent ion binding to the preformation of the hairpin loops poised for the tertiary kissing loop–loop contacts.     

Salt-Dependent Folding Energy Landscape of RNA Three-Way Junction

RNAs are highly negatively charged chain molecules. Metal ions play a crucial role in RNA folding stability and conformational changes. In this work, we employ the recently developed tightly bound ion (TBI) model, which accounts for the correlation between ions and the fluctuation of ion distributions, to investigate the ion-dependent free energy landscape for the three-way RNA junction in a 16S rRNA domain. The predicted electrostatic free energy landscape suggests that 1), ion-mediated electrostatic interactions cause an ensemble of unfolded conformations narrowly populated around the maximally extended structure; and 2), Mg²⁺ ion-induced correlation effects help bring the helices to the folded state. Nonelectrostatic interactions, such as noncanonical interactions within the junctions and between junctions and helix stems, might further limit the conformational diversity of the unfolded state, resulting in a more ordered unfolded state than the one predicted from the electrostatic effect. Moreover, the folded state is predominantly stabilized by the coaxial stacking force. The TBI-predicted folding stability agrees well with the experimental measurements for the different Na⁺ and Mg²⁺ ion concentrations. For Mg²⁺ solutions, the TBI model, which accounts for the Mg²⁺ ion correlation effect, gives more improved predictions than the Poisson-Boltzmann theory, which tends to underestimate the role of Mg²⁺ in stabilizing the folded structure. Detailed control tests indicate that the dominant ion correlation effect comes from the charge-charge Coulombic correlation rather than the size (excluded volume) correlation between the ions. Furthermore, the model gives quantitative predictions for the ion size effect in the folding energy landscape and folding cooperativity.     

Electrostatic free energy landscapes for DNA helix bending

Nucleic acids are highly charged polyanionic molecules; thus, the ionic conditions are crucial for nucleic acid structural changes such as bending. We use the tightly bound ion theory, which explicitly accounts for the correlation and ensemble effects for counterions, to calculate the electrostatic free energy landscapes for DNA helix bending. The electrostatic free energy landscapes show that DNA bending energy is strongly dependent on ion concentration, valency, and size. In a Na⁺ solution, DNA bending is electrostatically unfavorable because of the strong charge repulsion on backbone. With the increase of the Na⁺ concentration, the electrostatic bending repulsion is reduced and thus the bending becomes less unfavorable. In contrast, in an Mg²⁺ solution, ion correlation induces a possible attractive force between the different parts of the helical strands, resulting in bending. The electrostatically most favorable and unfavorable bending directions are toward the major and minor grooves, respectively. Decreasing the size of the divalent ions enhances the electrostatic bending attraction, causing an increased bending angle, and shifts the most favorable bending to the direction toward the minor groove. The microscopic analysis on ion-binding distribution reveals that the divalent ion-induced helix bending attraction may come from the correlated distribution of the ions across the grooves in the bending direction.     

88 Comparison of monovalent and divalent ion distributions around a DNA duplex with molecular dynamic simulation and Poisson–Boltzmann approach

Ion interactions with nucleic acids (both DNA and RNA) are an important and evolving field of investigation. Positively charged cations may interact with highly negatively charged nucleic acids via simple electrostatic interactions to help screen the electrostatic repulsion along the nucleic acids and assist their folding and/or compaction. Cations may also bind at specific sites and become integral parts of the structures, possibly playing important enzymatic roles. Two popular methods for computationally exploring a nucleic acid’s ion atmosphere are atomistic molecular dynamics (MD) simulations and the Poisson–Boltzmann (PB) equation. In general, monovalent ion results obtained from MD simulations and the PB equation agree well with experiment. However, Bai et al. (2007) observed discrepancies between experiment and the PB equation while examining the competitive binding of monovalent and divalent ions, with more significant discrepancies for divalent ions. The goal of this project was to thoroughly investigate monovalent (Na⁺) and divalent (Mg²⁺) ion distributions formed around a DNA duplex with MD simulations and the PB equation. We simulated three different cation concentrations, and matched the equilibrated bulk ion concentration for our theoretical calculations with the PB equation. Based on previous work, our Mg²⁺ ions were fully solvated, the expected state of Mg²⁺ ions when interacting with a duplex, when the production simulations began and remained throughout the simulations (Kirmizialtin, 2010; Robbins, 2012). Na⁺ ion distributions and number of Na⁺ ions within 10?Å of the DNA obtained from our two methods agreed well. However, results differed for Mg²⁺ ions, with a lower number of ions within the cut-off distance obtained from the PB equation when compared to MD simulations. The Mg²⁺ ion distributions around the DNA obtained via the two methods also differed. Based on our results, we conclude that the PB equation will systematically underestimate Mg²⁺ ions bound to DNA, and much of this deviation is attributed to dielectric saturation associated with high valency ions.     

Competitive Binding of Mg2+ and Na+ Ions to Nucleic Acids: From Helices to Tertiary Structures

Nucleic acids generally reside in cellular aqueous solutions with mixed divalent/monovalent ions, and the competitive binding of divalent and monovalent ions is critical to the structures of nucleic acids because of their polyanionic nature. In this work, we first proposed a general and effective method for simulating a nucleic acid in mixed divalent/monovalent ion solutions with desired bulk ion concentrations via molecular dynamics (MD) simulations and investigated the competitive binding of Mg²⁺/Na⁺ ions to various nucleic acids by all-atom MD simulations. The extensive MD-based examinations show that single MD simulations conducted using the proposed method can yield desired bulk divalent/monovalent ion concentrations for various nucleic acids, including RNA tertiary structures. Our comprehensive analyses show that the global binding of Mg²⁺/Na⁺ to a nucleic acid is mainly dependent on its structure compactness, as well as Mg²⁺/Na⁺ concentrations, rather than the specific structure of the nucleic acid. Specifically, the relative global binding of Mg²⁺ over Na⁺ is stronger for a nucleic acid with higher effective surface charge density and higher relative Mg²⁺/Na⁺ concentrations. Furthermore, the local binding of Mg²⁺/Na⁺ to a phosphate of a nucleic acid mainly depends on the local phosphate density in addition to Mg²⁺/Na⁺ concentrations.     

Structural basis of replication origin recognition by the DnaA protein

Escherichia coli DnaA binds to 9 bp sequences (DnaA boxes) in the replication origin, oriC, to form a complex initiating chromosomal DNA replication. In the present study, we determined the crystal structure of its DNA-binding domain (domain IV) complexed with a DnaA box at 2.1 Å resolution. DnaA domain IV contains a helix–turn–helix motif for DNA binding. One helix and a loop of the helix– turn–helix motif are inserted into the major groove and 5 bp (3′ two-thirds of the DnaA box sequence) are recognized through base-specific hydrogen bonds and van der Waals contacts with the C5-methyl groups of thymines. In the minor groove, Arg399, located in the loop adjacent to the motif, recognizes three more base pairs (5′ one-third of the DnaA box sequence) by base-specific hydrogen bonds. DNA bending by ~28° was also observed in the complex. These base-specific interactions explain how DnaA exhibits higher affinity for the strong DnaA boxes (R1, R2 and R4) than the weak DnaA boxes (R3 and M) in the replication origin.     

Mg2+ Dependence of the Structure and Thermodynamics of Wheat Germ and Lupin Seeds 5S rRNA

Abstract

The formation and stability of structural elements in two 5S rRNA molecules from wheat germ (WG) and lupin seeds (LS) as a function of Mg²⁺ concentration in solution was determined using the adiabatic differential scanning microcalorimetry (DSC). The experimentally determined thermodynamic parameters are compared with calculations using thermodynamic databases used for prediction of RNA structure. The 5S rRNA molecules which show minor differences in the nucleotide sequence display very different thermal unfolding profiles (DSC profiles). Numerical deconvolution of DSC profiles provided information about structural transformations that take place in both 5S rRNA molecules. A comparative analysis of DSC data and the theoretical thermodynamic models of the structure was used to establish a relationship between the constituting transitions found in the melting profiles and the unfolding of structural domains of the 5S rRNA and stability of its particular helical elements.

Increased concentration of Mg²⁺ ions induces additional internal interactions stabilising 5S rRNA structures found at low Na⁺ concentrations. Observed conformational transitions suggest a structural model in which the extension of helical region E dominates over the postulated tertiary interaction between hairpin loops. We propose that helix E is stabilised by a sequence of non-standard pairings extending this helix by the formation of tetra loop e and an almost total reduction of loop d between helices E and D. Two hairpin structures in both 5S rRNA molecules: the extended C-C' and the extended E-E'-E” hairpins appear as the most stable elements of the structure. The cooperativity of the unfolding of helixes in these 5S rRNA molecules changes already at 2 mM Mg²⁺.     

Mg2+ as an indicator of nutritional status in marine bacteria

Cells maintain an osmotic pressure essential for growth and division, using organic compatible solutes and inorganic ions. Mg²⁺, which is the most abundant divalent cation in living cells, has not been considered an osmotically important solute. Here we show that under carbon limitation or dormancy native marine bacterial communities have a high cellular concentration of Mg²⁺ (370–940 m) and a low cellular concentration of Na⁺ (50–170 m). With input of organic carbon, the average cellular concentration of Mg²⁺ decreased 6–12-fold, whereas that of Na⁺ increased ca 3–4-fold. The concentration of chlorine, which was in the range of 330–1200 m and was the only inorganic counterion of quantitative significance, balanced and followed changes in the concentration of Mg²⁺+Na⁺. In an osmotically stable environment, like seawater, any major shift in bacterial osmolyte composition should be related to shifts in growth conditions, and replacing organic compatible solutes with inorganic solutes is presumably a favorable strategy when growing in carbon-limited condition. A high concentration of Mg²⁺ in cells may also serve to protect and stabilize macromolecules during periods of non-growth and dormancy. Our results suggest that Mg²⁺ has a major role as osmolyte in marine bacteria, and that the [Mg²⁺]/[Na⁺] ratio is related to its physiological condition and nutritional status. Bacterial degradation is a main sink for dissolved organic carbon in the ocean, and understanding the mechanisms limiting bacterial activity is therefore essential for understanding the oceanic C-cycle. The [Mg²⁺]/[Na⁺]-ratio in cells may provide a physiological proxy for the transitions between C-limited and mineral nutrient-limited bacterial growth in the ocean''s surface layer.     

Salt dependence of nucleic acid hairpin stability

Single-stranded junctions/loops are frequently occurring structural motifs in nucleic acid structures. Due to the polyanionic nature of the nucleic acid backbone, metal ions play a crucial role in the loop stability. Here we use the tightly bound ion theory, which can account for the possible ion correlation and ensemble (fluctuation) effects, to predict the ion-dependence of loop and stem-loop (hairpin) free energies. The predicted loop free energy is a function of the loop length, the loop end-to-end distance, and the ion (Na⁺ and Mg²⁺ in this study) concentrations. Based on the statistical mechanical calculations, we derive a set of empirical formulas for the loop thermodynamic parameters as functions of Na⁺ and Mg²⁺ concentrations. For three specific types of loops, namely, hairpin, bulge, and internal loops, the predicted free energies agree with the experimental data. Further applications of these empirical formulas to RNA and DNA hairpin stability lead to good agreements with the available experimental data. Our results indicate that the ion-dependent loop stability makes significant contribution to the overall ion-dependence of the hairpin stability.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Extended knobs-into-holes packing in classical and complex coiled-coil assemblies

This year marks the 50th anniversary of Crick’s seminal paper on the packing of α-helices into coiled-coil structures. The central tenet of Crick’s work is the interdigitation of side chains, which directs the helix–helix interactions; so called knobs-into-holes packing. Subsequent determinations of coiled-coil-protein sequences and structures confirmed the key features of Crick’s model and established it as a fundamental concept in structural biology. Recently, we developed a program, SOCKET, to recognise knobs-into-holes packing in protein structures, which we applied to the Protein Data Bank to compile a database of coiled-coil structures. In addition to classic structures, the database reveals 4-helix bundles and larger helical assemblies. Here, we describe how the more-complex structures can be understood by extending Crick’s principles for classic coiled coils. In the simplest case, each helix of a 2-stranded structure contributes a single seam of (core) knobs-into-holes to the helical interface. 3-, 4-, and 5-Stranded structures, however, are best considered as rings of helices with cycles of knobs-into-holes. These higher-order oligomers make additional (peripheral) knobs-into-holes that broaden the helical contacts. Combinations of core and peripheral knobs may be assigned to different sequence repeats offset within the same helix. Such multiple repeats lead to multi-faceted helices, which explain structures above dimers. For instance, coiled-coil oligomer state correlates with the offset of the different repeats along a sequence. In addition, certain multi-helix assemblies can be considered as conjoined coiled coils in which multi-faceted helices participate in more than one coiled-coil motif.     

Comparison of monovalent and divalent ion distributions around a DNA duplex with molecular dynamics simulation and a Poisson‐Boltzmann approach

The ion atmosphere created by monovalent (Na⁺) or divalent (Mg²⁺) cations surrounding a B‐form DNA duplex were examined using atomistic molecular dynamics (MD) simulations and the nonlinear Poisson‐Boltzmann (PB) equation. The ion distributions predicted by the two methods were compared using plots of radial and two‐dimensional cation concentrations and by calculating the total number of cations and net solution charge surrounding the DNA. Na⁺ ion distributions near the DNA were more diffuse in PB calculations than in corresponding MD simulations, with PB calculations predicting lower concentrations near DNA groove sites and phosphate groups and a higher concentration in the region between these locations. Other than this difference, the Na⁺ distributions generated by the two methods largely agreed, as both predicted similar locations of high Na⁺ concentration and nearly identical values of the number of cations and the net solution charge at all distances from the DNA. In contrast, there was greater disagreement between the two methods for Mg²⁺ cation concentration profiles, as both the locations and magnitudes of peaks in Mg²⁺ concentration were different. Despite experimental and simulation observations that Mg²⁺ typically maintains its first solvation shell when interacting with nucleic acids, modeling Mg²⁺ as an unsolvated ion during PB calculations improved the agreement of the Mg²⁺ ion atmosphere predicted by the two methods and allowed for values of the number of bound ions and net solution charge surrounding the DNA from PB calculations that approached the values observed in MD simulations. © 2014 Wiley Periodicals, Inc. Biopolymers 101: 834–848, 2014.     

Dissecting a regulatory calcium-binding site of CLC-K kidney chloride channels

The kidney and inner ear CLC-K chloride channels, which are involved in salt absorption and endolymph production, are regulated by extracellular Ca²⁺ in the millimolar concentration range. Recently, Gradogna et al. (2010. J. Gen. Physiol. http://dx.doi.org/10.1085/jgp.201010455) identified a pair of acidic residues (E261 and D278) located in the loop between helices I and J as forming a putative intersubunit Ca²⁺-binding site in hClC-Ka. In this study, we sought to explore the properties of the binding site in more detail. First, we verified that the site is conserved in hClC-Kb and rClC-K1. In addition, we could confer Ca²⁺ sensitivity to the Torpedo marmorata ClC-0 channel by exchanging its I–J loop with that from ClC-Ka, demonstrating a direct role of the loop in Ca²⁺ binding. Based on a structure of a bacterial CLC and a new sequence alignment, we built homology models of ClC-Ka. The models suggested additional amino acids involved in Ca²⁺ binding. Testing mutants of these residues, we could restrict the range of plausible models and positively identify two more residues (E259 and E281) involved in Ca²⁺ coordination. To investigate cation specificity, we applied extracellular Zn²⁺, Mg²⁺, Ba²⁺, Sr²⁺, and Mn²⁺. Zn²⁺ blocks ClC-Ka as well as its Ca²⁺-insensitive mutant, suggesting that Zn²⁺ binds to a different site. Mg²⁺ does not activate CLC-Ks, but the channels are activated by Ba²⁺, Sr²⁺, and Mn²⁺ with a rank order of potency of Ca²⁺ > Ba²⁺ > Sr²⁺ = Mn²⁺ for the human CLC-Ks. Dose–response analysis indicates that the less potent Ba²⁺ has a lower affinity rather than a lower efficacy. Interestingly, rClC-K1 shows an altered rank order (Ca²⁺ > Sr²⁺ >> Ba²⁺), but homology models suggest that residues outside the I–J loop are responsible for this difference. Our detailed characterization of the regulatory Ca²⁺-binding site provides a solid basis for the understanding of the physiological modulation of CLC-K channel function in the kidney and inner ear.     

The Mechanism of Calcium-Induced Inhibition of Muscle Fructose 1,6-bisphosphatase and Destabilization of Glyconeogenic Complex

The mechanism by which calcium inhibits the activity of muscle fructose 1,6-bisphosphatase (FBPase) and destabilizes its interaction with aldolase, regulating glycogen synthesis from non-carbohydrates in skeletal muscle is poorly understood. In the current paper, we demonstrate evidence that Ca²⁺ affects conformation of the catalytic loop 52–72 of muscle FBPase and inhibits its activity by competing with activatory divalent cations, e.g. Mg²⁺ and Zn²⁺. We also propose the molecular mechanism of Ca²⁺-induced destabilization of the aldolase–FBPase interaction, showing that aldolase associates with FBPase in its active form, i.e. with loop 52–72 in the engaged conformation, while Ca²⁺ stabilizes the disengaged-like form of the loop.     

Single-molecule detection of folding and unfolding of the G-quadruplex aptamer in a nanopore nanocavity

Guanine-rich nucleic acids can form G-quadruplexes that are important in gene regulation, biosensor design and nano-structure construction. In this article, we report on the development of a nanopore encapsulating single-molecule method for exploring how cations regulate the folding and unfolding of the G-quadruplex formed by the thrombin-binding aptamer (TBA, GGTTGGTGTGGTTGG). The signature blocks in the nanopore revealed that the G-quadruplex formation is cation-selective. The selectivity sequence is K⁺ > NH₄⁺ ~ Ba²⁺ > Cs⁺ ~ Na⁺ > Li⁺, and G-quadruplex was not detected in Mg²⁺ and Ca²⁺. Ba²⁺ can form a long-lived G-quadruplex with TBA. However, the capability is affected by the cation–DNA interaction. The cation-selective formation of the G-quadruplex is correlated with the G-quadruplex volume, which varies with cation species. The high formation capability of the K⁺-induced G-quadruplex is contributed largely by the slow unfolding reaction. Although the Na⁺- and Li⁺-quadruplexes feature similar equilibrium properties, they undergo radically different pathways. The Na⁺-quadruplex folds and unfolds most rapidly, while the Li⁺-quadruplex performs both reactions at the slowest rates. Understanding these ion-regulated properties of oligonucleotides is beneficial for constructing fine-tuned biosensors and nano-structures. The methodology in this work can be used for studying other quadruplexes and protein–aptamer interactions.     

NMR structure and Mg2+ binding of an RNA segment that underlies the L7/L12 stalk in the E.coli 50S ribosomal subunit

Helix 42 of Domain II of Escherichia coli 23S ribosomal RNA underlies the L7/L12 stalk in the ribosome and may be significant in positioning this feature relative to the rest of the 50S ribosomal subunit. Unlike the Haloarcula marismortui and Deinococcus radiodurans examples, the lower portion of helix 42 in E.coli contains two consecutive G•A oppositions with both adenines on the same side of the stem. Herein, the structure of an analog of positions 1037–1043 and 1112–1118 in the helix 42 region is reported. NMR spectra and structure calculations support a cis Watson–Crick/Watson–Crick (cis W.C.) G•A conformation for the tandem (G•A)₂ in the analog and a minimally perturbed helical duplex stem. Mg²⁺ titration studies imply that the cis W.C. geometry of the tandem (G•A)₂ probably allows O6 of G20 and N1 of A4 to coordinate with a Mg²⁺ ion as indicated by the largest chemical shift changes associated with the imino group of G20 and the H8 of G20 and A4. A cross-strand bridging Mg²⁺ coordination has also been found in a different sequence context in the crystal structure of H.marismortui 23S rRNA, and therefore it may be a rare but general motif in Mg²⁺ coordination.     

Thermodynamic analysis of ligand binding and ligand binding-induced tertiary structure formation by the thiamine pyrophosphate riboswitch

The thi-box riboswitch regulates gene expression in response to the intracellular concentration of thiamine pyrophosphate (TPP) in archaea, bacteria, and eukarya. To complement previous biochemical, genetic, and structural studies of this phylogenetically widespread RNA domain, we have characterized its interaction with TPP by isothermal titration calorimetry. This shows that TPP binding is highly dependent on Mg²⁺ concentration. The dissociation constant decreases from ∼200 nM at 0.5 mM Mg²⁺ concentration to ∼9 nM at 2.5 mM Mg²⁺ concentration. Binding is enthalpically driven, but the unfavorable entropy of binding decreases as Mg²⁺ concentration rises, suggesting that divalent cations serve to pre-organize the RNA. Mutagenesis, biochemical analysis, and a new crystal structure of the riboswitch suggest that a critical element that participates in organizing the riboswitch structure is the tertiary interaction formed between the P3 and L5 regions. This tertiary contact is distant from the TPP binding site, but calorimetric analysis reveals that even subtle mutations in L5 can have readily detectable effects on TPP binding. The thermodynamic signatures of these mutations, namely decreased favorable enthalpy of binding and small effects on entropy of binding, are consistent with the P3–L5 association contributing allosterically to TPP-induced compaction of the RNA.     

Hinge stiffness is a barrier to RNA folding

Cation-mediated RNA folding from extended to compact, biologically active conformations relies on a temporal balance of forces. The Mg^2 +-mediated folding of the Tetrahymena thermophila ribozyme is characterized by rapid nonspecific collapse followed by tertiary-contact-induced compaction. This article focuses on an autonomously folding portion of the Tetrahymena ribozyme, its P4-P6 domain, in order to probe one facet of the rapid collapse: chain flexibility. The time evolution of P4-P6 folding was followed by global and local measures as a function of Mg^2 + concentration. While all concentrations of Mg^2 + studied are sufficient to screen the charge on the helices, the rates of compaction and tertiary contact formation diverge as the concentration of Mg^2 + increases; collapse is greatly accelerated by Mg^2 +, while tertiary contact formation is not. These studies highlight the importance of chain stiffness to RNA folding; at 10 mM Mg^2 +, a stiff hinge limits the rate of P4-P6 folding. At higher magnesium concentrations, the rate-limiting step shifts from hinge bending to tertiary contact formation.     

DNA-binding mechanism of the Escherichia coli Ada O(6)-alkylguanine-DNA alkyltransferase

The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O⁶-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O⁶-methylguanine (O⁶meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain.